Clustered regularly interspaced short palindromic repeats (CRISPR / LbCas12a) system-based vector for resisting infection of various geminiviruses as well as construction method and application

Abstract

The invention discloses a CRISPR / LbCas12a (clustered regularly interspaced short palindromic repeats / LbCas12a) system-based vector for resisting infection of various geminiviruses as well as a construction method and application of the CRISPR / LbCas12a system-based vector. A pCambia1300: T5exo-LbCas12-vir vector is constructed aiming at replication key sites of three geminiviruses, namely a tomato yellow leaf curl virus (TYLCV), a Yunnan tomato leaf curl virus (TLCYnV and a tobacco stem curl virus (TbCSV). Aiming at the most common and most harmful three geminiviruses in the fields of two important crops of tobacco and tomato in China, the three crRNAs are constructed on the same vector at the same time, so that one set of vector can resist the three geminiviruses at the same time, and a new strategy is provided for preventing and controlling a plurality of geminiviruses.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a vector, construction method and application thereof that resists infection by multiple geminiviruses based on a CRISPR / LbCas12a system. Background Art

[0002] Geminiviruses are single-stranded circular DNA viruses that are widely distributed around the world. Currently, the International Committee on Taxonomy of Viruses classifies Geminiviruses into 14 genera based on the host range, insect vectors, and genome structure of the virus, and has identified more than 520 species of Geminiviruses. Geminiviruses can infect economic and food crops including tobacco, tomatoes, cotton, corn, wheat, cassava, etc., seriously affecting the yield and quality of crops and causing devastating damage. Currently, many crops can be infected with multiple Geminiviruses at the same time, so it is urgent to create highly effective and broad-spectrum anti-geminivirus materials.

[0003] Although many disease-resistant genes have been screened out in host plants at this stage, overexpression of certain endogenous genes or mutant materials will cause dwarfing of plants, low fruiting rate and thus affect yield, so they cannot be put into actual production applications. Or the Cas9 protein can be used to cut the CP protein or IR region of the Gemini virus to achieve an antiviral effect, but there is also a risk of virus escape, resulting in more mutants, which will bring more difficulties to future virus prevention and control.

[0004] LbCas12a is a class II type V CRISPR nuclease, which is significantly different from the Cas9 protein. CRISPR / Cas12a can process crRNA by itself, and can specifically recognize and cut thymine (T)-rich PAM sites, while the Cas9 protein recognizes and cuts guanine (G)-rich PAM sites. Secondly, CRISPR / Cas12a cuts to produce sticky ends and larger deletion mutations, while Cas9 cuts to produce flat ends, most of which cause the insertion or deletion of several bases. Therefore, the mechanism of action of CRISPR / Cas12a is simpler and more conducive to multi-gene editing, which has a stronger advantage in achieving resistance to multiple viruses. In addition, LbCas12a can add more editing sites, so that while reducing the escape of geminiviruses from gene editing, it can also design crRNA for a variety of common geminiviruses at the same time, achieving the purpose of broad-spectrum resistance to geminiviruses, and providing new strategies and ideas for subsequent resistance genetic breeding. Summary of the invention

[0005] The purpose of the present invention is to provide a vector and construction method and application of multiple Gemini virus infection resistance based on CRISPR / LbCas12a system. The present invention designs specific crRNA by designing the replication key sites of three Gemini viruses, Tomato Yellow Leaf Curl Virus (TYLCV), Yunnan Tomato Leaf Curl Virus (TLCYnV) and Tobacco Stem Curl Virus (TbCSV), and constructs an Agrobacterium-infectious cloning vector using LbCas12a to resist three Gemini viruses.

[0006] Specifically, the technical solution adopted by the present invention is as follows:

[0007] A method for constructing a vector resistant to infection by multiple geminiviruses based on the CRISPR / LbCas12a system is presented. The pCambia1300:T5exo-LbCas12-vir vector is constructed targeting the key replication sites of three geminiviruses: Tomato yellow leaf curl virus TYLCV, Yunnan tomato leaf curl virus TLCYnV, and tobacco stem curl virus TbCSV.

[0008] Specifically, crRNA was designed near the key replication sites of three geminiviruses, namely, tomato yellow leaf curl virus TYLCV, Yunnan tomato leaf curl virus TLCYnV and tobacco stem curl virus TbCSV, and the three crRNA sequences were separated and connected in series using hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV to artificially synthesize the sequence, which was named vir and its sequence is shown in SEQ ID NO: 1.

[0009] Among them, the construction method of the pCambia1300:T5exo-LbCas12-vir recombinant vector is specifically as follows: artificially synthesize the vir gene fragment, clone it into pUC57, name it pUC57:vir, use Bsa I and Bcu I to double-digest the plasmids pUC57:vir and pCambia1300:T5exo-LbCas12, respectively recover the 420bp vir fragment and the 16kb vector backbone, and use T4 ligase to connect the 420bp vir fragment to the linearized pCambia1300 vector backbone; after the plasmid is sequenced correctly, it is successfully verified and then transformed into Agrobacterium for preservation.

[0010] Among them, the primers used for positive screening of vector pCambia1300:T5exo-LbCas12-vir are Vir-1-F1 / Y16-R1, and its sequence is shown in SEQ ID NO: 2-3;

[0011] Vir-1-F1: ATGTGGACACCAAATGGCATAA;

[0012] Y16-R1:ACTTTGTACAAGAAAGCTGGGT;

[0013] The correct clone was expanded and cultured, the plasmid was extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-vir vector.

[0014] Furthermore, the construction method of the pCambia1300:T5exo-LbCas12 vector is:

[0015] ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest GreenBuffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0016] ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequences of LbCas12a and 1300-LbCas12a-F1 / R1 are shown in SEQ ID NO: 4-6:

[0017] ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min;

[0018] ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0019] Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 7-8;

[0020] The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 9;

[0021] So far, the vector containing pCambia1300-ccdb-LbCas12 is obtained.

[0022] ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0023] ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by gel cutting; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 10-12:

[0024] ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min;

[0025] ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0026] Primer 35S-F / Y16-R1 was identified, and the correct clone was expanded, the plasmid was extracted, and sequenced with the Nos-R1 primer;

[0027] Thus, the pENTR-Y16 vector was obtained.

[0028] ⑨1μg pENTR-Y16 plasmid, ApaⅠ1μL, 10×FastDigest Green Buffer 5μL; the remaining system was supplemented with ddH2O; enzyme digestion was performed at 37℃ for 30min, then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway's LR reaction to obtain the pCambia1300:LbCas12 vector.

[0029] ⑩1 μg pCambia1300:LbCas12 plasmid, 1 μL BamH I and 1 μL Bcu I, 5 μL 10×FastDigestGreen Buffer; the remaining system was supplemented with ddH2O; enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and stored in a freezer at -20°C;

[0030] The primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 were used to amplify the T5 nuclease and LbCas12a nucleotide sequences, respectively, to obtain two specific PCR bands, respectively; after agarose gel electrophoresis, the specific PCR target bands were recovered and purified by gel cutting; the sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NOs: 13-16;

[0031] 3 μL of the backbone of pCambia1300:LbCas12 plasmid was digested with BamH I and Bcu I, 1 μL of each of the amplified fragments of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; reacted at 50°C for 30 min; T5 nuclease was fused to the 5' end of LbCas12a, and the sequence of T5exo was shown in SEQ ID NO: 17;

[0032] 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the target site was connected to the vector;

[0033] Primer 35S-F / 1300-T5-R1 was identified, the correct clone was expanded, the plasmid was extracted, and sequenced with Nos-R1 primer to obtain the pCambia1300:T5exo-LbCas12 vector.

[0034] The CRISPR / LbCas12a system-based anti-multiple Geminivirus infection vector pCambia1300:T5exo-LbCas12-vir constructed by the above method of the present invention can simultaneously achieve significant anti-geminivirus functions against three Geminiviruses: Tomato Yellow Leaf Curl Virus (TYLCV), Yunnan Tomato Leaf Curl Virus (TLCYnV) and Tobacco Curly Stem Virus (TbCSV).

[0035] Compared with the prior art, the outstanding effects of the present invention are:

[0036] The present invention designs crRNAs for the key replication sites of the three most common and most harmful geminiviruses in the fields of two important crops, tobacco and tomato, in my country, including tomato yellow leaf curl virus (TYLCV), Yunnan tomato leaf curl virus (TLCYnV) and tobacco stem curl virus TbCSV, and constructs the three crRNAs simultaneously in the same vector, so that a set of vectors can simultaneously resist the above three geminiviruses, providing a new strategy for the prevention and control of multiple geminiviruses.

[0037] This vector uses the editing characteristics of LbCas12, which is highly efficient, has a large deletion fragment, and has low off-target efficiency, and will not cause the risk of virus escape editing. This vector designs crRNA for the three most serious Gemini viruses in the field, and uses CRISPR technology to simultaneously edit multiple Gemini virus sequences and give them broad-spectrum resistance. This vector can simultaneously resist three Gemini viruses in a broad spectrum, and can be used in a variety of host crops such as tobacco and tomatoes to resist infection by multiple Gemini viruses.

[0038] The following is a further description of the CRISPR / LbCas12a system-based anti-multiple Gemini virus infection vector, construction method and application of the present invention in combination with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram for constructing vectors based on the CRISPR / LbCas12a system to resist infection by multiple geminiviruses;

[0040] Figure 2 (a) Symptoms of N. benthamiana leaves 10 days after infiltration (10 dpi) after empty vector pCambia1300 was used as MOCK, pCambia1300 and pCambia1300:T5exo-LbCas12-vir infectious clones were mixed with TYLCV infectious clones.

[0041] (b) Total DNA from systemic leaves was extracted 7 days after inoculation, and the accumulation level of TYLCV in (a) was detected by qPCR using the CP protein encoded by TYLCV as a reference.

[0042] Figure 3 (a) Symptoms of N. benthamiana leaves 15 days after infiltration (15 dpi) after empty vector pCambia1300 was used as MOCK, pCambia1300 and pCambia1300:T5exo-LbCas12-vir infectious clones were mixed with TLCYnV infectious clones.

[0043] (b) Total DNA from systemic leaves was extracted 7 days after inoculation, and the accumulation level of TLCYnV in (a) was detected by qPCR using the CP protein encoded by TLCYnV as a reference.

[0044] Figure 4 (a) Symptoms of N. benthamiana leaves 10 days after infiltration (10 dpi) after empty vector pCambia1300 was used as MOCK, pCambia1300 and pCambia1300:T5exo-LbCas12-vir infectious clones were mixed with TbCSV infectious clones respectively.

[0045] (b) Total DNA from systemic leaves was extracted 7 days after inoculation, and the accumulation level of TbCSV in (a) was detected by qPCR using the CP protein encoded by TbCSV as a reference. DETAILED DESCRIPTION

[0046] like Figure 1 As shown, a method for constructing a vector (pCambia1300: T5exo-LbCas12-vir) based on the CRISPR / LbCas12a system to resist infection by multiple geminiviruses specifically comprises the following steps:

[0047] (1) crRNAs were designed near the key replication sites of three geminiviruses, namely, tomato yellow leaf curl virus (TYLCV), Yunnan tomato leaf curl virus (TLCYnV), and tobacco stem curl virus (TbCSV); and the three crRNA sequences were separated by hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV and connected in series to artificially synthesize the sequence, which was named vir and its sequence is shown in SEQ ID NO: 1.

[0048] (2) Construction of pCambia1300:T5exo-LbCas12 vector:

[0049] ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest GreenBuffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0050] ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequences of LbCas12a and 1300-LbCas12a-F1 / R1 are shown in SEQ ID NO: 4-6:

[0051] ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min;

[0052] ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0053] Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 7-8;

[0054] The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 9;

[0055] So far, the vector containing pCambia1300-ccdb-LbCas12 is obtained.

[0056] ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃;

[0057] ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by gel cutting; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 10-12:

[0058] 35s-HDV-F1: AAAAAGCAGGCTCCACCATGGatggccccgggcctgcagg

[0059] 35s-HDV-R1:CTCGAGTGGCGGCCGCGAATTCccgatctagtaacatagatgacaccg

[0060] ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min;

[0061] ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector;

[0062] Primer 35S-F / Y16-R1 was identified, and the correct clone was expanded, the plasmid was extracted, and sequenced with the Nos-R1 primer;

[0063] Thus, the pENTR-Y16 vector was obtained.

[0064] ⑨1μg pENTR-Y16 plasmid, ApaⅠ1μL, 10×FastDigest Green Buffer 5μL; the remaining system was supplemented with ddH2O; enzyme digestion was performed at 37℃ for 30min, then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway's LR reaction to obtain the pCambia1300:LbCas12 vector.

[0065] ⑩1 μg pCambia1300:LbCas12 plasmid, 1 μL BamH I and 1 μL Bcu I, 5 μL 10×FastDigestGreen Buffer; the remaining system was supplemented with ddH2O; enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and stored in a freezer at -20°C;

[0066] The primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 were used to amplify the T5 nuclease and LbCas12a nucleotide sequences, respectively, and two specific PCR bands were obtained. After agarose gel electrophoresis, the specific PCR target bands were recovered and purified by gel cutting. The sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NOs: 13-16:

[0067] 1300-T5-F1:

[0068] AAATTTTCACCATTTACGAACGATAGGATCCCGCCACCATGGCCGACTATAAGGACCACGA CGGAGA;

[0069] 1300-T5-R1:

[0070] TATAACCGACCTTTCTTTTTTCTTTGGGGCCATATCACTTCCGCCAGAAGAACCT;

[0071] 1300-T5-F2:

[0072] AGGTTCTTCTGGCGGAAGTGATATGGCCCCAAAGAAAAAAAGAAAGGTCGGTATA;

[0073] 1300-T5-R2:

[0074] GATCGGGGAAATTCGAGCTCactagtCTTCTTTTTTTTTGCCTGGCCTGC;

[0075] 3 μL of the backbone of pCambia1300:LbCas12 plasmid was digested with BamH I and Bcu I, 1 μL of each of the amplified fragments of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; reacted at 50°C for 30 min; T5 nuclease (T5exo) was fused to the 5' end of LbCas12a, and the sequence of T5exo is shown in SEQ ID NO: 17;

[0076] 10 μL of the ligation product was transformed into E. coli DH5α, and ampicillin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the fragment was connected to the vector;

[0077] Primer 35S-F / 1300-T5-R1 was used for identification, and the correct clone was expanded, the plasmid was extracted, and sequenced using the Nos-R1 primer;

[0078] So far, the pCambia1300:T5exo-LbCas12 vector is obtained.

[0079] (3) The construction method of the recombinant vector of pCambia1300:T5exo-LbCas12-vir is as follows: artificially synthesize the vir gene fragment and clone it into pUC57, named pUC57:vir, use Bsa I and Bcu I to double-digest the plasmids pUC57:vir and pCambia1300:T5exo-LbCas12, respectively, recover the 420bp vir fragment and the 16kb vector backbone, and use T4 ligase to connect the 420bp vir fragment to the linearized pCambia1300 vector backbone; after transformation of Escherichia coli, apply it on the corresponding resistance culture medium; the primer used for positive screening is Vir-1-F1 / Y16-R1, the sequence of which is shown in SEQ ID NO: 2-3;

[0080] Vir-1-F1: ATGTGGACACCAAATGGCATAA;

[0081] Y16-R1:ACTTTGTACAAGAAAGCTGGGT;

[0082] The correct clones were expanded and cultured, plasmids were extracted, and sequenced with Y16-R1 primers. After the plasmid sequencing was correct, it was successfully verified and transferred to Agrobacterium for preservation.

[0083] (4) The constructed Agrobacterium-infectious clones were inoculated into Nicotiana benthamiana leaves simultaneously with Agrobacterium-infectious of three geminiviruses, namely, Tomato yellow leaf curl virus (TYLCV), Tomato leaf curl Yunnan virus (TLCYnV), and Tobacco stem curl virus (TbCSV). After 7 days, the phenotype and disease symptoms of the systemic leaves were observed and samples were taken.

[0084] (5) After sampling, molecular testing is performed and qPCR is used to detect changes in viral accumulation.

[0085] (6) The primers for detecting TYLCV are qPCR-TYLCV-F / R, and the sequences are shown in SEQ ID NOs: 18-19; the primers for detecting TLCYnV are qPCR-Y194A-F / R, and the sequences are shown in SEQ ID NOs: 20-21; the primers for detecting TbCSV are qPCR-Y35A-F / R, and the sequences are shown in SEQ ID NOs: 22-23.

[0086] qPCR-TYLCV-F:CCCTCAAAGCTCTATGGCAATCGG

[0087] qPCR-TYLCV-R:CAGTGACGTCTGTGGAACCCTC

[0088] qPCR-Y194-F:ACAAATATGGAACAACAGGC

[0089] qPCR-Y194-R: ACCAACTCGATGCGTAATAC

[0090] qPCR-Y35-F: ATATGTGAGCCGTGCTGCTG

[0091] qPCR-Y35-R:AGTTCCACCGCGTAACATCAC

[0092] like Figure 2-4 As shown, qPCR experiments determined that the constructed pCambia1300:T5exo-LbCas12-vir vector had resistance to tomato yellow leaf curl virus (TYLCV), Yunnan tomato leaf curl virus (TLCYnV) and tobacco curly stem virus (TbCSV). Compared with MOCK, the accumulation of TYLCV, TLCYnV and TbCSV viruses was significantly reduced.

[0093] The above results all show that pCambia1300:T5exo-LbCas12-vir can effectively inhibit the infection and viral accumulation levels of TYLCV, TLCYnV and TbCSV viruses at the same time, indicating that the vector constructed based on the CRISPR / LbCas12a system of the present invention can effectively inhibit the infection of Gemini viruses.

[0094] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing a vector resistant to multiple geminivirus infection based on the CRISPR / LbCas12a system, characterized in that: The pCambia1300:T5exo-LbCas12-vir vector was constructed targeting the replication key sites of three geminiviruses: Tomato yellow leaf curl virus TYLCV, Yunnan tomato leaf curl virus TLCYnV and tobacco stem curl virus TbCSV.

2. The method for constructing a vector resistant to multiple geminivirus infection based on the CRISPR / LbCas12a system according to claim 1, characterized in that: crRNA was designed near the key replication sites of three geminiviruses, namely, tomato yellow leaf curl virus TYLCV, Yunnan tomato leaf curl virus TLCYnV and tobacco stem curl virus TbCSV, and the three crRNA sequences were separated by hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV and connected in series to artificially synthesize the sequence, which was named vir and its sequence is shown in SEQ ID NO:

1.

3. The method for constructing a vector resistant to multiple Gemini viruses based on the CRISPR / LbCas12a system according to claim 2, characterized in that: The construction method of the pCambia1300:T5exo-LbCas12-vir recombinant vector is specifically as follows: artificially synthesizing the vir gene fragment, cloning it into pUC57, and naming it pUC57:vir, using Bsa I and Bcu I to double-digest the plasmids pUC57:vir and pCambia1300:T5exo-LbCas12, respectively recovering the 420bp vir fragment and the 16kb vector backbone, and using T4 ligase to connect the 420bp vir fragment to the pCambia1300 vector backbone; After the plasmid is sequenced correctly, it is successfully verified and transferred to Agrobacterium for preservation.

4. The method for constructing a vector resistant to multiple Gemini viruses based on the CRISPR / LbCas12a system according to claim 3, characterized in that: The primers used for positive screening of vector pCambia1300:T5exo-LbCas12-vir were Vir-1-F1 / Y16-R1, and the sequence thereof is shown in SEQ ID NO: 2-3; Vir-1-F1: ATGTGGACACCAAATGGCATAA; Y16-R1:ACTTTGTACAAGAAAGCTGGGT; The correct clone was expanded and cultured, the plasmid was extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-vir vector.

5. The method for constructing a vector resistant to multiple Gemini viruses based on the CRISPR / LbCas12a system according to claim 3, characterized in that: The construction method of the pCambia1300:T5exo-LbCas12 vector is: ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequences of LbCas12a and 1300-LbCas12a-F1 / R1 are shown in SEQ ID NO: 4-6: ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 7-8; The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 9; So far, the pCambia1300-ccdb-LbCas12 vector is obtained; ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by gel cutting; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 10-12: ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Primer 35S-F / Y16-R1 was identified, and the correct clone was expanded, the plasmid was extracted, and sequenced with the Nos-R1 primer; Thus, the pENTR-Y16 vector was obtained; ⑨1 μg pENTR-Y16 plasmid, 1 μL ApaⅠ, 5 μL 10× FastDigest Green Buffer; the remaining system was supplemented with ddH2O; restriction enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway LR reaction to obtain pCambia1300:LbCas12 vector; ⑩1 μg pCambia1300:LbCas12 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest GreenBuffer; the remaining system was supplemented with ddH2O; digestion was performed at 37℃ for 30 min, and then the DNA was purified and stored in a freezer at -20℃; The primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 were used to amplify the T5 nuclease and LbCas12a nucleotide sequences, respectively, to obtain two specific PCR bands, respectively; after agarose gel electrophoresis, the specific PCR target bands were recovered and purified by gel cutting; the sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NOs: 13-16; 3 μL of the backbone of pCambia1300:LbCas12 plasmid was digested with BamH I and Bcu I, 1 μL of each of the amplified fragments of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; reacted at 50°C for 30 min; T5 nuclease was fused to the 5' end of LbCas12a, and the sequence of T5exo is shown in SEQ ID NO: 17; 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the fragment was connected to the vector; Primer 35S-F / 1300-T5-R1 was used for identification, and the correct clone was expanded, the plasmid was extracted, and sequenced using the Nos-R1 primer; So far, the pCambia1300:T5exo-LbCas12 vector is obtained.

6. A recombinant vector based on the CRISPR / LbCas12a system that resists infection by multiple geminiviruses obtained by the construction method described in any one of claims 1 to 5.

7. Use of the vector according to claim 6 in resisting infection by multiple geminiviruses, characterized in that: It can simultaneously resist infection by three twin viruses: Tomato yellow leaf curl virus TYLCV, Yunnan tomato leaf curl virus TLCYnV and tobacco stem curl virus TbCSV.

Images