Vector for inhibiting geminivirus infection based on CRISPR / LbCas12a system and its construction method and application

Abstract

The present invention discloses a vector for inhibiting infection of geminiviruses based on CRISPR / LbCas12a system, a construction method and an application thereof, wherein the geminiviruses are TYLCCNV and its accompanying satellite virus TYLCCNB; including at least one of pCambia1300:LbCas12‑fgY10A and pCambia1300:T5exo‑LbCas12‑fgY10A vectors constructed for the key replication sites of TYLCCNV, pCambia1300:LbCas12‑fgY10b and pCambia1300:T5exo‑LbCas12‑fgY10b vectors constructed for the key replication sites of TYLCCNB, and pCambia1300:T5exo‑LbCas12‑Y10*4 vectors constructed for the key replication sites of TYLCCNV / TYLCCNB. The present invention designs crRNA for the key replication sites of geminiviruses, which has better anti-disease activity than the currently commonly used CRISPR / Cas9 system.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and particularly to a vector for inhibiting geminivirus infection based on the CRISPR LbCas12a system, a construction method and an application thereof. Background Art

[0002] Geminiviruses are a class of single-stranded circular DNA viruses widely existing worldwide, which can infect economic and food crops including tobacco, tomato, cotton, corn, wheat, soybean, cassava, etc., seriously affecting the yield and quality of crops and causing huge economic losses globally. When plants are infected with geminiviruses, especially when solanaceous plants are infected with TYLCCNV / TYLCCNB, they will show severe symptoms including plant dwarfing, leaf wrinkling, yellowing, stem bending, etc., resulting in huge yield losses. Currently, the prevention of geminiviruses in the field mainly focuses on prevention, and the occurrence of virus diseases is reduced by strengthening management and controlling the transmission routes. However, in the past few decades, the economic losses caused by geminiviruses have reached tens of billions of US dollars. Therefore, developing highly efficient antiviral varieties is crucial for preventing the occurrence of diseases.

[0003] LbCas12a is a type II-V CRISPR nuclease, a class of endonucleases mediated by a single crRNA. Different from the Cas9 protein, LbCas12a can specifically recognize and cleave sites rich in thymine (T) PAM, and cause larger fragment deletions of the genomic sequences near the target by generating sticky ends, indicating that it is difficult for the cut virus to recombine and achieve effective infection.

[0004] At present, the prevention and control measures for geminiviruses in actual field production are very limited, and there are the following limitations and problems:

[0005] (1) At present, the prevention and control of geminiviruses mainly focuses on using chemical pesticides to control the virus-transmitting insects of geminiviruses. The extensive use of chemical pesticides not only increases the drug resistance of the virus-transmitting vector Bemisia tabaci, but also causes great harm to non-target organisms and the field ecological environment, resulting in pesticide residues;

[0006] (2) In the field, measures such as timely pulling out diseased plants in the field and increasing the application of chemical fertilizers to improve growth are simultaneously adopted for prevention and control. These field measures waste a lot of labor and time;

[0007] (3) At present, the progress of screening geminivirus-resistant crop varieties by traditional hybridization techniques is slow, which is likely to cause changes in the agronomic traits of offspring plants and reduce the quality and yield of crops;

[0008] (4) In the currently widely used CRISPR / Cas9 system, the knockout fragment of the target virus sequence against geminiviruses is small, and there is a risk of viral sequence mutation escaping editing and recombination into new viruses, posing a greater biosafety hazard.

[0009] Many replication key sites are contained in the geminivirus genome, and these motifs are crucial for the replication of geminiviruses. Therefore, in the present invention, LbCas12a is used to perform targeted editing on them. By knocking out a larger range of geminivirus genome sequences, the replication process of geminiviruses is disrupted, thereby enhancing the anti-geminivirus effect. Summary of the Invention

[0010] The object of the present invention is to provide a vector for inhibiting geminivirus infection based on the CRISPR LbCas12a system, its construction method and application. In the present invention, specific crRNAs are designed against the replication key motifs of TYLCCNV / TYLCCNB, and an Agrobacterium tumefaciens infectious clone vector using LbCas12a to resist geminiviruses is constructed.

[0011] Specifically, the technical solution adopted by the present invention is as follows:

[0012] A vector for inhibiting geminivirus infection based on the CRISPR / LbCas12a system, wherein the geminivirus is TYLCCNV / TYLCCNB; the vectors are pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, pCambia1300:T5exo-LbCas12-fgY10b and pCambia1300:T5exo-LbCas12-Y10*4.

[0013] Its construction method includes the following steps:

[0014] (1) Select PAM sites in the TYLCCNV sequence and design crRNAs; including two crRNA strands required for the pCambia1300:LbCas12-fgY10A vector target: fgY10A-F1 / R1; their sequences are as shown in SEQ ID NO: 1-2;

[0015] fgY10A-F1:AGATTATGTGGACACCAAATGGCATAA

[0016] fgY10A-R1:GGCCTTATGCCATTTGGTGTCCACATA

[0017] (2) Select the PAM site in the TYLCCNB sequence and design crRNA; including two crRNA strands required for 1 target site of the pCambia1300:LbCas12-fgY10b vector: fgY10b-F1 / R1; their sequences are shown in SEQ ID NO: 3-4;

[0018] fgY10b-F1:AGATATCTCAGAGGTAAATAATTGGGA

[0019] fgY10b-R1:GGCCTCCCAATTATTTACCTCTGAGAT

[0020] (3) Synthesize the single-stranded crRNAs described in steps (1) and (2) into double-stranded crRNAs, and the specific method is as follows:

[0021] ① First, dilute the above single-stranded gRNA to 10 μM / μL;

[0022] ② Prepare a 15 μL system according to 10×reaction buffer A: 1.5 μL; T4 Polynucleotide Kinase: 1.5 μL; 10 mM ATP: 1 μL; T4 Polynucleotide Kinase: 1 μL; primer F: 4 μL; primer R: 4 μL; ddH 2 O: 3.5 μL;

[0023] ③ Boil in a boiling water bath for 5 min, cool to room temperature naturally, and store at -20 °C;

[0024] (4) Construction of the pCambia1300:LbCas12-fgY10A vector:

[0025] ① 1 μg of pCambia1300 plasmid, 1 μL of BamH I and 1 μL of Bcu I, 5 μL of 10×FastDigest GreenBuffer; the remaining system is supplemented with ddH 2 O; Digest with enzymes at 37 °C for 30 min, then purify the DNA and store it frozen at -20 °C;

[0026] ② Amplify the LbCas12a nucleotide sequence with the primer pair 1300-LbCas12a-F1 / R1 respectively to obtain a specific PCR band; perform agarose gel electrophoresis and cut the gel to recover and purify the specific PCR target band; the sequences of LbCas12a and 1300-LbCas12a-F1 / R1 are shown in SEQ ID NO: 6, 8-9;

[0027] ③Digest 3 μL of the backbone of the pCambia1300 plasmid with BamH I and Bcu I, 1 μL of the fragment amplified by 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50 °C for 30 min;

[0028] ④Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin for resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the fragment is inserted into the vector;

[0029] The identification primers are 35S-F / LbCas12a-R1, and the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NO: 10-11;

[0030] Expand and culture the correct clones, extract the plasmids, and sequence them with the Nos-R1 primer, and its sequence is shown in SEQ ID NO: 12;

[0031] Thus, the pCambia1300-ccdb-LbCas12 vector is obtained.

[0032] ⑤1 μg of pENTR4 plasmid, 1 μL of Sma I and 1 μL of EcoR I, 5 μL of 10×FastDigest Green Buffer; fill up the remaining system with ddH 2 O; digest at 37 °C for 30 min, then purify the DNA and store it frozen at -20 °C;

[0033] ⑥Amplify the 35S-HH-crRNA-BsaⅠ-HDV nucleotide sequence with the primer pair 35s-HDV-F1 / R1 respectively to obtain a specific PCR band; perform agarose gel electrophoresis and cut and recover and purify the specific PCR target band; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NO: 13-15:

[0034] 35s-HDV-F1: AAAAAGCAGGCTCCACCATGGatggccccgggcctgcagg

[0035] 35s-HDV-R1: CTCGAGTGCGGCCGCGAATTCccgatctagtaacatagatgacaccg

[0036] ⑦Digest 3 μL of the backbone of the pENTR plasmid with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50 °C for 30 min;

[0037] ⑧Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin for resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the fragment has been inserted into the vector;

[0038] The identification primers are 35S-F / Y16-R1, and the sequence of Y16-R1 is shown in SEQ ID NO: 16;

[0039] Expand the correct clone, extract the plasmid, and sequence it with the Nos-R1 primer;

[0040] Thus, the pENTR-Y16 vector is obtained.

[0041] ⑨1 μg of pENTR-Y16 plasmid, 1 μL of ApaⅠ, 5 μL of 10×FastDigest Green Buffer; make up the remaining system with ddH2O; digest at 37 °C for 30 min, then purify the DNA, and clone it into pCambia1300-ccdb-LbCas12 through the Gateway LR reaction to obtain the pCambia1300:LbCas12 vector.

[0042] ⑩1 μg of pCambia1300:LbCas12 plasmid, 1 μL of Bsa I-HF, 5 μL of 10×cutsmart buffer; make up the remaining system with ddH 2 O; digest at 37 °C for 60 min, then purify the DNA and store it frozen at -20 °C;

[0043] 2 μL of 10×T4 DNA ligase buffer, 80 ng of the digested pCambia1300:LbCas12 vector, 1 μL of double-stranded gRNA, 1 μL of T4 DNA ligase, make up to 20 μL with ddH 2 O; control the temperature with a PCR instrument and react at 22 °C for 15 min;

[0044] Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin for resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the target has been inserted into the vector;

[0045] Identify the primer fgY10A-F1 / Y16-R1, expand the correct clone for culture, extract the plasmid, and sequence it with the Y16-R1 primer. Thus, the pCambia1300:LbCas12-fgY10A vector is obtained;

[0046] (5) Construction of the pCambia1300:LbCas12-fgY10b vector:

[0047] ① 1 μg of pCambia1300:LbCas12 plasmid, 1 μL of Bsa I-HF, 5 μL of 10× cutsmart buffer; the remaining system is made up with ddH 2 O; Digest with enzymes at 37°C for 60 min, then purify the DNA and store it frozen at -20°C;

[0048] ② 2 μL of 10× T4 DNAligase buffer, 80 ng of the digested pCambia1300:LbCas12 vector, 1 μL of double-stranded gRNA, 1 μL of T4 DNAligase, and make up to 20 μL with ddH 2 O; Control the temperature with a PCR instrument and react at 22°C for 15 min;

[0049] ③ Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as the resistance screening, select monoclonal colonies for colony PCR identification and sequencing to confirm whether the target point is inserted into the vector;

[0050] Identify the primer fgY10b-b1 / Y16-R1; expand the correct clone for culture, extract the plasmid, and sequence it with the Y16-R1 primer. Thus, the pCambia1300:LbCas12-fgY10b vector is obtained;

[0051] (6) Construction of the pCambia1300:T5exo-LbCas12 vector:

[0052] ① 1 μg of pCambia1300:LbCas12 plasmid, 1 μL of BamH I and 1 μL of Bcu I, 5 μL of 10× FastDigestGreen Buffer; the remaining system is made up with ddH 2 O; Digest with enzymes at 37°C for 30 min, then purify the DNA and store it frozen at -20°C;

[0053] ②Using primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 respectively, amplify the T5 nuclease and LbCas12a nucleotide sequences to obtain two specific PCR bands respectively; perform agarose gel electrophoresis and cut and recover and purify the specific PCR target bands; the sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NO: 17-20:

[0054] 1300-T5-F1:

[0055] AAATTTTCACCATTTACGAACGATAGGATCCGCCACCATGGCCGACTATAAGGACCACGACGGAGA;

[0056] 1300-T5-R1:

[0057] TATACCGACCTTTCTTTTTTCTTTGGGGCCATATCACTTCCGCCAGAAGAACCT;

[0058] 1300-T5-F2:

[0059] AGGTTCTTCTGGCGGAAGTGATATGGCCCCAAAGAAAAAAAGAAAGGTCGGTATA;

[0060] 1300-T5-R2:

[0061] GATCGGGGAAATTCGAGCTCactagtCTTCTTTTTTTTTGCCTGGCCTGC;

[0062] ③Digest 3 μL of the backbone of pCambia1300:LbCas12 plasmid with BamH I and Bcu I, 1 μL each of the fragments amplified by 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless AssemblyMix; react at 50 °C for 30 min; fuse the T5 nuclease (T5exo) at the 5' end of LbCas12a, and the sequence of T5exo is shown in SEQ ID NO: 7;

[0063] ④Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as the resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the target is inserted into the vector;

[0064] Identify the primer 35S-F / 1300-T5-R1, expand the culture of the correct clone, extract the plasmid, and sequence it with the Nos-R1 primer;

[0065] Thus, the pCambia1300:T5exo-LbCas12 vector is obtained.

[0066] (7) Construction of the pCambia1300:T5exo-LbCas12-fgY10A vector:

[0067] ① 1 μg of pCambia1300:LbCas12 plasmid, 1 μL of Bsa I-HF, 5 μL of 10× cutsmart buffer; the remaining system is made up with ddH 2 O; Digest at 37 °C for 60 min, then purify the DNA and store it frozen at -20 °C;

[0068] ② 2 μL of 10× T4 DNAligase buffer, 80 ng of the digested pCambia1300:LbCas12 vector, 1 μL of double-stranded gRNA, 1 μL of T4 DNA ligase, and make up to 20 μL with ddH 2 O; Control the temperature with a PCR instrument and react at 22 °C for 15 min;

[0069] ③ Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as the resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the target site is inserted into the vector;

[0070] Identify the primer fgY10A-F1 / Y16-R1; expand the culture of the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer. Thus, the pCambia1300:T5exo-LbCas12-fgY10A vector is obtained;

[0071] (8) Construction of pCambia1300:T5exo-LbCas12-fgY10b:

[0072] ① 1 μg of pCambia1300:LbCas12 plasmid, 1 μL of Bsa I-HF, 5 μL of 10× cutsmart buffer; the remaining system is made up with ddH 2 O; Digest at 37 °C for 60 min, then purify the DNA and store it frozen at -20 °C;

[0073] ②10×T4 DNA ligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH 2 O volume is adjusted to 20μL; PCR instrument temperature is controlled at 22℃ and reacted for 15min;

[0074] ③Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as resistance screening, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0075] Identify the primers fgY10b-F1 / Y16-R1; expand the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10b vector;

[0076] (9) Construction of pCambia1300:T5exo-LbCas12-Y10*4:

[0077] ① Select a PAM site near the TYLCCNV replication key site and design two crRNAs; and select a PAM site near the TYLCCNB replication key site and design two crRNAs, and separate the four crRNA sequences using hammerhead ribozyme HH and hepatitis D virus ribozyme HDV for series connection, and artificially synthesize the sequence, named Y10*4, whose sequence is shown in SEQ ID NO: 5;

[0078] After artificially synthesizing the Y10*4 gene fragment, it was cloned into pUC57 and named pUC57:Y10*4;

[0079] ②1μg pUC57:Y10*4 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the rest of the system is washed with ddH 2 O supplementation; enzyme digestion at 37℃ for 60min, then DNA purification and cryopreservation at -20℃;

[0080] ③1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the rest of the system is washed with ddH 2 O supplementation; enzyme digestion at 37℃ for 60min, then DNA purification and cryopreservation at -20℃;

[0081] ​​④ 2 μL of 10×T4 DNA ligase buffer, 80 ng of the digested pCambia1300:T5exo-LbCas12 vector, 80 ng of the digested pUC57:Y10*4 fragment, 1 μL of T4 DNA ligase, ddH 2 O was made up to 20 μL; The temperature of the PCR instrument was controlled at 22 °C for 15 min;

[0082] ⑤ 10 μL of the ligation product was transformed into Escherichia coli DH5α, kanamycin was used for resistance screening, and single colonies were selected for colony PCR identification and sequencing;

[0083] The identification primers were Y10*4-F1 / Y16-R1; Among them, the sequence of Y10*4-F1 was as shown in SEQ ID NO: 21;

[0084] Y10*4-F1: AGAGACACCAATTGACCAGTCAA;

[0085] The correct clone was amplified, the plasmid was extracted, and sequenced with the Y16-R1 primer. Thus, the pCambia1300:T5exo-LbCas12-Y10*4 vector was obtained;

[0086] (10) Transformation of the final vector into Agrobacterium: 50 μL of Agrobacterium EHA105 strain and 5 μL of plasmid were used for chemical transformation; Incubated at 28 °C for 5 - 6 h; Plated on plates with Kan+Rif resistance, and single colonies were selected for colony PCR identification; The strain was stored at -80 °C.

[0087] The infection vector of the present invention based on the CRISPR / LbCas12a system that can target the key motifs for the replication of TYLCCNV / TYLCCNB has a significantly efficient antiviral function. The antiviral principle based on this system directly cleaves the viral sequence to inhibit virus replication, while increasing the size of the deleted fragment, further enhancing the anti-geminivirus effect, thereby preventing the potential risk of virus escape from editing and being more safely applied in production.

[0088] The vector of the present invention that adds the T5exo element can enhance the efficiency of editing the geminivirus genome sequence and expand the application of the deleted fragment. The present invention can enhance the disease resistance effect against TYLCCNV / TYLCCNB by using a multi-target editing strategy.

[0089] Compared with the prior art, the outstanding effect of the present invention lies in:

[0090] (1) The present invention constructs recombinant vectors pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, pCambia1300:T5exo-LbCas12-fgY10b, and pCambia1300:T5exo-LbCas12-Y10*4. By utilizing the characteristics of the editing of the Cas12 protein, such as high editing efficiency and large deleted fragment size, these vectors target the key replication sites of TYLCCNV / TYLCCNB, thus further reducing and eliminating the risk of virus escape editing caused by geminivirus sequence mutations.

[0091] (2) By adding the T5exo element, the editing efficiency and the size of the deleted fragment are further increased, thereby further enhancing the anti-geminivirus effect.

[0092] (3) By multi-target editing of geminiviruses, the anti-geminivirus effect of the vectors is further enhanced.

[0093] (4) These vectors target the virus itself rather than the host plant, so they can efficiently resist virus infection without affecting agronomic traits, which is more conducive to practical field production.

[0094] (5) This set of systems has a wide range of applications and can be applied to all host plants of TYLCCNV / TYLCCNB.

[0095] The following further describes the vector for inhibiting geminivirus infection based on the CRISPR / LbCas12a system, its construction method, and applications of the present invention in conjunction with the accompanying drawings and specific examples. Description of the Drawings

[0096] Figure 1 In the figures, (a) is a schematic diagram of the vector for editing geminivirus TYLCCNV / TYLCCNB infection based on the CRISPR / LbCas12a system; (b) is a schematic diagram of the vector for editing geminivirus TYLCCNV / TYLCCNB infection based on the CRISPR / T5exo-LbCas12a system; (c) is a schematic diagram of the vector for simultaneous four-target editing of geminivirus TYLCCNV / TYLCCNB infection based on the CRISPR / T5exo-LbCas12a system.

[0097] Figure 2Among them, (a) is the edited sequence map after first-generation sequencing, where total DNA was extracted 3 days after co-inoculating TYLCCNV / TYLCCNB virus with Agrobacterium tumefaciens carrying BKG-g4 (Cas9-TYLCCNV), PCR was performed near the PAM site of the TYLCCNV virus sequence, and after ligation to the T vector; (b) is the edited sequence map after first-generation sequencing, where total DNA was extracted 3 days after co-inoculating TYLCCNV / TYLCCNB virus with Agrobacterium tumefaciens carrying BKG-g1 (Cas9-TYLCCNB), PCR was performed near the PAM site of the TYLCCNB virus sequence, and after ligation to the T vector; (c) is the edited sequence map after first-generation sequencing, where DNA was extracted after co-inoculating TYLCCNV / TYLCCNB virus with Agrobacterium tumefaciens carrying CRISPR / LbCas12a-Y10A, PCR was performed near the PAM site of the TYLCCNV virus sequence, and after ligation to the T vector; (d) is the edited sequence map after first-generation sequencing, where DNA was extracted after co-inoculating TYLCCNV / TYLCCNB virus with Agrobacterium tumefaciens carrying CRISPR / LbCas12a-Y10b, PCR was performed near the PAM site of the TYLCCNB virus sequence, and after ligation to the T vector;

[0098] Figure 3 Among them, (a) Empty Agrobacterium tumefaciens was used as MOCK, and the symptom map at 7 days post inoculation (7 dpi) of Nicotiana benthamiana plants infiltrated with a mixture of Agrobacterium tumefaciens carrying BKG-g4 (Cas9-TYLCCNV), BKG-g1 (Cas9-TYLCCNB), pCambia1300:LbCas12-fgY10A (Cas12-TYLCCNV), pCambia1300:LbCas12-fgY10b (Cas12-TYLCCNB) infectious clone and Agrobacterium tumefaciens carrying TYLCCNV / TYLCCNB infectious clone. (b) Using the CP protein encoded by TYLCCNV as a reference, the accumulation level of TYLCCNV was detected by qPCR. Using the βC1 protein encoded by TYLCCNB as a reference, the accumulation level of TYLCCNB was detected by qPCR.

[0099] Figure 4Among them, (a) the symptom diagram of Nicotiana benthamiana plants infiltrated with Agrobacterium tumefaciens without load as MOCK, Agrobacterium tumefaciens containing pCambia1300:LbCas12-fgY10A (Cas12-TYLCCNV), pCambia1300:T5exo-LbCas12-fgY10A (Cas12 / T5exo-TYLCCNV) infectious clone Agrobacterium tumefaciens mixed with TYLCCNV / TYLCCNB infectious clone Agrobacterium tumefaciens after 7 days (7 dpi); (b) taking the CP protein encoded by TYLCCNV as a reference, qPCR was used to detect the accumulation level of TYLCCNV in figure (a); (c) the symptom diagram of Nicotiana benthamiana plants infiltrated with Agrobacterium tumefaciens without load as MOCK, Agrobacterium tumefaciens containing pCambia1300:LbCas12-fgY10b (Cas12-TYLCCNB), pCambia1300:T5exo-LbCas12-fgY10b (Cas12 / T5exo-TYLCCNB) infectious clone Agrobacterium tumefaciens mixed with TYLCCNV / TYLCCNB infectious clone Agrobacterium tumefaciens after 7 days (7 dpi); (d) taking the βC1 protein encoded by TYLCCNB as a reference, qPCR was used to detect the accumulation level of TYLCCNB in figure (a).

[0100] Figure 5 Among them, (a) the symptom diagram of Nicotiana benthamiana plants infiltrated with Agrobacterium tumefaciens without load as MOCK, Agrobacterium tumefaciens containing pCambia1300:T5exo-LbCas12-fgY10A (Cas12 / T5exo-TYLCCNV), pCambia1300:T5exo-LbCas12-Y10*4 (Cas12 / T5exo-TYLCCNV *4 ) infectious clone Agrobacterium tumefaciens mixed with TYLCCNV / TYLCCNB infectious clone Agrobacterium tumefaciens after 7 days (7 dpi); (b) taking the CP protein encoded by TYLCCNV as a reference, qPCR was used to detect the accumulation level of TYLCCNV in figure (a). Detailed implementation method

[0101] A construction method of a vector for inhibiting geminivirus infection based on the CRISPR / LbCas12a system, wherein the geminivirus is TYLCCNV / TYLCCNB; as Figure 1 shown, the vectors are pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, pCambia1300:T5exo-LbCas12-fgY10b, and pCambia1300:T5exo-LbCas12-Y10*4;

[0102] Specifically, it includes the following steps:

[0103] (1) Select the PAM site in the TYLCCNV sequence and design crRNA; including two crRNA strands required for the target of the pCambia1300:LbCas12-fgY10A vector: fgY10A-F1 / R1; their sequences are shown in SEQ ID NO: 1-2;

[0104] fgY10A-F1:AGATTATGTGGACACCAAATGGCATAA

[0105] fgY10A-R1:GGCCTTATGCCATTTGGTGTCCACATA

[0106] (2) Select the PAM site in the TYLCCNB sequence and design crRNA; including two crRNA strands required for 1 target of the pCambia1300:LbCas12-fgY10b vector: fgY10b-F1 / R1; their sequences are shown in SEQ ID NO: 3-4;

[0107] fgY10b-F1:AGATATCTCAGAGGTAAATAATTGGGA

[0108] fgY10b-R1:GGCCTCCCAATTATTTACCTCTGAGAT

[0109] (3) Synthesize the single-stranded crRNAs described in steps (1) and (2) into double-stranded ones, and the specific method is as follows:

[0110] ① First, dilute the above single-stranded gRNA to 10 μM / μL;

[0111] ② Prepare a 15 μL system according to 10×reaction buffer A: 1.5 μL; T4 Polynucleotide Kinase: 1.5 μL; 10 mM ATP: 1 μL; T4 Polynucleotide Kinase: 1 μL; primer F: 4 μL; primer R: 4 μL; ddH 2 O: 3.5 μL;

[0112] ③ Boil in a boiling water bath for 5 min, cool naturally to room temperature, and store at -20 °C;

[0113] (4) Construction of the pCambia1300:LbCas12-fgY10A vector:

[0114] ① 1 μg of pCambia1300 plasmid, 1 μL of BamH I and 1 μL of Bcu I, 5 μL of 10×FastDigest Green Buffer; the remaining volume is made up with ddH 2 O; Digest with enzymes at 37 °C for 30 min, then purify the DNA and store it frozen at -20 °C;

[0115] ② Amplify the LbCas12a nucleotide sequence with primer pair 1300-LbCas12a-F1 / R1 respectively to obtain a specific PCR band; perform agarose gel electrophoresis and cut and recover the purified specific PCR target band; the sequences of LbCas12a, 1300-LbCas12a-F1 / R1 are shown in SEQ ID NO: 6, 8-9;

[0116] ③ Digest 3 μL of the backbone of pCambia1300 plasmid with BamH I and Bcu I, 1 μL of the fragment amplified by 1300-LbCas12a-F1 / R1, 5 μL of 2×MultiF Seamless Assembly Mix; react at 50 °C for 30 min;

[0117] ④ Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the fragment is inserted into the vector;

[0118] The identification primers are 35S-F / LbCas12a-R1, and the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NO: 10-11;

[0119] Expand the correct clone for culture, extract the plasmid, and sequence it with the Nos-R1 primer, and its sequence is shown in SEQ ID NO: 12;

[0120] Thus, the pCambia1300-ccdb-LbCas12 vector is obtained.

[0121] ⑤ 1 μg of pENTR4 plasmid, 1 μL of Sma I and 1 μL of EcoR I, 5 μL of 10×FastDigest Green Buffer; the remaining volume is made up with ddH 2 O; Digest with enzymes at 37 °C for 30 min, then purify the DNA and store it frozen at -20 °C;

[0122] ⑥ Amplify the 35S-HH-crRNA-BsaⅠ-HDV nucleotide sequence with primer pair 35s-HDV-F1 / R1 respectively to obtain a specific PCR band; perform agarose gel electrophoresis and excise and purify the specific PCR target band by gel extraction; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NO: 13-15;

[0123] 35s-HDV-F1: AAAAAGCAGGCTCCACCATGGatggccccgggcctgcagg

[0124] 35s-HDV-R1: CTCGAGTGCGGCCGCGAATTCccgatctagtaacatagatgacaccg

[0125] ⑦ Digest 3 μL of the backbone of the pENTR plasmid with Sma I and EcoR I enzymes, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50 °C for 30 min;

[0126] ⑧ Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as the resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the fragment is inserted into the vector;

[0127] Identification primers 35S-F / Y16-R1, where the sequence of Y16-R1 is shown in SEQ ID NO: 16;

[0128] Expand the culture of the correct clone, extract the plasmid, and sequence it with the Nos-R1 primer;

[0129] Thus, the pENTR-Y16 vector is obtained.

[0130] ⑨ 1 μg of pENTR-Y16 plasmid, 1 μL of ApaⅠ, 5 μL of 10×FastDigest Green Buffer; make up the remaining system with ddH2O; digest at 37 °C for 30 min, then purify the DNA, and clone it into pCambia1300-ccdb-LbCas12 through the Gateway LR reaction to obtain the pCambia1300:LbCas12 vector.

[0131] ⑩ 1 μg of pCambia1300:LbCas12 plasmid, 1 μL of Bsa I-HF, 5 μL of 10×cutsmart buffer; make up the remaining system with ddH 2O supplementation; 37℃ digestion for 60min, then purify DNA, and freeze at -20℃;

[0132] 10×T4 DNAligase buffer 2μL, pCambia1300:LbCas12 vector after enzyme digestion 80ng, double-stranded gRNA 1μL, T4 DNAligase 1μL, ddH 2 O volume is adjusted to 20μL; PCR instrument temperature is controlled at 22℃ and reacted for 15min;

[0133] Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as resistance screening, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0134] Identification primer fgY10A-F1 / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16;

[0135] Y16-R1:ACTTTGTACAAGAAAGCTGGGT;

[0136] The correct clone was expanded, the plasmid was extracted, and sequenced with Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10A vector;

[0137] (5) Construction of pCambia1300:LbCas12-fgY10b vector:

[0138] ①1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the rest of the system is washed with ddH 2 O supplementation; enzyme digestion at 37℃ for 60min, then DNA purification and cryopreservation at -20℃;

[0139] ②10×T4 DNA ligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4 DNA ligase 1μL, ddH 2 O volume is adjusted to 20μL; PCR instrument temperature is controlled at 22℃ and reacted for 15min;

[0140] ③Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as resistance screening, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector;

[0141] ​​​​Identification primers fgY10b-b1 / Y16-R1; Expand and culture the correct clone, extract the plasmid, and sequence it with primer Y16-R1. Thus, the pCambia1300:LbCas12-fgY10b vector is obtained.

[0142] (6) Construction of the pCambia1300:T5exo-LbCas12 vector:

[0143] ① 1 μg of pCambia1300:LbCas12 plasmid, 1 μL of BamH I and 1 μL of Bcu I, 5 μL of 10×FastDigestGreen Buffer; The remaining system is supplemented with ddH 2 O; Digest with enzymes at 37°C for 30 min, then purify the DNA and store it frozen at -20°C;

[0144] ② Use primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 to amplify the T5 nuclease and LbCas12a nucleotide sequences respectively, and obtain two specific PCR bands. After agarose gel electrophoresis, cut the gel and recover and purify the specific PCR target bands. The sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NO: 17-20:

[0145] 1300-T5-F1:

[0146] AAATTTTCACCATTTACGAACGATAGGATCCGCCACCATGGCCGACTATAAGGACCACGA CGGAGA;

[0147] 1300-T5-R1:

[0148] TATACCGACCTTTCTTTTTTCTTTGGGGCCATATCACTTCCGCCAGAAGAACCT;

[0149] 1300-T5-F2:

[0150] AGGTTCTTCTGGCGGAAGTGATATGGCCCCAAAGAAAAAAAGAAAGGTCGGTATA;

[0151] 1300-T5-R2:

[0152] GATCGGGGAAATTCGAGCTCactagtCTTCTTTTTTTTTGCCTGGCCTGC;

[0153] ③Digest 3 μL of the backbone of pCambia1300:LbCas12 plasmid with BamH I and Bcu I, 1 μL each of the fragments amplified by 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50 °C for 30 min; fuse T5 nuclease (T5exo) at the 5' end of LbCas12a, and the T5exo sequence is as shown in SEQ ID NO: 7;

[0154] ④Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as the resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the fragment is ligated into the vector;

[0155] The identification primers are 35S-F / 1300-T5-R1. Expand the correct clones, extract the plasmids, and sequence them with the Nos-R1 primer;

[0156] Thus, the pCambia1300:T5exo-LbCas12 vector is obtained.

[0157] (7) Construction of the pCambia1300:T5exo-LbCas12-fgY10A vector:

[0158] ①1 μg of pCambia1300:T5exo-LbCas12 plasmid, 1 μL of Bsa I-HF, and 5 μL of 10×cutsmart buffer; fill up the remaining system with ddH 2 O; digest at 37 °C for 60 min, then purify the DNA and store it frozen at -20 °C;

[0159] ②2 μL of 10×T4 DNA ligase buffer, 80 ng of the digested pCambia1300:T5exo-LbCas12 vector, 1 μL of double-stranded gRNA, 1 μL of T4 DNA ligase, and make up the volume to 20 μL with ddH 2 O; control the temperature with a PCR instrument and react at 22 °C for 15 min;

[0160] ③Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as the resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the target site is ligated into the vector;

[0161] Identification primers fgY10A-F1 / Y16-R1; Expand the correct clone for culture, extract the plasmid, and sequence it with primer Y16-R1. Thus, the pCambia1300:T5exo-LbCas12-fgY10A vector is obtained;

[0162] (8) Construction of pCambia1300:T5exo-LbCas12-fgY10b:

[0163] ① 1 μg of pCambia1300:T5exo-LbCas12 plasmid, 1 μL of Bsa I-HF, 5 μL of 10× cutsmart buffer; The remaining system is supplemented with ddH 2 O; Incubate at 37 °C for 60 min, then purify the DNA and store it frozen at -20 °C;

[0164] ② 2 μL of 10× T4 DNAligase buffer, 80 ng of the digested pCambia1300:T5exo-LbCas12 vector, 1 μL of double-stranded gRNA, 1 μL of T4 DNA ligase, and ddH 2 O is made up to 20 μL; Control the temperature with a PCR instrument and react at 22 °C for 15 min;

[0165] ③ Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as the resistance screening, pick monoclonal colonies for colony PCR identification and sequencing to confirm whether the target site is inserted into the vector;

[0166] Identification primers fgY10b-F1 / Y16-R1; Expand the correct clone for culture, extract the plasmid, and sequence it with primer Y16-R1. Thus, the pCambia1300:T5exo-LbCas12-fgY10b vector is obtained;

[0167] (9) Construction of pCambia1300:T5exo-LbCas12-Y10*4:

[0168] ① Select PAM sites near the key replication sites of TYLCCNV and design two crRNAs; and select PAM sites near the key replication sites of TYLCCNB and design two crRNAs. Tandemly link the 4 crRNA sequences separated by the hammerhead ribozyme HH and the hepatitis delta virus ribozyme HDV, and artificially synthesize this sequence, named Y10*4, and its sequence is shown in SEQ ID NO: 5; After artificially synthesizing the Y10*4 gene fragment, clone it into pUC57 and name it pUC57:Y10*4;

[0169] ②1 μg of pUC57:Y10*4 plasmid, 1 μL of Bsa I-HF and 1 μL of Bcu I, 5 μL of 10× cutsmart buffer; the remaining volume is made up with ddH 2 O; digest with enzymes at 37 °C for 60 min, then purify the DNA and store it frozen at -20 °C;

[0170] ③1 μg of pCambia1300:T5exo-LbCas12 plasmid, 1 μL of Bsa I-HF and 1 μL of Bcu I, 5 μL of 10× cutsmart buffer; the remaining volume is made up with ddH 2 O; digest with enzymes at 37 °C for 60 min, then purify the DNA and store it frozen at -20 °C;

[0171] ④2 μL of 10× T4 DNA ligase buffer, 80 ng of digested pCambia1300:T5exo-LbCas12 vector, 80 ng of digested pUC57:Y10*4 fragment, 1 μL of T4 DNA ligase, and make up the volume to 20 μL with ddH 2 O; control the temperature with a PCR instrument and react at 22 °C for 15 min;

[0172] ⑤Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin for resistance screening, pick monoclonal colonies for colony PCR identification and sequencing;

[0173] The identification primers are Y10*4-F1 / Y16-R1; among them, the sequence of Y10*4-F1 is shown as SEQ ID NO: 21;

[0174] Y10*4-F1: AGAGACACCAATTGACCAGTCAA;

[0175] Expand the culture of the correct clone, extract the plasmid, and sequence it with the Y16-R1 primer. Thus, the pCambia1300:T5exo-LbCas12-Y10*4 vector is obtained;

[0176] (10) Transformation of the final vector into Agrobacterium: 50 μL of Agrobacterium EHA105 strain and 5 μL of plasmid for chemical transformation; incubate at 28 °C for 5 - 6 h; plate with Kan+Rif resistance, pick monoclonal colonies for colony PCR identification; store the strain at -80 °C.

[0177] (11) Activate Agrobacterium tumefaciens. Mix the Agrobacterium tumefaciens containing the infectious clones of BKG-g4 (Cas9-TYLCCNV), pCambia1300:LbCas12-fgY10A, BKG-g1 (Cas9-TYLCCNB), and pCambia1300:LbCas12-fgY10b2 vectors with the Agrobacterium tumefaciens of the TYLCCNV / TYLCCNB infectious clone and inoculate them on wild-type Nicotiana benthamiana. Mix the Agrobacterium tumefaciens with the empty vector and the TYLCCNV / TYLCCNB infectious clone as a control (Mock). Extract the total DNA from the inoculated leaves 3 days after inoculation, perform PCR on the region near the PAM site of the TYLCCNV / TYLCCNB virus sequence, ligate the T vector, and detect the editing effect by first-generation sequencing, as Figure 2 shown.

[0178] (12) Detect the antiviral effects of the BKG-g4 (Cas9-TYLCCNV), pCambia1300:LbCas12-fgY10A, BKG-g1 (Cas9-TYLCCNB), and pCambia1300:LbCas12-fgY10b2 vectors respectively. Extract the total DNA from the systemic leaves of Nicotiana benthamiana plants 7 days after mixed inoculation. Using the CP protein encoded by TYLCCNV as a reference, perform qPCR to detect the accumulation level of TYLCCNV. Using the βC1 protein encoded by TYLCCNB as a reference, perform qPCR to detect the accumulation level of TYLCCNB, as Figure 3 shown.

[0179] (13) Detect the antiviral effects of the pCambia1300:T5exo-LbCas12-fgY10A and pCambia1300:T5exo-LbCas12-fgY10b vectors: Extract the total DNA from the systemic leaves of Nicotiana benthamiana plants of pCambia1300:LbCas12-fgY10A, pCambia1300:LbCas12-fgY10b, pCambia1300:T5exo-LbCas12-fgY10A, and pCambia1300:

[0180] T5exo-LbCas12-fgY10b 7 days after mixed inoculation. Using the CP protein encoded by TYLCCNV as a reference, perform qPCR to detect the accumulation level of TYLCCNV. Using the βC1 protein encoded by TYLCCNB as a reference, perform qPCR to detect the accumulation level of TYLCCNB, as Figure 4 shown.

[0181] (14) Detect the antiviral effects of the pCambia1300:T5exo-LbCas12-fgY10A and pCambia1300:T5exo-LbCas12-Y10A*4 vectors: Extract the total DNA from the systemic leaves of Nicotiana benthamiana plants of pCambia1300:T5exo-LbCas12-fgY10A and pCambia1300:T5exo-LbCas12-Y10A*4 7 days after co-inoculation respectively. Using the CP protein encoded by TYLCCNV as a reference, qPCR was used to detect the accumulation level of TYLCCNV, as Figure 5 shown.

[0182] The above results all indicate that the antiviral effect of the virus gene editing vector based on CRISPR / LbCas12a is better than that of the virus gene editing vector based on CRISPR / Cas9, and the deleted fragment of the virus gene sequence is larger, which can reduce the risk of geminivirus escaping gene editing more effectively. In addition, the virus gene editing vector based on CRISPR / LbCas12a can further enhance the resistance to geminivirus after adding the T5exo element, effectively inhibiting the infection of TYLCCN / TYLCCNB and the level of virus accumulation. In addition, designing a multi-gene editing vector for the TYLCCN / TYLCCNB genome has a better anti-geminivirus effect compared with single-gene editing, indicating that the virus gene editing vector based on CRISPR / LbCas12a has better application prospects than the virus gene editing vector based on CRISPR / Cas9.

[0183] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the spirit of the present invention's design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system, characterized in that: The Geminivirus is TYLCCNV / TYLCCNB; Including at least one of pCambia1300:LbCas12-fgY10A and pCambia1300:T5exo-LbCas12-fgY10A vectors constructed for the key replication site of TYLCCNV, pCambia1300:LbCas12-fgY10b and pCambia1300:T5exo-LbCas12-fgY10b vectors constructed for the key replication site of TYLCCNB, and pCambia1300:T5exo-LbCas12-Y10*4 vectors constructed for the key replication site of TYLCCNV / TYLCCNB; A PAM site was selected near the TYLCCNV replication key site and two crRNAs were designed to construct two crRNA chains required for the pCambia1300:LbCas12-fgY10A vector containing the site: fgY10A-F1 / R1, whose sequence is shown in SEQ ID NO: 1-2; a PAM site was selected near the TYLCCNB replication key site and crRNA was designed to construct two crRNA chains required for the pCambia1300:LbCas12-fgY10b vector containing the site: fgY10b-F1 / R1, whose sequence is shown in SEQ ID NO: 3-4; single-stranded crRNA was synthesized into double-stranded; T5 nuclease is fused to the 5' end of LbCas12a, and the editing vector pCambia1300:T5exo-LbCas12-Y10*4 is used to simultaneously edit the four viral target sites of TYLCCNV and TYLCCNB; wherein, a PAM site is selected near the TYLCCNV key replication site and two crRNAs are designed, and a PAM site is selected near the TYLCCNB key replication site and two crRNAs are designed, and the four crRNA sequences are separated by hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV for series connection, and the sequence is artificially synthesized and named Y10*4, and its sequence is shown in SEQ ID NO: 5; T5 nuclease is fused to the 5' end of LbCas12a, and the sequences of LbCas12a and T5 nuclease are shown in SEQ ID NO: 6-7.

2. The method for constructing a vector for inhibiting geminivirus infection based on the CRISPR / LbCas12a system according to claim 1, characterized in that: A PAM site was selected near the TYLCCNV replication key site and two crRNAs were designed to construct the two crRNA chains required for the pCambia1300:LbCas12-fgY10A vector containing the site: fgY10A-F1 / R1, whose sequence is shown in SEQ ID NO: 1-2; A PAM site was selected near the TYLCCNB replication key site and crRNA was designed to construct two crRNA chains required for the pCambia1300:LbCas12-fgY10b vector containing the site: fgY10b-F1 / R1, whose sequence is shown in SEQ ID NO: 3-4; The single-stranded crRNA was synthesized into a double-stranded one.

3. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 1, characterized in that: The editing vector pCambia1300:T5exo-LbCas12-Y10*4, which fuses T5 nuclease at the 5' end of LbCas12a and simultaneously edits four viral target sites at the key replication sites of TYLCCNV and TYLCCNB; Among them, a PAM site was selected near the TYLCCNV replication key site and two crRNAs were designed, and a PAM site was selected near the TYLCCNB replication key site and two crRNAs were designed, and the four crRNA sequences were separated by hammerhead ribozyme HH and hepatitis delta virus ribozyme HDV for series connection, and the sequence was artificially synthesized and named Y10*4, and its sequence is shown in SEQ ID NO: 5; T5 nuclease is fused to the 5' end of LbCas12a, wherein the sequences of LbCas12a and T5 nuclease are shown in SEQ ID NOs: 6-7.

4. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to any one of claims 1 to 3, characterized in that Including the construction of pCambia1300:LbCas12-fgY10A vector: ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequence of 1300-LbCas12a-F1 / R1 is shown in SEQ ID NO: 8-9: ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11; The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12; So far, the pCambia1300-ccdb-LbCas12 vector is obtained; ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by cutting the gel; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15: ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16; The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers; Thus, the pENTR-Y16 vector was obtained; ⑨1 μg pENTR-Y16 plasmid, 1 μL ApaⅠ, 5 μL 10× FastDigest Green Buffer; the remaining system was supplemented with ddH2O; restriction enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway LR reaction to obtain pCambia1300:LbCas12 vector; ⑩1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃; 10×T4DNAligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4DNA ligase 1μL, ddH2O fixed to 20μL; PCR instrument controlled at 22℃ for 15min; 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the target site was connected to the vector; Primers fgY10A-F1 / Y16-R1 were identified, the correct clone was expanded, the plasmid was extracted, and sequenced with Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10A vector.

5. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to any one of claims 1 to 3, characterized in that Including the construction of pCambia1300:LbCas12-fgY10b vector: ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequence of 1300-LbCas12a-F1 / R1 is shown in SEQ ID NO: 8-9: ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11; The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12; So far, the pCambia1300-ccdb-LbCas12 vector is obtained; ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by cutting the gel; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15: ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16; The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers; Thus, the pENTR-Y16 vector was obtained; ⑨1 μg pENTR-Y16 plasmid, 1 μL ApaⅠ, 5 μL 10× FastDigest Green Buffer; the remaining system was supplemented with ddH2O; restriction enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway LR reaction to obtain pCambia1300:LbCas12 vector; ⑩1μg pCambia1300:LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃; 10×T4DNAligase buffer 2μL, pCambia1300:LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4DNA ligase 1μL, ddH2O fixed to 20μL; PCR instrument controlled at 22℃ for 15min; 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the target site was connected to the vector; The primers fgY10b-F1 / Y16-R1 were identified; the correct clones were expanded, the plasmids were extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:LbCas12-fgY10b vector.

6. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to any one of claims 1 to 3, characterized in that Including the construction of pCambia1300:T5exo-LbCas12 vector: ① 1 μg pCambia1300 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ② The LbCas12a nucleotide sequence was amplified with primer pair 1300-LbCas12a-F1 / R1 to obtain a specific PCR band; after agarose gel electrophoresis, the specific PCR target band was recovered and purified by gel cutting; the sequence of 1300-LbCas12a-F1 / R1 is shown in SEQ ID NO: 8-9: ③ 3 μL of the backbone of the pCambia1300 plasmid digested with BamH I and Bcu I, 1 μL of the fragment amplified from 1300-LbCas12a-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ④ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / LbCas12a-R1, wherein the sequences of 35S-F and LbCas12a-R1 are shown in SEQ ID NOs: 10-11; The correct clone was expanded and cultured, and the plasmid was extracted and sequenced using the Nos-R1 primer. The sequence is shown in SEQ ID NO: 12; So far, the pCambia1300-ccdb-LbCas12 vector is obtained; ⑤1μg pENTR4 plasmid, 1μL SmaI and 1μL EcoR I, 5μL 10×FastDigest Green Buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 30min, then purify the DNA and store at -20℃; ⑥ Amplify the nucleotide sequence of 35S-HH-crRNA-BsaⅠ-HDV with primer pair 35s-HDV-F1 / R1 to obtain a specific PCR band; perform agarose gel electrophoresis and recover and purify the specific PCR target band by cutting the gel; the sequences of 35S-HH-crRNA-BsaⅠ-HDV and 35s-HDV-F1 / R1 are shown in SEQ ID NOs: 13-15: ⑦ 3 μL of the backbone of the pENTR plasmid digested with Sma I and EcoR I, 1 μL of the fragment amplified by 35s-HDV-F1 / R1, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; ⑧ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the fragment is connected to the vector; Identification primer 35S-F / Y16-R1, wherein the sequence of Y16-R1 is shown in SEQ ID NO: 16; The correct clones were expanded, plasmids were extracted, and sequenced using Nos-R1 primers; Thus, the pENTR-Y16 vector was obtained; ⑨1 μg pENTR-Y16 plasmid, 1 μL ApaⅠ, 5 μL 10× FastDigest Green Buffer; the remaining system was supplemented with ddH2O; restriction enzyme digestion was performed at 37°C for 30 min, and then the DNA was purified and cloned into pCambia1300-ccdb-LbCas12 through Gateway LR reaction to obtain pCambia1300:LbCas12 vector; ⑩1 μg pCambia1300:LbCas12 plasmid, 1 μL BamHI and 1 μL BcuI, 5 μL 10×FastDigest GreenBuffer; the remaining system was supplemented with ddH2O; digestion was performed at 37℃ for 30 min, and then the DNA was purified and stored in a freezer at -20℃; The primer pairs 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 were used to amplify the T5 nuclease and LbCas12a nucleotide sequences, respectively, to obtain two specific PCR bands, respectively; after agarose gel electrophoresis, the specific PCR target bands were recovered and purified by gel cutting; the sequences of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2 are shown in SEQ ID NOs: 17-20: 3 μL of the backbone of pCambia1300:LbCas12 plasmid digested with BamH I and Bcu I, 1 μL of each of the amplified fragments of 1300-T5-F1 / 1300-T5-R1 and 1300-T5-F2 / 1300-T5-R2, and 5 μL of 2×MultiF Seamless Assembly Mix; react at 50°C for 30 min; 10 μL of the ligation product was transformed into E. coli DH5α, and kanamycin was used for resistance screening. Single clones were selected for colony PCR identification and sequencing to confirm whether the fragment was connected to the vector; Identify primer 35S-F / 1300-T5-R1; expand the correct clone, extract the plasmid, and sequence it with Nos-R1 primer; So far, the vector containing pCambia1300:T5exo-LbCas12 is obtained.

7. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 6, characterized in that: Including the construction of pCambia1300:T5exo-LbCas12-fgY10A vector: ① 1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃; ②10×T4DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min; ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector; The primers fgY10A-F1 / Y16-R1 were identified; the correct clones were expanded and cultured, the plasmids were extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10A vector.

8. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 6, characterized in that Including the construction of pCambia1300:T5exo-LbCas12-fgY10b vector: ① 1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃; ②10×T4DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, double-stranded gRNA 1μL, T4DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min; ③ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing to confirm whether the target site is connected to the vector; The primers fgY10b-F1 / Y16-R1 were identified; the correct clones were expanded and cultured, the plasmids were extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-fgY10b vector.

9. The method for constructing a vector for inhibiting Gemini virus infection based on the CRISPR / LbCas12a system according to claim 6, characterized in that Including the construction of pCambia1300:T5exo-LbCas12-Y10*4 vector: ① Artificially synthesize the Y10*4 gene fragment and clone it into pUC57, named pUC57:Y10*4; ②1μg pUC57:Y10*4 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmart buffer; the remaining system is supplemented with ddH2O; digest at 37℃ for 60min, then purify the DNA and store at -20℃; ③1μg pCambia1300:T5exo-LbCas12 plasmid, 1μL Bsa I-HF and 1μL Bcu I, 5μL 10×cutsmartbuffer; the remaining system was supplemented with ddH2O; enzyme digestion at 37℃ for 60min, then DNA was purified and stored at -20℃; ④10×T4DNA ligase buffer 2μL, pCambia1300:T5exo-LbCas12 vector 80ng after enzyme digestion, pUC57:Y10*4 fragment 80ng after enzyme digestion, T4DNA ligase 1μL, ddH2O fixed volume to 20μL; PCR instrument temperature controlled at 22℃ for 15min; ⑤ Transform 10 μL of the ligation product into E. coli DH5α, use kanamycin as a resistance screen, select single clones for colony PCR identification and sequencing; The identification primers are Y10*4-F1 / Y16-R1, wherein the sequence of Y10*4-F1 is shown in SEQ ID NO: 21; Y10*4-F1: AGAGACACCAATTGACCAGTCAA; The correct clone was expanded and cultured, the plasmid was extracted, and sequenced with the Y16-R1 primer to obtain the pCambia1300:T5exo-LbCas12-Y10*4 vector.

10. The use of the CRISPR / LbCas12a system-based Geminivirus infection inhibition vector according to claim 1 in the prevention and control of TYLCCNV / TYLCCNB.

Images