Recombinant plasmid and its preparation method, protein composition, use, vaccine, combined vaccine

Abstract

The present invention belongs to the field of biology and discloses a recombinant plasmid. The recombinant plasmid comprises an expression vector and a target gene linked to the expression vector. The target gene includes an IFNγ gene and a Tα1 gene. The nucleotide sequence of the IFNγ gene is as shown in SEQ ID No.1, and the nucleotide sequence of the Tα1 gene is as shown in SEQ ID No.2. This recombinant plasmid can significantly improve the level of HI antibodies after immunization, and the effect of this recombinant plasmid is more significant than that of a mixed preparation of a recombinant plasmid linked with the IFNγ gene and a recombinant plasmid linked with the Tα1 gene, which shows that the specific IFNγ gene and Tα1 gene selected in the present invention can produce obvious synergy after being cloned onto the vector simultaneously. At the same time, the present invention also discloses a preparation method of this recombinant plasmid, a protein composition, uses, a vaccine, and a combined vaccine.

Description

Technical Field

[0001] The present invention belongs to the field of biology, and particularly relates to a recombinant plasmid, a preparation method thereof, a protein composition, uses, a vaccine, and a combined vaccine. Background Art

[0002] As relatively strong biological response modifiers, thymosin and interferon have played an increasingly important role in the prevention and treatment of diseases in medical and veterinary clinical practice, attracting more and more attention, promoting the extensive development and application of thymosin and interferon preparations, and achieving gratifying achievements.

[0003] In the research on chicken interferon, since Sekellick et al. cloned the interferon gene of chicken embryo fibroblasts in 1994, the research on chicken IFN has entered the molecular level, and subsequently many scholars have carried out research. In 1995, Digby et al. obtained the chicken IFNγ gene by RT-PCR method. Its reading frame is 492 bases, and the predicted mature protein is 145 amino acids with a molecular weight of 16.8KD. The amino acid sequence homology with horses and humans is 35% and 32% respectively, while the homology with IFN-I type is only 15%. Liu Shengwang et al. (2000) cloned the chicken interferon gene from mitogen-stimulated chicken spleen lymphocytes, and the obtained gene was consistent with the chicken IFNγ reported by Digby et al. Wu Zhiguang et al. (2001) cloned the type II interferon gene from Huiyang bearded chickens. Homology comparison with avian and mammalian species found that the amino acid homology of IFNγ with avian IFNγ and mammalian IFNγ was 62.2% - 92.7% and 26.5% - 31.8% respectively, and it could be designated as a new subtype of chicken type II interferon. Dai Jianhua (2003) amplified the IFNγ gene of Lohmann laying hens. Compared with the reported coding region sequences of other IFNγ, the amino acid level homology reached 92.8% - 100%. Bao Ming et al. (2004) and Xie Kun et al. (2007) cloned the IFNγ gene of SPF chickens. Wei Xuetao et al. (2008) cloned the IFNγ of common chickens, and the homology with the IFNγ sequence published on Genbank reached 99.6%. Xu Genliang et al. (2008) cloned and prokaryotically expressed the mature protein gene of IFNγ of Xiaoshan chickens. The experimental sequencing results of Wu Shuhua et al. (2009) showed that the full length of the IFNγ gene of Hy-Line chickens is 495bp, with a complete open reading frame encoding 164 amino acids, and the homology with the IFNγ sequence published abroad is 100%. The above data further illustrate that the coding region of IFNγ is highly conserved in different chicken species.

[0004] In recent years, scholars from various countries have widely carried out research on the antiviral effects of avian recombinant interferons. Chicken recombinant interferon has significant curative effects on viral diseases such as Newcastle disease, infectious bursal disease, infectious bronchitis, Marek's disease, and avian influenza (Ma Liang, 1995). Moreover, recombinant IFNγ has high anti-coccidial activity. Studies have found that IFNγ can inhibit the development of coccidia sporozoites in cells, promote the rapid recovery of broiler chickens from coccidial infection, reduce weight loss caused by coccidiosis, and also has obvious immunomodulatory activity (Ye Xiuhua et al., 2005).

[0005] In the prior art, for the prevention and treatment of virus infections such as avian influenza, the form of a basic vaccine combined with an immune enhancer is mostly adopted. The immune enhancer is usually selected from materials such as traditional Chinese medicine extracts or polypeptides. For example, CN117815385A discloses an immune enhancer with double-stranded polyinosinic acid-polycytidylic acid, muramyl dipeptide, imiquimod, levamisole hydrochloride, concanavalin, and astragalus polysaccharide as active ingredients; CN117180301A discloses the application of heterophylly falsestarwort root polysaccharide in the preparation of live vaccines against Mycoplasma gallisepticum in chickens, etc.

[0006] The technical problem to be solved by the present invention is: how to significantly improve the immune enhancement ability of existing immune enhancers. Summary of the Invention

[0007] In view of the deficiencies of the prior art, the purpose of the present invention is to provide a recombinant plasmid, which can significantly improve the HI antibody level after immunization, and the effect of this recombinant plasmid is more significant than that of a mixed preparation of a recombinant plasmid linked with the IFNγ gene and a recombinant plasmid linked with the Tα1 gene, which shows that the specific IFNγ gene and Tα1 gene selected by the present invention can produce obvious synergy after being cloned onto the vector at the same time. The difference in the protein expression lengths of the recombinant plasmid of the present invention, the recombinant plasmid linked with the IFNγ gene, and the recombinant plasmid linked with the Tα1 gene also proves that even for the same gene, the proteins expressed are different, which is the fundamental reason for the difference in effects.

[0008] Meanwhile, the present invention also discloses a preparation method, a protein composition, uses, a vaccine, and a combined vaccine of the recombinant plasmid.

[0009] To achieve the purpose of this invention, the present invention adopts the following technical solutions:

[0010] A recombinant plasmid, the recombinant plasmid comprises an expression vector and target genes linked to the expression vector, and the target genes include the IFNγ gene and the Tα1 gene;

[0011] The nucleotide sequence of the IFNγ gene is as shown in SEQ ID No.1;

[0012] The nucleotide sequence of the Tα1 gene is shown in SEQ ID No. 2.

[0013] In the above recombinant plasmid, the expression vector is the eukaryotic expression vector pIRES.

[0014] Meanwhile, the present invention also discloses a preparation method of the above-mentioned recombinant plasmid, and specifically, the method is as follows:

[0015] Add restriction enzyme sites to the Tα1 gene using primers Ts1 / Ts2, and add restriction enzyme sites to the IFNγ gene using primers IF3 / IF4; and insert the Tα1 gene and IFNγ gene with added restriction enzyme sites into the expression vector.

[0016] The nucleotide sequence of primer Ts1 is shown in SEQ ID No. 5;

[0017] The nucleotide sequence of primer Ts2 is shown in SEQ ID No. 6;

[0018] The nucleotide sequence of primer IF3 is shown in SEQ ID No. 9;

[0019] The nucleotide sequence of primer IF4 is shown in SEQ ID No. 10.

[0020] In the above preparation method, the expression vector is the eukaryotic expression vector pIRES; the IFNγ gene with added restriction enzyme sites is inserted into the multiple cloning site A region of the eukaryotic expression vector pIRES; the Tα1 gene with added restriction enzyme sites is inserted into the multiple cloning site B region of the eukaryotic expression vector pIRES.

[0021] Meanwhile, the present invention also discloses a protein composition, including a first target protein and a second target protein;

[0022] The amino acid sequence of the first target protein is shown in SEQ ID No. 13;

[0023] The amino acid sequence of the second target protein is shown in SEQ ID No. 14.

[0024] In the above protein composition, it is obtained by prokaryotic expression using the above-mentioned recombinant plasmid.

[0025] The present invention also discloses the use of the above-mentioned recombinant plasmid in the preparation of vaccines.

[0026] The present invention also discloses the use of the above-mentioned protein composition in the preparation of vaccines.

[0027] Finally, the present invention also discloses a vaccine, containing:

[0028] The above-mentioned recombinant plasmid;

[0029] and / or,

[0030] the protein composition as described above.

[0031] And, a combined vaccine, comprising a basic vaccine and an immune enhancer;

[0032] The basic vaccine is a vaccine for preventing and treating viral infections and using inactivated or attenuated viruses as antigens;

[0033] The immune enhancer is the recombinant plasmid as described above; and / or, the protein composition as described above.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The recombinant plasmid can significantly increase the level of HI antibodies after immunization, and the recombinant plasmid has a more significant effect than the mixed preparation of the recombinant plasmid linked with IFNγ gene and the recombinant plasmid linked with Tα1 gene, which shows that the specific IFNγ gene and Tα1 gene selected by the present invention can produce obvious synergy after being cloned onto the vector at the same time. The difference in the protein expression lengths of the recombinant plasmid of the present invention, the recombinant plasmid linked with IFNγ gene, and the recombinant plasmid linked with Tα1 gene also proves that even for the same gene, the proteins expressed are different, which is the fundamental reason for the difference in effects.

[0036] The research of the present invention can further prove that chicken IFNγ and Tα1 have a strong immune promotion effect on the avian influenza H5N1 vaccine, achieving a good immune protection effect; there is a synergistic effect between them, and the effect is the best when expressed in the same expression system (IFNγ-pIRES-Tα1), and shows a certain dose relationship, and the immune effect is the most ideal at a low dose (50 μg / only). This lays a foundation for the application of chicken IFNγ and Tα1 in livestock production. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 is the RT-PCR product of chicken IFNγ gene.

[0038] Figure 2 is the structural schematic diagram of plasmid pMD19-T.

[0039] Figure 3 is the construction schematic diagram of recombinant plasmid pMD19-T-IFNγ.

[0040] Figure 4 is the PCR identification result diagram of chicken IFNγ;

[0041] Figure 5 is the restriction enzyme digestion identification diagram of the recombinant plasmid;

[0042] Figure 6 Nucleotide sequence of chicken IFNγ and its deduced amino acid sequence diagram;

[0043] Figure 7 Phylogenetic relationship analysis diagram based on the nucleotide sequence of the IFNγ gene;

[0044] Figure 8 Phylogenetic relationship analysis diagram based on the amino acid sequence of the IFNγ gene;

[0045] Figure 9 Agarose gel electrophoresis diagram of the PCR amplification product of the Tα1 gene;

[0046] Figure 10 Detection result diagram of the PCR product of the Tα1 gene fragment with restriction enzyme sites added;

[0047] Figure 11 PCR identification result diagram of the recombinant plasmid pcDNA6-Tα1;

[0048] Figure 12 SDS-PAGE detection result of the pcDNA6-Tα1 positive supernatant;

[0049] Figure 13 Agarose gel electrophoresis result diagram of the PCR product of the IFNγ gene with restriction enzyme sites added;

[0050] Figure 14 PCR identification result diagram of the recombinant plasmid pcDNA6-IFNγ;

[0051] Figure 15 Electrophoresis result diagram of the RT-PCR product of cells transfected with pcDNA6-Tα1 and pcDNA6-IFNγ;

[0052] Figure 16A SDS-PAGE detection result diagram of the pcDNA6-IFNγ positive cell supernatant;

[0053] Figure 16B SDS-PAGE detection result diagram of the IFNγ-pIRES-Tα1 positive cell supernatant;

[0054] Figure 17 PCR identification result diagram of the recombinant plasmid pMD19-T-Tα1;

[0055] Figure 18 Restriction enzyme digestion identification result diagram of the recombinant plasmid pMD19-T-Tα1;

[0056] Figure 19 Double restriction enzyme digestion identification diagram of the recombinant plasmid IFNγ-pIRES-Tα1;

[0057] Figure 20 It is a schematic structural diagram of the pIRES plasmid;

[0058] Figure 21 It is a PCR identification result diagram of the recombinant plasmid IFNγ-pIRES;

[0059] Figure 22 It is a PCR identification result diagram of the recombinant plasmid IFNγ-pIRES-Tα1;

[0060] Figure 23 It is a double digestion identification diagram of the recombinant plasmid IFNγ-pIRES-Tα1;

[0061] Figure 24 It is a cell RT-PCR product diagram;

[0062] Figure 25 It is a schematic diagram of the construction of the recombinant plasmid IFNγ-pIRES-Tα1. Specific implementation manners

[0063] The technical solution of the present invention will be further described below through specific implementation manners. Those skilled in the art should understand that the embodiments are only for helping to understand the present invention and should not be regarded as specific limitations to the present invention.

[0064] Before elaborating on each embodiment and comparative example, the sources of the relevant raw materials involved in the present invention are introduced:

[0065] The genetic engineering host bacterium E.coil DH5α is preserved by the Genetic Engineering Laboratory of the College of Animal Science, South China Agricultural University, and its genotype is: supE44, △lacU169(ф80, lacZΔM15, hsdR17, recA1, endA1, gyrA96, thi-1, relA1;

[0066] The pMD19-T vector plasmid system is a product of TaKaRa Bio Inc., Dalian;

[0067] pcDNA6 / His TM The eukaryotic expression plasmid is a product of Invitrogen Corporation;

[0068] The restriction endonucleases EcoRI (15u / uL), XhoI (10u / uL), NheI (10u / uL), XbaI (10u / uL), SalI (10u / uL) and their corresponding buffers are products of Promega Corporation;

[0069] ExTaq enzyme, DNA Ligation Kit (Mighty Mix), and calf intestinal alkaline phosphatase (CIAP) are products of TaKaRa;

[0070] pUC18 / Msp I Marker and DNA Marker 15000 molecular weight standard are products of Guangzhou Dongsheng Biotechnology Co., Ltd.;

[0071] pUC18 / Msp I: 501, 404, 353, 242, 149, 147, 110, 89, 67, 34 bp.

[0072] DL15000: 15,000, 10,000, 7,500, 5,000, 2,500, 1,000, 250 bp.

[0073] Endotoxin-free plasmid large-scale extraction kit is a product of TIANGEN Biotech Co., Ltd.;

[0074] Acrylamide and N,N'-methylenebisacrylamide are purchased from Huamei Biological Engineering Company;

[0075] Tris(hydroxymethyl)aminomethane (Tris), sodium dodecyl sulfate (SDS), and glycine (analytical grade) are purchased from Beijing Dingguo Biotechnology Co., Ltd.;

[0076] TEMED (N,N,N',N'-tetramethylethylenediamine) is a product of Promega;

[0077] Low molecular weight standard protein (94,000, 66,200, 45,000, 35,000, 26,000, 20,000, 14,400) is purchased from Baotaihe Biotechnology Co., Ltd.;

[0078] Small peptide protein molecular weight standard (20,000, 15,000, 10,000, 6,000, 3,500, 2,500) is purchased from Jevett Biotechnology Co., Ltd.;

[0079] Prestained protein molecular weight standard (Prestained SDS-PAGE standards, Mid Range) (2 - 105 kDa) is a product of Hou-Bio;

[0080] Nitrocellulose membrane is purchased from Gene Company;

[0081] NBT / BCIP is a product of AMRESCO;

[0082] Coomassie Brilliant Blue G250 is purchased from Shanghai Sangon Biological Engineering Co., Ltd.;

[0083] Lipofectamine TM 2000 liposome transfection kit is a product of Invitrogen;

[0084] LB liquid medium: 10 g of Tryptone, 5 g of Yeast Extract, 10 g of NaCl, made up to 1000 mL with double-distilled water, autoclaved for 20 min and stored at 4 °C;

[0085] LB solid medium: Add agar powder to LB liquid medium to a final concentration of 1.5% (w / v) (15 g), autoclave, pour into petri dishes when cooled to about 45 °C, and store at 4 °C after solidification;

[0086] Agar plate containing Amp (100 μg / mL): When the temperature of the sterilized LB solid medium drops to about 50 °C, add Amp to a final concentration of 100 μg / mL, dispense into sterilized petri dishes, and store at 4 °C after solidification;

[0087] Amp stock solution: Prepared with triple-distilled water at 100 mg / mL, filtered and sterilized with a 0.22 μm filter membrane, aliquoted and stored at -20 °C;

[0088] DMEM medium, fetal bovine serum, and trypsin were all purchased from GIBCO;

[0089] Basic culture medium: 0.37 g of NaHCO 3 , 0.25 g of glucose were dissolved in 100 ml of DMEM medium, the pH was adjusted to 6.8 - 7.0 with 1 mol / l HCl, filtered and sterilized with a 0.22 μm filter membrane, and stored at 4 °C;

[0090] Complete culture medium: Basic culture medium containing 10% fetal bovine serum, with penicillin, streptomycin, and L-glutamine added to final concentrations of 100 IU / mL, 100 μg / mL, and 1 mmol / mL respectively;

[0091] Solution A (acrylamide stock solution): 30% (w / v) acrylamide, 0.8% (w / v) N,N'-methylenebisacrylamide, prepared with triple-distilled water, stored in a brown bottle at 4 °C in the dark;

[0092] Solution B (4× separating gel buffer): 1.5 mol / L Tris-HCl (pH 8.8), 0.4% SDS; stored at 4 °C;

[0093] Solution C (4× stacking gel buffer): 0.5 mol / L Tris-HCl (pH 6.8), 0.4% SDS; stored at 4 °C;

[0094] 1×SDS-PAGE electrophoresis buffer: 25 mmol / L Tris-HCl, 250 mmol / L glycine, 0.1% SDS, adjust the pH value to 8.3, store at room temperature;

[0095] 5×SDS-PAGE loading buffer: 60 mmol / L Tris-HCl (pH 6.8), 14.4 mmol / L DTT, 2% SDS, 0.1% bromophenol blue, 25% glycerol;

[0096] Coomassie brilliant blue staining solution: 0.25 g Coomassie brilliant blue is dissolved in 100 mL methanol / acetic acid solution and filtered through Whatman No. 1 filter paper;

[0097] Decolorizing solution (methanol / acetic acid solution): 100 mL methanol, 100 mL glacial acetic acid, 800 mL double-distilled water;

[0098] Transfer buffer: 25 mmol / L Tris, 192 mmol / L glycine, 20% (v / v) methanol, 0.037% (w / v) SDS, adjust the pH value to 8.3 with HCl;

[0099] TBS buffer: 150 mmol / L NaCl, 10 mmol / L Tris-HCl (pH 7.5);

[0100] Blocking solution: 5% (w / v) non-fat dry milk, 0.5% Tween 20, prepared with TBS buffer;

[0101] 1% non-fat dry milk / TBS: TBS solution containing 1% non-fat dry milk, used for dilution of antibodies (including primary antibody and secondary antibody);

[0102] Chromogenic solution: Dissolve 6 mg 3,3'-diaminobenzidine in 9 mL 0.01 mol / L Tris-HCl (pH 7.6) buffer, add 1 mL 0.3% cobalt chloride (CoCl 2 ), and finally add 10 μL 30% hydrogen peroxide (H 2 O 2 ), mix well and use immediately;

[0103] His Taq AP Western Reagents kit for anti-6×His is purchased from Beijing Biosynthesis Biotechnology Co., Ltd.;

[0104] Chicken IFNγ ELISA kit is purchased from Shanghai Jingtian Biotechnology Co., Ltd.;

[0105] One-day-old White Leghorn SPF chickens are purchased from the SPF chicken farm of Guangdong Wens Foodstuff Group Co., Ltd.;

[0106] The highly pathogenic avian influenza virus strain H5N1 was collected and preserved by the Laboratory of Animal Molecular Virology and Animal Virus Immunology, School of Life Sciences, Sun Yat-sen University.

[0107] 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), a product of Sigma, was purchased from Guangzhou Meijin Biotechnology Co., Ltd.

[0108] Lymphocyte separation medium (Ficoll-Paque PLUS) was a product of Tianjin Haoyang Biological Products Co., Ltd.

[0109] Fetal bovine serum (FBS) was purchased from GIBCO BRL.

[0110] Concanavalin A (ConA) was a product of Sigma.

[0111] Sodium dodecyl sulfate (SDS) was purchased from Beijing Dingguo Biotechnology Co., Ltd.

[0112] Procaine was purchased from the Pet Hospital of South China Agricultural University.

[0113] Inactivated avian influenza vaccine (H5 subtype, RE-5) and standard antigen were provided by the Poultry Research Laboratory, Production Technology Department, Guangdong Wens Group.

[0114] 10×PBS solution: Dissolve 15.4 g of Na 2 HPO·12H 2 O, 2 g of KH 2 PO 4 , 80 g of NaCl, 2 g of KCl, make up the volume to 1,000 ml with double-distilled water, autoclave at 121°C for 20 min and store at room temperature. The working solution is 1×PBS, pH 7.2.

[0115] Anticoagulant: Dissolve 3.8 g of trisodium citrate in 100 mL of 1×PBS solution and filter through a 0.22-μm membrane filter.

[0116] RPMI 1640 culture medium: It contains 2 mmol / L of glutamine, inactivated 10% fetal bovine serum, 100 units of penicillin and streptomycin per milliliter.

[0117] Trypan blue staining solution: Dissolve 0.2 g of trypan blue in 100 mL of 1×PBS solution, filter through filter paper and store at room temperature.

[0118] MTT solution: Prepare a solution with a concentration of 5 mg / mL using 1×PBS solution containing 0.05% glucose, filter through a 0.22-μm membrane filter to remove bacteria, store at 4°C in the dark. During the preparation and storage process, it is best to wrap the container with aluminum foil and use it freshly prepared.

[0119] Acidified SDS solution: SDS is dissolved in 0.01 moL / L hydrochloric acid solution with a final concentration of 100 g / L, and it is prepared before use;

[0120] ConA solution: Prepared to the optimal concentration with serum-free RPMI-1640, filtered and sterilized, and stored at 4°C;

[0121] FITC-labeled rabbit anti-chicken CD3 + , CD4 + , CD8 + Monoclonal antibodies against surface marker proteins were purchased from USASouthernBiotech.

[0122] The first part

[0123] 1. Source, homology and phylogenetic tree analysis of chicken IFNγ gene

[0124] The chicken IFNγ gene selected in the present invention is derived from lymphocytes isolated from the spleen tissue of Foshan partridge chickens;

[0125] The cDNA length of the Foshan partridge chicken IFNγ gene is 495 bp, encoding 164 amino acids with a molecular weight of 16.8 KD. Comparing the obtained gene sequence with the IFNγ sequences of different chicken breeds and other species, it was found that the nucleotide sequence homology of this sequence with the IFNγ genes of other different chicken breeds was between 93.5% and 100%, and the amino acid homology was between 87.3% and 99.4%; the nucleotide homology with the IFNγ sequences of other species was 28.5% - 95.6%, and the amino acid homology was 6.4% - 93.3%; among them, the homology with Japanese quail was the highest, and the homology with mammals was relatively low. This indicates that the chicken IFNγ gene is very conservative and has high species specificity.

[0126] Its specific source is as follows: Using the designed specific primers C1 / C2 (sequences are as follows), by RT-PCR, specific fragments were amplified from the total RNA extracted from the spleen tissue lymphocytes of Foshan partridge chickens stimulated with ConA for 12, 16, and 20 h. The RT-PCR products were detected by electrophoresis on 1% agarose gel, and an electrophoresis band about 500 bp long could be seen (see Figure 1 ), and the size was consistent with the expected. No specific fragment was amplified from the total RNA of spleen tissue lymphocytes not stimulated with ConA, nor from the total RNA of peripheral blood and spleen tissue lymphocytes stimulated with ConA for 4 and 8 h.

[0127] C1: 5’-CG GAATTC CCACCATGACTTGCCAGAC-3’ (SEQ ID No.15)

[0128] C2: 5’-GCGTCGAC TTAGCAATTGCATCTCCTCTGA-3’(SEQ ID No.16)

[0129] Figure 1 Each marker in it is: M: DNA Marker DL2000; 1: RT-PCR product of unstimulated chicken spleen lymphocytes; 2, 3, 4, 5, 6 are RT-PCR products of spleen lymphocytes induced by ConA for 4, 8, 12, 16, 20 h respectively.

[0130] After purification, the RT-PCR product of chicken IFNγ gene was inserted into the foreign gene insertion site of pMD19-T vector (see Figure 2 ), and the recombinant plasmid carrying the IFNγ gene was obtained, named pMD19-T-IFNγ (see Figure 3 ).

[0131] The specific preparation method of recombinant plasmid pMD19-T-IFNγ is as follows:

[0132] 1.1 RT-PCR amplification reaction of IFNγ gene

[0133] The target gene (SEQ ID No.1) was amplified by RT-PCR method, and the specific operation was carried out with reference to the instruction manual of PrimeScript TM OneStep RT-PCR Kit Ver.2.

[0134] The RT-PCR reaction system was:

[0135]

[0136] The above reaction system was mixed and centrifuged, and the following reaction program was executed on a PCR Express Gradient PCR instrument: 50 °C for 30 min, pre-denaturation at 94 °C for 2 min, one cycle; 94 °C for 30 s, annealing at 56 °C for 40 s, extension at 72 °C for 1 min, 30 cycles. The amplified product was detected by 1% agarose gel electrophoresis (containing 0.5 μg / mL EB).

[0137] Figure 6 is the nucleotide sequence of chicken IFNγ and its deduced amino acid sequence (SEQ ID No.13). The underlined parts in the figure are primers and two glycosylation sites.

[0138] 1..2 Recovery and purification of PCR products

[0139] Perform according to the instruction manual of the gel purification kit from Omega. After the PCR products are electrophoresed on 1% agarose gel, cut out the agarose gel containing the target DNA fragment as small as possible, chop it up and add Binding Buffer at a weight ratio of 1:3 (DNA fragment: Binding Buffer, weight / volume ratio), and incubate in a 65°C water bath until the gel completely melts; add the above solution to an ion exchange column, centrifuge at 10,000 rpm for 1 min, and discard the filtrate; add 700 μL of elution buffer containing alcohol and elute twice at 10,000 rpm, pour out the filtrate, and centrifuge again at 10,000 rpm for 1 min to spin out the residual washing solution. Place the purification column in a new centrifuge tube, add an appropriate amount of preheated triple-distilled water, let it stand at room temperature for 1 min, centrifuge at 10,000 rpm to elute the nucleic acid, and detect the recovery effect by 1% agarose electrophoresis. Store the purified DNA at -20°C for later use.

[0140] 1.3 Construction of pMD19-T-IFNγ recombinant plasmid

[0141] The ligation of the PCR product and the pMD19-T vector was carried out according to the instruction manual of the pMD9-T Vector kit. The ligation reaction system was (total 10 μL):

[0142] Solution I 5 μL

[0143] Purified PCR product 4 μL

[0144] pMD19-T Vector 1 μL

[0145] After mixing and centrifuging, ligate overnight at 4°C to obtain the ligation product recombinant plasmid pMD19-T-IFNγ. The ligation product was directly used for transformation.

[0146] Transform the above recombinant plasmid into E. coli DH5α, spread it on an LA plate, culture overnight at 37°C, pick the white single colonies of the transformed E. coli DH5α for culture, and directly use the cultured bacterial solution as a template for PCR identification. An amplified fragment of about 500 bp was obtained (see Figure 4 ). Using Primer5.0 software to analyze the reported chicken IFNγ gene sequence, it was found that it contains an EcoR V restriction enzyme site. If digested with EcoR V, the chicken IFNγ gene will be cut into two fragments. Therefore, the plasmid extracted from the PCR positive colonies was digested and identified with EcoR I and Sal I. The digested recombinant plasmid produced two bands. One was the vector plasmid, about 2,600 bp in size, and the other was the inserted foreign fragment, about 500 bp in size (see Figure 5 ). The results showed that the full-length cDNA of the chicken IFNγ gene had been successfully cloned into the vector plasmid pMD19-T vector.

[0147] Figure 4 The meanings of each label are as follows: M: DNA Marker DL2000; 0: negative control; 1, 2, 4, 5, 6, 7, 8: positive clones of pMD19-T-IFNγ, and the size of the amplification product is 513 bp; 3: transformant without inserted IFNγ gene.

[0148] Figure 5 The meanings of each label are as follows: M1: DL2000 plus; M2: DNA Marker DL2000; 1: double digestion product of pMD19-T-IFNγ plasmid; 2: PCR product of IFNγ, with a size of 513 bp.

[0149] The recombinant plasmid pMD19-T-IFNγ identified by PCR and enzyme digestion was sent to Shanghai Sangon Biotech Co., Ltd. for sequence determination. A gene fragment with a length of 513 bp was obtained through sequence determination, which contains a complete open reading frame with a length of 495 bp, encoding a precursor protein of 164 amino acids in total. The 19 amino acid residues at the N-terminus form a signal peptide, the mature protein is 145 amino acids, with a molecular weight of approximately 16.8 kD, containing two glycosylation sites and a stop codon (see Figure 6 ). Figure 6 In it, the underlined parts are primers and two glycosylation sites.

[0150] The full-length IFNγ gene sequence obtained by measurement was compared with the registered IFNγ nucleotide sequences in GenBank through the NCBI BLAST program. The results showed that the IFNγ nucleotide sequence obtained in this experiment had 100% homology with the Gallus gallus IFNγ with accession numbers AY501004, X99774, and U27465 respectively, and the top 9 sequences with relatively high homology were all Gallus gallus IFNγ genes.

[0151] The DNA sequences obtained in this experiment were compared with the DNA sequences of IFNγ from different animals in GenBank and the sequences of other chicken breeds using DNASTAR software. They were AF424744 (Shiqi hybrid chicken), AJ001263 (guinea fowl), AJ001289 (pheasant), AJ634956 (Indian broiler), AY163160 (Huiyang bearded chicken), AY501004 (White Leghorn), AY705909 (ISA Brown), DQ470471 (Luoyang native chicken), NM205149 (red jungle fowl), U27465 (Roman chicken), X99774 (avain), AJ000725 (turkey), AJ001678 (Japanese quail), AJ012254 (duck), AY524421 (goose), DQ479967 (pigeon), AB010386 (rabbit), AF126247 (dog), AF493993 (pig), BC119065 (mouse), DQ410715 (sheep), EU000431 (giraffe), EU000433 (horse), X07902 (cow), DQ630727 (giant panda), AY376145 (rhesus monkey), X13274 (human). Through comparison, it can be seen that the nucleotide sequence homology of the IFNγ gene cloned in the present invention with that of mammals (such as human, pig, cow, sheep, etc.) and other strains of poultry is 28.5% - 33.9% and 93.5% - 100% respectively. Among the comparisons of the IFNγ nucleotide sequence homology between different species, the homology between chicken and Japanese quail IFNγ genes is the highest, at 95.8%, and the homology between chicken and cow is the lowest, at 27.6%.

[0152] The DNA sequences were converted into the corresponding amino acid sequences for homology comparison. The results showed that the amino acid sequence homology of the IFNγ gene cloned in this experiment with that of mammals (such as human, pig, cow, sheep, etc.) and other strains of poultry is 6.4% - 8.5% and 66.7% - 99.4% respectively. Among the comparisons of the IFNγ amino acid sequence homology between different species, the homology between chicken and Japanese quail IFNγ genes is the highest, at 93.3%, and the homology between chicken and sheep, giraffe, giant panda and duck, goose is the lowest, all at 5.5%.

[0153] From the phylogenetic tree of the nucleotide sequence and the deduced amino acid sequence ( Figure 7 , Figure 8 ), it can be seen that chicken IFNγ is on the same branch as Japanese quail, pigeon, duck and goose. The species on this branch all belong to poultry, while bovine, ovine, giraffe, porcine, canine, giant panda, rhesus monkey, human, rabbit, equine and murine IFNγ are on another branch, and the species in this branch belong to mammals.

[0154] 2. Synthesis and identification of Tα1 sequence

[0155] Synthesis of 2.1Tα1 sequence

[0156] The 28 amino acids of Tα1 (SEQ ID No.14) were converted into a nucleotide sequence as follows:

[0157] 5′AGC GAC GCC GCC GTG GAC ACC AGC AGC GAG ATC ACC ACC AAG GAC CTG AAGGAG AAG AAG GAG GTG GTG GAG GAG GCC GAG AAC 3′(SEQ ID No.2)

[0158] 3′TCG CTG CGG CGG CAC CTG TGG TCG TCG CTC TAG TGG TGG TTC CTG GAC TTCCTC TTC TTC CTC CAC CAC CTC CTC CGG CTC TTG 5′(Complementary sequence of SEQ ID No.2)

[0159] According to the above nucleotide sequence, two fragments T1 and T2 were designed to amplify the Tα1 gene. The fragment sequences are as follows:

[0160] T1: AGCGACGCCGCCGTGGACACCAGCAGCGAGATCACCACCAAGGA CCTG(SEQ ID No.11)

[0161] T2: GTTCTCGGCCTCCTCCACCACCACCTCCTTCTCCTTCAGGTCCTTGGT(SEQ ID No.12)

[0162] 2..2 PCR amplification of Tα1 gene

[0163] The Tα1 gene fragment was amplified by PCR method with primers T1 and T2 using itself as a template. The total volume of the PCR reaction system was 100 μL, and the composition was as follows:

[0164]

[0165] After mixing the above reaction systems respectively and centrifuging, the following reaction program was performed on a PCR Express Gradient PCR instrument: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 40 s, annealing at 56°C for 40 s, extension at 72°C for 1 min, 30 cycles; final extension at 72°C for 20 min. The PCR products were detected by 3% agarose gel electrophoresis.

[0166] ReferenceFigure 9 , Figure 9 It is the agarose electrophoresis map of the product of PCR amplification of the Tα1 gene;

[0167] Figure 9 In it, the meanings of each label are: M: Marker pUC18 / MspI; 1, 2: PCR products of the Tα1 gene fragment, with a size of 84bp;

[0168] 2.3 Recovery and purification of PCR products

[0169] It is carried out according to the instruction manual of the gel purification kit of Omega company.

[0170] 2.4 Construction of pMD19-T-Tα1 recombinant plasmid

[0171] It is carried out with reference to the instruction manual of the pMD9-T Vector kit. The ligation reaction system is (a total of 10 μL):

[0172] Solution I 5 μL

[0173] PCR product of the Tα1 gene 4 μL

[0174] pMD19-T Vector 1 μL

[0175] After mixing and centrifuging, it is ligated overnight at 4°C. The ligation product is directly used for transformation.

[0176] 2.5 Transformation of the ligation product into DH5α competent cells

[0177] Take the ligation product in 2.4 and transform it into E.coil DH5α competent cells by the same method as 1.3. Pick a single colony from the above overnight culture plate, inoculate it into 3 mL of LB liquid medium containing Amp (100 mg / L), shake and culture it overnight at 37°C, and directly use the bacterial liquid as a template for PCR reaction for identification, and at the same time set up a negative control.

[0178] 2.6 Enzyme digestion identification of recombinant plasmid

[0179] Select the transformant with a positive PCR result, shake and culture it overnight at 37°C and 220 rpm, and extract the plasmid using the E.Z.N.A.Plasmid Minipreps Kit. Carry out enzyme digestion identification on the above recombinant plasmid, and the enzyme digestion reaction systems are as follows respectively:

[0180] The enzyme digestion reaction system of the recombinant plasmid pMD19-T-Tα1 is:

[0181]

[0182] After centrifuging and mixing, digest with enzymes at 37°C for 2 h.

[0183] After purification, the PCR product of the Tα1 gene was inserted into the foreign gene insertion site of the pMD19-T vector to obtain a recombinant plasmid carrying the Tα1 gene, named pMD19-T-Tα1. The above recombinant plasmid was transformed into E. coli DH5α, spread on an LA plate, and cultured overnight at 37°C. White single colonies of transformed E. coli DH5α were picked for culture, and PCR identification was directly performed using the cultured bacterial solution as a template. A fragment about 90 bp long was amplified (see Figure 17 ). After extracting the plasmid from the bacterial solution identified as positive by PCR, EcoR V was used for enzyme digestion identification. The digested recombinant plasmid produced two bands. One was the vector plasmid, about 2,600 bp in size, and the other was the inserted foreign fragment, about 90 bp in size (see Figure 18 ). The results showed that the Tα1 gene had been successfully cloned into the vector plasmid pMD19-T.

[0184] Figure 17 For the PCR identification results of the recombinant plasmid pMD19-T-Tα1, the meanings of each label in the attached figure are as follows: M: Marker pUC18 / MspI; 0: negative control; 1, 2, 3, 4, 5, 6, 7, 9: pMD19-T-Tα1 positive clones, and the product size is 84 bp; 8: transformant without the inserted Tα1 gene

[0185] Figure 18 For the enzyme digestion identification results of the recombinant plasmid pMD19-T-Tα1, the meanings of each label in the attached figure are as follows: M1: DNA Marker DL15000; M2: DNA Marker DL2000; 1: enzyme digestion product of the recombinant plasmid pMD19-T-Tα1; 2: PCR product of the Tα1 gene.

[0186] The second part

[0187] Construction and expression of recombinant eukaryotic expression plasmids of chicken IFNγ and TA1

[0188] 2.1 Synthesis and identification of the recombinant plasmid pcDNA6-IFNγ

[0189] 2.1.1 Synthesis of primers for the recombinant plasmid

[0190] Using Primer5.0 software, according to the restriction enzyme sites on the pcDNA6 / His TM vector, primers IF1 / IF2 were designed for the ligation of the IFNγ gene and the pcDNA6 / His TM vector. The primer sequences are as follows:

[0191] IF1: TAT GAATTCTGATGACTTGCCAG (SEQ ID No.7)

[0192] IF2: TAT CTCGAG CTTAGCAATTGCA (SEQ ID No.8)

[0193] The primers were synthesized by Beijing AuGCT DNA Technology Co., Ltd. The synthesized primers were diluted with triple-distilled water to 25 mM

[0194] The solution was stored at -20 °C.

[0195] 2.1.2 PCR Amplification of IFNγ Gene with Added Restriction Enzyme Sites

[0196] Different restriction enzyme sites were added to the IFNγ gene through primers IF1 / IF2;

[0197] The pMD19-T-IFNγ recombinant plasmid in the first part was diluted 100-fold and used as the template for the PCR reaction. The total volume of the PCR reaction system was 100 μL, which was respectively:

[0198]

[0199]

[0200] After mixing the above reaction systems respectively and centrifuging, the following reaction program was executed on a PCR Express Gradient PCR instrument: pre-denaturation at 94 °C for 3 min, one cycle; 94 °C for 40 s, 56 / 62 / 53 / 57 °C for 40 s, 72 °C for 1 min, 30 cycles; post-extension at 72 °C for 20 min. The PCR products were detected by 3% and 1% agarose gel electrophoresis respectively.

[0201] Refer to Figure 13 , Figure 13 For the agarose gel electrophoresis results of the PCR products of the IFNγ gene with added restriction enzyme sites; the meanings of each label in the figure are: DNA Marker DL2000; 1, 2: PCR products with IF1 / IF2 as primers, with a size of 516 bp; 3, 4: PCR products with IF3 / IF4 as primers, with a size of 513 bp;

[0202] 2.1.3 Recovery and Purification of PCR Products

[0203] It was carried out according to the instruction manual of the gel purification kit of Omega company.

[0204] 2.1.4 Restriction Enzyme Digestion of PCR Purified Products and Ligation Vectors

[0205] 2.1.4.1 Restriction Enzyme Digestion Reaction of PCR Purified Products and pcDNA6 / His Empty Plasmid

[0206] The enzymatic digestion reaction system of the PCR product amplified by primers IF1 / IF2 is as follows:

[0207]

[0208] Centrifuge and mix the above reaction system, and digest with enzymes at 37°C for 4 h.

[0209] The enzymatic digestion reaction system of the pcDNA6 / His empty plasmid is as follows:

[0210]

[0211]

[0212] After centrifuging and mixing, digest with enzymes at 37°C for 4 h.

[0213] 2.1.4.2 Recovery of the Enzymatic Digestion Product

[0214] Prepare a 1% agarose gel recovery gel. After electrophoresis of the enzymatic digestion product, cut off the agarose gel containing the target DNA fragment as small as possible, and recover it according to the instructions of the gel purification kit of Omega company.

[0215] 2.4.1.3 Ligation of the Enzymatic Digestion Product and the Vector

[0216] The ligation reaction system is (15 μL in total):

[0217] PCR enzymatic digestion and recovery product 6 μL

[0218] Plasmid enzymatic digestion and recovery product 1.5 μL

[0219] Ligation Mix 7.5 μL

[0220] After mixing and centrifuging, ligate overnight at 4°C. The ligation product is directly used for transformation.

[0221] 2.1.5 Transformation of the Ligation Product into DH5α Competent Cells

[0222] Take the ligation product in 2.4.1.3 and transform it into E.coil DH5α competent cells. Take 50 μL of the above-prepared competent cells, add 5 μL of the ligation product prepared in 1.2.4.1, mix well and incubate on ice for 30 min, heat shock at 42°C for 90 s, then quickly incubate on ice for 2 min, add 200 μL of LB liquid medium without antibiotics, and shake and culture at 37°C in a shaker at 160 rpm for 45 min; spread the bacterial solution on a preheated LB plate containing Amp and culture overnight at 37°C.

[0223] 2.1.6 Screening and Identification of Positive Colonies

[0224] Pick a single colony from the overnight culture plate and inoculate it into 3 mL of LB liquid medium containing Amp (100 mg / L). Incubate it with shaking at 37 °C overnight, and directly use the bacterial solution as a template for PCR reaction for identification. At the same time, set up a negative control. The reaction system is as follows:

[0225]

[0226]

[0227] The PCR reaction program is the same as in 2.1.2. The PCR products are detected by 1% agarose gel electrophoresis.

[0228] 2.1.7 Restriction Enzyme Identification of Recombinant Plasmids

[0229] Select the transformants with positive PCR results and incubate them with shaking at 37 °C and 220 rpm overnight. Extract the plasmids using the E.Z.N.A. Plasmid Minipreps Kit. Perform restriction enzyme identification on the above recombinant plasmids. The restriction enzyme reaction systems are as follows:

[0230]

[0231] After centrifugation and mixing, digest at 37 °C for 2 h. The digested products are detected by 3% and 1% agarose gel electrophoresis respectively.

[0232] Reference Figure 14 , Figure 14 For the PCR identification results of the recombinant plasmid pcDNA6-IFNγ, the meanings of each label in the figure are: M: DNA Marker DL2000; 1, 2, 5, 6, 7, 8, 9: positive clones of pcDNA6-IFNγ, the size of the PCR products is about 500 bp; 0: negative control; 3, 4: transformants without inserted IFNγ gene.

[0233] 2.1.8 Sequence Determination of the Reading Frame of Positive Clones

[0234] Send the bacterial solution that is positive by the above PCR identification and positive by plasmid double digestion identification to Shanghai Boshang Biotechnology Co., Ltd. for sequence determination.

[0235] 2.1.9 Large-scale Extraction of Recombinant Eukaryotic Plasmids

[0236] Refer to the TIANGEN endotoxin-free plasmid large-scale extraction kit to obtain the endotoxin-free plasmid pcDNA6-IFNγ. The specific operation method is as follows:

[0237] (1) Inoculate the correctly sequenced positive bacterial liquid into 400 mL of LB medium containing Amp, and culture it overnight with shaking at 37°C. To obtain the best results, approximately 1 mL of positive bacterial liquid can be used as the inoculum;

[0238] (2) Column equilibration step: Add 2.5 mL of equilibration buffer BL to the adsorption column CP5 (the adsorption column is placed in a 50 mL collection tube), centrifuge at 10,000 rpm for 2 min, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube (the column treated with the equilibration buffer is preferably used immediately);

[0239] (2) Aliquot the overnight cultured bacterial liquid into 100 mL centrifuge tubes, centrifuge at 10,000 rpm for 5 min at room temperature to collect the bacteria, pour out or aspirate the culture medium and discard it, try to aspirate the supernatant as much as possible. To ensure that all the supernatant is aspirated, use a clean pipette tip to aspirate the water droplets on the tube wall;

[0240] (3) Add 7 mL of P1 solution (RNase A has been added) to the centrifuge tube with the bacterial cell pellet, vortex or pipette to thoroughly suspend the bacterial cell pellet;

[0241] (4) Add 7 mL of P2 buffer to the resuspension, immediately gently invert the mixture up and down 6 - 8 times to obtain a clear lysate, and let the lysate stand at room temperature for 5 min;

[0242] (5) Add 7 mL of solution P4 to the centrifuge tube, immediately gently invert it up and down 6 - 8 times to mix well. At this time, a white flocculent precipitate will appear. Then let it stand at room temperature for about 10 minutes. Centrifuge at 10,000 rpm for 5 - 10 min, pour all the solution into the filter CS, slowly push the push handle to filter, and collect the filtrate in a clean 50 mL centrifuge tube;

[0243] (6) Add isopropanol with a volume 0.3 times that of the filtrate to the filtrate (adding too much isopropanol is likely to cause RNA contamination), invert to mix well and transfer it to the adsorption column CP5. Centrifuge at 10,000 rpm for 2 min at room temperature, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0244] (7) Add 10 mL of washing buffer PW containing absolute ethanol to the adsorption column, centrifuge at 10,000 rpm for 2 min, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube; Repeat the washing once;

[0245] (8) Add 3 mL of absolute ethanol to the adsorption column, centrifuge at 10,000 rpm for 2 min at room temperature, pour out the waste liquid in the collection tube; Place the adsorption column back into the collection tube, centrifuge at 10,000 rpm for 5 min and then let it stand at room temperature for several minutes to remove the residual washing buffer in the adsorption column;

[0246] (9) Place the adsorption column CP5 in a clean 50 mL collection tube. Suspend and add 1 - 2 mL of elution buffer TB to the middle position of the adsorption membrane. After standing at room temperature for 5 min, centrifuge at 10,000 rpm for 2 min. Transfer all the eluate in the 50 mL centrifuge tube to a clean 1.5 mL centrifuge tube and store it at -20 °C.

[0247] (10) Dilute an appropriate sample 20 - 50 times and measure its absorbance at 260 nm and 280 nm. The plasmid concentration can be calculated according to the following formula:

[0248] [DNA concentration] = OD 260 ×50×(dilution factor) μg / ml

[0249] The OD 260 of the purified plasmid DNA and the OD 280 ratio is usually around 1.8 - 2.0 and can be directly used for cell transfection and even in vivo experiments in animals.

[0250] 2.1.10 Liposome-mediated transfection of eukaryotic expression vector into COS-7 cells

[0251] 2.1.10.1 Resuscitation, culture, and subculture of COS-7 cells

[0252] (1) Take out the IMDM complete culture medium supplemented with calf serum and double antibiotics from the refrigerator and warm it to room temperature.

[0253] (2) Take out the COS-7 cell cryopreservation tube from liquid nitrogen, quickly place it in a 37 °C water bath, and shake it to melt in about 1 min.

[0254] (3) Centrifuge at 800 r / m for 5 min at room temperature, discard the supernatant, add about 1.5 mL of IMDM complete culture medium for rinsing, centrifuge for 5 min and then discard the supernatant. Add fresh culture medium to resuspend the cells by pipetting, transfer them to a culture flask, add culture medium to a total volume of about 4 mL, and culture them in a 5% CO 2 incubator at 37 °C.

[0255] (4) When the cells reach the optimal growth state, continue to subculture them in a 6-well plate. When the cell plating density reaches 90% - 95%, they can be used for transfection experiments.

[0256] 2.1.10.2 Transfection of pcDNA6-IFNγ recombinant plasmid and pcDNA6 empty plasmid into COS-7 cells

[0257] Use the liposome method to transfect the plasmid into COS-7 cells. The specific operation is as follows:

[0258] (1) At 3×105 ~4×10 5 / mL density, inoculate COS-7 cells on a 6-well cell culture plate, and use 2 mL of culture medium containing fetal bovine serum in a 5% CO 2 incubator at 37 °C until the cells reach 90% - 95% confluence;

[0259] (2) Prepare Solution A: Add 5 μg of detoxified plasmid pcDNA6-IFNγ to 100 μL of culture medium; Solution B: Add 5 μL of transfection reagent to 100 μL of culture medium, incubate for 5 min; gently mix Solutions A and B and incubate at room temperature for 20 min;

[0260] (3) After rinsing the cells in the 6-well plate twice with serum-free medium, add 2 mL of serum-free medium;

[0261] (4) Dropwise add the mixture of the two solutions into the wells, shake the culture plate gently to mix well. Incubate in a 5% CO 2 incubator at 37 °C for 12 h, then replace with complete medium and continue culturing;

[0262] (5) Start harvesting the cell culture supernatant into a 5 mL sterile tube 24 h after cell transfection, centrifuge at 3,000 rpm for 5 min, transfer the supernatant to a new centrifuge tube, and concentrate it with sucrose. Continue to passage the cells and collect the culture supernatant after passage, and perform the same treatment. Store the obtained cell supernatant at -80 °C for later use.

[0263] 2.1.11 RT-PCR Detection of Recombinant Plasmid Transfected into COS-7 Cells

[0264] RT-PCR detection mainly includes two parts: extraction of total cellular RNA and RT-PCR identification.

[0265] (1) Extraction of Total Cellular RNA

[0266] Collect the transfected cells at 2.1.10.2, freeze and thaw them several times repeatedly. The total RNA was extracted using TRIzol Reagent RNA kit. The specific steps are as follows: Add 1 mL of Trizol to each well of the six-well plate (transfected and untransfected COS-7 cells), place on ice for 5 min, and pipette with a pipette tip; Aspirate the lysate from each well into a 1.5 mL EP tube, add 0.2 mL of chloroform per tube, shake vigorously for 15 s, incubate at 15 °C - 30 °C for 2 - 3 min, and centrifuge at 4 °C at 12,000 rpm for 15 min; After centrifugation, the liquid is divided into three layers (the upper colorless aqueous layer is RNA, the middle white layer is DNA, and the bottom red layer is protein). Carefully aspirate the upper colorless liquid and transfer it to a new EP tube; Add an equal volume of isopropanol (0.4 - 0.5 ml), mix well, incubate at 15 °C - 30 °C for 10 - 30 min, and centrifuge at 4 °C at 12,000 rpm for 15 min (if an equal volume of isopropanol is added, seal it with a PE glove on a test tube rack and place it in a 4 °C refrigerator, the precipitation for 30 min has a better effect); Discard the supernatant, add 1 mL of 75% ethanol to the precipitate, vortex for 30 s, and centrifuge at 4 °C at 7,500 rpm for 5 min; Carefully discard the supernatant, and air-dry the precipitate in the tube in the laminar flow hood for 3 - 5 min. It is best to aspirate the supernatant with a pipette tip to remove as much as possible; Add 20 μL of DEPC water to dissolve, aliquot 5 μL per tube, and store at -80 °C in the refrigerator.

[0267] (2) RT-PCR identification

[0268] The target gene was amplified by RT-PCR method. The specific operation was carried out with reference to the instruction manual of PrimeScript TM One Step RT-PCR Kit Ver.2. The RT-PCR reaction system is as follows:

[0269]

[0270] Mix and centrifuge the above reaction system, and execute the following reaction program on a PCR Express Gradient PCR instrument: 50 °C for 30 min, pre-denature at 94 °C for 2 min, one cycle; 94 °C for 30 s, anneal at 56 / 62 / 53 / 57 °C for 40 s, extend at 72 °C for 1 min, 30 cycles. Take 5 μL of the amplified product for detection by agarose gel electrophoresis.

[0271] Reference Figure 15 , Figure 15 shows the electrophoresis results of the RT-PCR products of pcDNA6-Tα1 and pcDNA6-IFNγ transfected cells. Among them, M: DNA Marker DL2,000, 1, 2: RT-PCR products of pcDNA6-Tα1 and pcDNA6-IFNγ transfected cells;

[0272] 2.1.12 SDS-PAGE Detection of the Expressed Product

[0273] The concentrated supernatant of the obtained cells was subjected to SDS-PAGE detection to determine the expression of the pcDNA6-IFNγ recombinant plasmid in COS-7 cells.

[0274] SDS-polyacrylamide gel (PAGE) electrophoresis of proteins was carried out according to the method in "Protein Electrophoresis Experimental Techniques".

[0275] Prepare 4.5 mL of 16.5% separating gel according to the following ratio:

[0276]

[0277] After mixing, carefully inject the separating gel into the gap between the prepared glass plates immediately, leaving enough space for the stacking gel, and add deionized water on its top layer to prevent the inhibition of gel polymerization by oxygen in the air.

[0278] After polymerization is completed, pour off the covering liquid, wash the upper part of the gel with deionized water several times, and dry the residual liquid at the top of the gel with filter paper as much as possible.

[0279] Prepare 2 mL of 4% stacking gel:

[0280]

[0281]

[0282] After the stacking gel polymerization is completed, rinse the comb holes with deionized water to remove unpolymerized acrylamide. Put the prepared gel into the electrophoresis tank, add 1× electrophoresis buffer. Take 20 μL of the concentrated supernatant in 1.2.11, add 5 μL of 5× loading buffer, boil in a water bath for 10 min, then centrifuge at 10,000 rpm for 2 min. Take 15 μL of the supernatant for electrophoresis. The initial voltage is 30 V. After the dye enters the separating gel, increase the voltage to 80 V and continue electrophoresis until the dye reaches the bottom of the separating gel. Disconnect the power supply, remove the gel, soak it in at least 5 times the volume of Coomassie Brilliant Blue staining solution, and slowly rotate it at room temperature on a shaker for 3 - 4 h; replace and recover the staining solution, and decolorize it with methanol / acetic acid solution until the background is colorless. Store the decolorized gel with a gel imaging system.

[0283] 2.1.13 Western Blot Detection of the Expressed Product

[0284] Carry out according to the method in "Protein Technology Manual".

[0285] The expression product was subjected to SDS-PAGE electrophoresis. Cut a nitrocellulose (NC) membrane the same size as the SDS-PAGE gel and two filter papers, immerse them together with the gel after electrophoresis in the transfer buffer, soak at room temperature for 15 min, and install the transfer clip in the order of sponge pad - filter paper - gel - NC membrane - filter paper - sponge pad; connect the side with the NC membrane in the transfer clip to the positive electrode and transfer at a voltage of 15 V for 1.5 h. After the transfer is completed, take out the membrane, block it with 5% skim milk / TBS solution for 90 min; discard the blocking solution, wash the membrane three times with TBS solution, 10 min each time; discard the TBS, add 8 mL of the primary antibody diluted 1:200 in 1% skim milk / TBS, gently shake for at least 1 h; discard the primary antibody, wash the membrane twice with TBS, 10 min each time; discard the TBS, add 8 mL of the secondary antibody diluted 1:500 in 1% skim milk / TBS, gently shake for at least 1 h; discard the secondary antibody, wash the membrane for 30 min, wash three times in total. Discard the TBS, add NBT / BCIP substrate chromogenic solution for color development, gently shake the nitrocellulose membrane, and when the color development reaches a certain degree, wash the membrane with double-distilled water to terminate the color development reaction.

[0286] Reference Figure 16A , Figure 16A Figure 7 shows the SDS-PAGE detection results of the supernatant of pcDNA6-IFNγ positive cells. In the figure, protein bands appear at 21 KD in the pcDNA6-IFNγ positive supernatant.

[0287] 2.2 Synthesis and Identification of Recombinant Plasmid pcDNA6-Tα1

[0288] 2.2.1 Synthesis of Primers for Recombinant Plasmid

[0289] Using Primer5.0 software, add the nucleotide sequence corresponding to the start codon in front of the Tα1 gene and the nucleotide sequence corresponding to the stop codon behind the Tα1 gene, and design primers Ta1 / Ta2 for the ligation of Tα1 and the pcDNA6 / His TM vector. The primer sequences are as follows:

[0290] Primer Ta1: TAT GAATTC TGATGAGCGACGCCGCCGTGGAC (SEQ ID No.3)

[0291] Primer Ta2: TAT CTCGAG CGTTCTCGGCCTCCTCCACCACCAC (SEQ ID No.4)

[0292] The primers were synthesized by Beijing AuGCT Biotechnology Co., Ltd. The synthesized primers were diluted with triple-distilled water into a 25 mM solution and stored at -20 °C.

[0293] 2.2.2 PCR Amplification of the Tα1 Gene with Restriction Enzyme Sites Added

[0294] The primers Ta1 / Ta2 were mainly used to add different restriction enzyme sites to the Tα1 gene, and the template was the PCR product in 2.2..1. The total volume of the PCR reaction system was 100 μL, which consisted of:

[0295]

[0296] After mixing the above reaction systems respectively and centrifuging, the following reaction program was performed on a PCR Express Gradient PCR instrument: pre-denaturation at 94 °C for 3 min, one cycle; denaturation at 94 °C for 40 s, annealing at 56 / 62 / 53 / 57 °C for 40 s, extension at 72 °C for 1 min, 30 cycles; final extension at 72 °C for 20 min. The PCR products were detected by 3% and 1% agarose gel electrophoresis respectively.

[0297] Reference Figure 10 , Figure 10 showed the detection results of the PCR products with restriction enzyme sites added to the Tα1 gene fragment. The meanings of the labels in the figure were: M: DNA marker 2000; 1, 2: PCR products amplified with Ta1 / Ta2 as primers, with a size of 105 bp; 3, 4: PCR products amplified with Ts1 / Ts2 as primers, with a size of 106 bp.

[0298] From Figure 10 it could be seen that the two fragments were successfully cloned, with sizes of 105 bp and 106 bp respectively.

[0299] 2.2.3 Recovery and Purification of PCR Products

[0300] It was carried out according to the instructions of the gel purification kit from Omega company.

[0301] 2.2.4 Restriction Enzyme Reaction of PCR Purified Products

[0302] The restriction enzyme digestion reaction system of the PCR product amplified with primers Ta1 / Ta2 was as follows:

[0303]

[0304] After centrifuging and mixing the above reaction system, it was digested with restriction enzyme at 37 °C for 4 h.

[0305] 2.2.5 Recovery of Restriction Enzyme Products

[0306] A 1% agarose gel for recovery was prepared. After electrophoresis of the restriction enzyme products, the agarose gel containing the target DNA fragment was cut as small as possible, and the recovery was carried out according to the instructions of the gel purification kit from Omega company.

[0307] 2.2.6 Ligation of Restriction Enzyme Digestion Products and Vector

[0308] The ligation reaction system is (15 μL in total):

[0309] 6 μL of PCR restriction enzyme digestion and recovery product

[0310] 1.5 μL of plasmid restriction enzyme digestion and recovery product

[0311] 7.5 μL of Ligation Mix

[0312] For the plasmid restriction enzyme digestion and recovery product, refer to Section 2.1.4.1;

[0313] After mixing and centrifuging, ligate overnight at 4°C. The ligation product is directly used for transformation.

[0314] 2.2.7 Transformation of Ligation Product into DH5α Competent Cells

[0315] Transform the ligation product of Tα1 and the vector into E. coli DH5α competent cells.

[0316] 2.2.8 Screening and Identification of Positive Colonies

[0317] Pick single colonies from the above overnight culture plates, inoculate them into 3 mL of LB liquid medium containing Amp (100 mg / L), shake and culture overnight at 37°C, and directly use the bacterial liquid as a template for PCR reaction for identification, while setting up a negative control. For pcDNA6-Tα1, the primers are Ta1 and Ta2. The reaction system is as follows:

[0318]

[0319]

[0320] The PCR reaction program is the same as in 2.1.2. The PCR products are detected by 1% agarose gel electrophoresis.

[0321] 2.2.9 Restriction Enzyme Identification of Recombinant Plasmids

[0322] Select the transformants with positive PCR results, shake and culture overnight at 37°C and 220 rpm, extract the plasmids using the E.Z.N.A. Plasmid Minipreps Kit to obtain the recombinant plasmid pcDNA6-Tα1.

[0323] Perform restriction enzyme identification on the above recombinant plasmids. The restriction enzyme reaction systems are as follows:

[0324]

[0325] After centrifugal mixing, digest with enzymes at 37°C for 2 h. The enzyme digestion products were detected by 3% and 1% agarose gel electrophoresis respectively.

[0326] The detection results are referred to Figure 11 , Figure 11 is the PCR identification result of the recombinant plasmid pcDNA6-Tα1. The meanings of each label in the figure are as follows: M: DNA Marker DL2000; 0: negative control; 1, 2, 3, 4, 6, 7, 8, 9: positive clones, the size of the PCR product is 105 bp; 5: transformant without inserted Tα1 gene.

[0327] 2.2.10 Sequencing of the reading frame of positive clones

[0328] The bacterial liquid identified as positive by the above PCR and identified as positive by double enzyme digestion of the plasmid was sent to Shanghai Boshang Biotechnology Co., Ltd. for sequencing.

[0329] 2.2.11 Large-scale extraction of recombinant eukaryotic plasmid

[0330] Refer to the method in 2.1.9.

[0331] 2.2.12 Transfection of recombinant plasmid pcDNA6-Tα1 into COS-7 cells

[0332] Refer to the method in 2.1.10.2.

[0333] 2.2.13 RT-PCR detection of recombinant plasmid transfected into COS-7 cells

[0334] RT-PCR detection mainly includes two parts: extraction of total cellular RNA and RT-PCR identification.

[0335] The method for extracting total cellular RNA was referred to 2.1.11.

[0336] The target gene was amplified by RT-PCR method. The specific operation was referred to the instruction of PrimeScript TM One Step RT-PCRKit Ver.2. The RT-PCR reaction system was as follows:

[0337]

[0338] Mix and centrifuge the above reaction system, and perform the following reaction program on a PCR Express Gradient PCR instrument: 50°C for 30 min, pre-denaturation at 94°C for 2 min, one cycle; 94°C for 30 s, annealing at 56 / 62 / 53 / 57°C for 40 s, extension at 72°C for 1 min, 30 cycles. Take 5 μL of the amplification product and detect it by agarose gel electrophoresis.

[0339] Reference Figure 15 , Figure 15 is the electrophoresis result of RT-PCR products of pcDNA6-Tα1 and pcDNA6-IFNγ transfected cells. Among them, M: DNA Marker DL2,000, 1, 2: RT-PCR products of pcDNA6-Tα1 and pcDNA6-IFNγ transfected cells;

[0340] 2.2.14 SDS-PAGE detection and Western Blot detection of expression products

[0341] Refer to the methods in 2.1.12 and 2.1.13 to detect the expression products.

[0342] Reference Figure 12 , Figure 12 is that a protein band appears at 8KD in the SDS-PAGE detection of pcDNA6-Tα1 positive supernatant.

[0343] 2.3 Synthesis and identification of recombinant plasmid IFNγ-pIRES-Tα1

[0344] The construction strategy of recombinant plasmid IFNγ-pIRES-Tα1 can be seen Figure 25 ;

[0345] 2.3.1 Synthesis of primers for recombinant plasmid

[0346] Using Primer5.0 software, according to the restriction enzyme sites on the pIRES vector, add the nucleotide sequence corresponding to the start codon in front of the Tα1 gene and the nucleotide sequence corresponding to the stop codon behind the Tα1 gene. Design Ts1 / Ts2 for the ligation of Tα1 and the pIRES vector; design primers IF3 / IF4 for the ligation of the IFNγ gene and the pIRES vector. The primer sequences are as follows:

[0347] Ts1: CCA TCTAGA GTATGAGCGACGCCGCCGTGGAC (SEQ ID No.5)

[0348] Ts2: CCG GTCGAC ACGTTCTCGGCCTCCTCCACCACCAC (SEQ ID No.6)

[0349] IF3: CCA GCTAGC ATGACTTGCCAG (SEQ ID No.9)

[0350] IF4: CCG GAATTC TTAGCAATTGCA (SEQ ID No.10)

[0351] The primers were synthesized by Beijing AuGCT Biotechnology Co., Ltd. The synthesized primers were diluted with triple-distilled water to a 25 mM solution and stored at -20°C.

[0352] 2.3.2 PCR amplification of adding restriction enzyme sites Tα1 and IFNγ gene

[0353] Restriction enzyme sites were added to the Tα1 gene through primers Ts1 / Ts2 and to the IFNγ gene through primers IF3 / IF4. The previously obtained pMD19-T-IFNγ recombinant plasmid was diluted 100-fold and used as the template for the PCR reaction. The total volume of the PCR reaction system was 100 μL, which consisted of:

[0354]

[0355] After mixing the above reaction systems respectively and centrifuging, the following reaction program was performed on a PCR Express Gradient PCR instrument: pre-denaturation at 94°C for 3 min, one cycle; 94°C for 40 s, 56 / 62 / 53 / 57°C for 40 s, 72°C for 1 min, 30 cycles; post-extension at 72°C for 20 min. The PCR products were detected by 3% and 1% agarose gel electrophoresis respectively.

[0356] 2.3.3 Recovery and purification of PCR products

[0357] It was carried out according to the instruction manual of the gel purification kit from Omega Company.

[0358] 2.3.4 Restriction enzyme digestion reactions of PCR purified products and pIRES empty plasmid

[0359] The PCR product of chicken IFNγ amplified by IF3 / IF4 was used to be inserted between the two restriction enzyme sites Nhe I and EcoR I in the multiple cloning site A region (MCSA region) of the pIRES vector. Therefore, the restriction enzyme digestion reaction system was as follows:

[0360]

[0361] After centrifuging and mixing, digest at 37°C for 4 h.

[0362] The PCR product of Tα1 amplified by primers Ts1 / Ts2 was used to be inserted between the two restriction enzyme sites Sal I and Xba I in the multiple cloning site B region (MCS B region) of the pIRES vector. Therefore, the restriction enzyme digestion reaction system was as follows:

[0363]

[0364] After centrifuging and mixing, digest at 37°C for 4 h.

[0365] The pIRES empty plasmid was first double digested at the MCS A region, and the reaction system was as follows:

[0366]

[0367]

[0368] After centrifugation and mixing, digestion was carried out at 37 °C for 4.5 h.

[0369] After double digestion of the pIRES empty plasmid at the MCS A region, the recovery of the digested products of the pIRES empty plasmid and the IFNγ gene was carried out according to the operation steps in 2.2.5. The ligation reaction system for the digested product of the IFNγ gene and the digested product of the pIRES empty plasmid double digested at the MCS A region was (a total of 15 μL):

[0370] PCR digested and recovered product of IFNγ gene 6 μL

[0371] Digested and recovered product of pIRES empty plasmid 1.5 μL

[0372] Ligation Mix 7.5 μL

[0373] After mixing and centrifugation, ligation was carried out overnight at 4 °C.

[0374] After ligating the pIRES empty plasmid double digested at the MCS A region with the IFNγ gene, after constructing the recombinant plasmid IFNγ-pIRES, a double digestion reaction was carried out on the MCS B region of the recombinant plasmid IFNγ-pIRES to obtain a plasmid digested and recovered product, and the system was as follows:

[0375]

[0376] After centrifugation and mixing, digestion was carried out at 37 °C for 4.5 h.

[0377] The recovery of the double digested and recovered product of the MCS B region of the recombinant plasmid IFNγ-pIRES was carried out according to the operation steps in 2.2.5. The double digested product of the recovered MCS B region of the recombinant plasmid IFNγ-pIRES and the double digested product of Tα1 were ligated. The ligation reaction system was (a total of 15 μL):

[0378] PCR digested and recovered product of Tα1 6 μL

[0379] Digested and recovered product of recombinant plasmid IFNγ-pIRES 1.5 μL

[0380] Ligation Mix 7.5 μL

[0381] After mixing and centrifugation, ligation was carried out overnight at 4 °C. The ligation product was directly used for transformation.

[0382] 2.3.5 Transformation of the Ligation Product into DH5α Competent Cells

[0383] Take the ligation product IFNγ-pIRES-Tα1 in 2.3.4 and transform it into E.coil DH5α competent cells.

[0384] 2.3.6 Screening and Identification of Positive Colonies

[0385] Pick single colonies from the above overnight culture plates, inoculate them into 3 mL of LB liquid medium containing Amp (100 mg / L), culture them overnight with shaking at 37°C, and directly use the bacterial solution as a template for PCR reaction for identification, while setting up a negative control. For IFNγ-pIRES, the primers are IF3 and IF4; for IFNγ-pIRES-Tα1, the primers are Ts1 and Ts2. The reaction system is as follows:

[0386]

[0387] The PCR reaction program is the same as in 2.1.2. The PCR products are detected by 1% agarose gel electrophoresis.

[0388] 2.3.7 Enzymatic Digestion Identification of Recombinant Plasmids

[0389] Select the transformants with positive PCR results, culture them overnight with shaking at 37°C and 220 r / m, and extract the plasmids using the E.Z.N.A.Plasmid Minipreps Kit. Perform enzymatic digestion identification on the above recombinant plasmids. The enzymatic digestion reaction systems are as follows:

[0390] Enzymatic digestion reaction system for recombinant plasmid IFNγ-pIRES:

[0391]

[0392]

[0393] After centrifugation and mixing, digest at 37°C for 2 h.

[0394] Enzymatic digestion reaction system for recombinant plasmid IFNγ-pIRES-Tα1:

[0395]

[0396] After centrifugation and mixing, digest at 37°C for 2 h.

[0397] The above enzymatic digestion products are detected by 3% and 1% agarose gel electrophoresis respectively.

[0398] Figure 19Double digestion identification map of recombinant plasmid IFNγ-pIRES-Tα1; the meanings of each label in the figure are as follows: M1: DNA Marker DL15,000; M2: DNA Marker DL2,000; 1, 4: digestion products of recombinant plasmids pcDNA6-IFNγ and pcDNA6-Tα1; 2, 3: PCR products of IFNγ and Tα1 genes;

[0399] The pIRES vector is a eukaryotic expression vector that can be used to express two gene fragments simultaneously. As Figure 20 shown, an internal ribosome entry site (IRES) was inserted between the two multiple cloning sites (MCS) regions A and B of it, which can translate two open reading frames through the same messenger RNA. According to the characteristics of the pIRES vector, using IF3 / IF4 as primers and pGEM-T-IFNγ as a template, a fragment with a size of 513 bp was obtained by PCR amplification; after double digestion of this fragment, it was ligated with the digested pIRES empty plasmid with the same enzymes, and the recombinant plasmid IFNγ-pIRES was obtained. After the ligation product was transformed into DH5α competent cells, single colonies were picked for culture, and PCR identification was performed using the bacterial liquid as a template, and a fragment with the expected size was amplified. The plasmid was extracted from the bacterial liquid with positive PCR identification, and the plasmid was subjected to double digestion identification, indicating that the recombinant plasmid IFNγ-pIRES was successfully constructed. The plasmid with correct double digestion identification was subjected to sequence determination, and those with correct results were digested with Sal I and Xba I, and the recovered product was ligated with the recovered product of the Tα1 gene digested with Sal I and Xba I. The ligation product was transformed into DH5α competent cells. After the single colony was cultured with overnight shaking, PCR identification was performed using the bacterial liquid as a template and Ts1 / Ts2 as primers, and a fragment with a size of about 106 bp was amplified ( Figure 21 ), initially identified as a positive clone, and the recombinant plasmid IFNγ-pIRES-Tα1 was obtained ( Figure 22 ). Double digestion identification was performed on the plasmid extracted from the positive clone bacteria, and the expected results were obtained ( Figure 23 ). It shows that the recombinant plasmid was successfully constructed. The obtained positive clone bacteria were named DH-pIRES-IFNγ and DH-IFNγ-pcDNA6-Tα1.

[0400] Figure 20 Schematic diagram of the structure of the pIRES plasmid;

[0401] Figure 21PCR identification results of recombinant plasmid IFNγ-pIRES; The meanings of each label in the figure are as follows: M: DNA Marker DL2,000; 0: negative control; 1, 2, 3, 4, 6, 7, 9: positive clones of IFNγ-pIRES, the size of the PCR product is about 500 bp; 5, 8: transformants without inserted IFNγ gene;

[0402] Figure 22 PCR identification results of recombinant plasmid IFNγ-pIRES-Tα1; The meanings of each label in the figure are as follows: M: Marker pUC18 / MspI; 0: negative control; 1, 2, 6, 7, 8, 9: positive clones, the size of the PCR product is 106 bp; 3, 4, 5: transformants without inserted Tα1 gene;

[0403] Figure 23 Double digestion identification map of recombinant plasmid IFNγ-pIRES-Tα1; The meanings of each label in the figure are as follows: M1: DNA Marker DL2,000; M2: DNA Marker DL15,000; 1, 4: PCR products of IFNγ and Tα1 genes; 2, 3: digestion products of recombinant plasmids IFNγ-pIRES and IFNγ-pIRES-Tα1;

[0404] 2.3.11 Sequencing of the reading frame of positive clones

[0405] The bacterial liquid that was identified as positive by the above PCR and positive by plasmid double digestion was sent to Shanghai Boshang Biotechnology Co., Ltd. for sequencing.

[0406] 2.3.12 Large-scale extraction of recombinant eukaryotic plasmids

[0407] Refer to the method in 2.1.9.

[0408] 2.2.13 Transfection of COS-7 cells with IFNγ-pIRES-Tα1 recombinant plasmid and pIRES empty plasmid

[0409] Refer to the method in 2.1.10.2.

[0410] 2.2.14 RT-PCR detection of recombinant plasmid transfected into COS-7 cells

[0411] RT-PCR detection mainly includes two parts: extraction of total cellular RNA and RT-PCR identification.

[0412] The method for extracting total cellular RNA refers to 2.1.11.

[0413] The target gene was amplified by RT-PCR method, and the specific operation refers to PrimeScript TMCarry out according to the instructions of One Step RT-PCRKit Ver.2. The RT-PCR reaction system is as follows:

[0414]

[0415] Mix the above reaction system well and centrifuge it. Execute the following reaction program on a PCR Express Gradient PCR instrument: 50°C for 30 min, pre-denaturation at 94°C for 2 min, one cycle; 94°C for 30 s, annealing at 56 / 62 / 53 / 57°C for 40 s, extension at 72°C for 1 min, 30 cycles. Take 5 μL of the amplified product and detect it by agarose gel electrophoresis.

[0416] The results can be referred to Figure 24 , Figure 24 which is the figure of cell RT-PCR products; the meanings of each label in the figure are as follows: M: DNA Marker DL2,000, 1, 2: RT-PCR products of pcDNA6-Tα1 and pcDNA6-IFNγ transfected cells; 3, 4: RT-PCR products of IFNγ-pIRES-Tα1 transfected cells;

[0417] 2.2.15 SDS-PAGE detection and Western Blot detection of the expression product

[0418] Perform SDS-PAGE detection on the concentrated supernatant of the obtained cells to judge the expression of the IFNγ-pIRES-Tα1 recombinant plasmid in COS-7 cells. The specific operation method is referred to 2.1.12.

[0419] Carry out Western Blot detection on the expression product according to the method in the Protein Technology Manual. The specific operation method is shown in 2.1.13.

[0420] Refer to Figure 16B , Figure 16B which is the SDS-PAGE detection result of the supernatant of IFNγ-pIRES-Tα1 positive cells. Protein bands appear simultaneously at 17 KD and 4 KD in the positive supernatant of cells transfected with the IFNγ-pIRES-Tα1 plasmid.

[0421] The third part

[0422] Study on the immune enhancement effect of chicken IFNγ and Tα1 recombinant plasmids on H5 subtype avian influenza vaccine

[0423] The nucleic acid content of four endotoxin-free plasmids, pcDNA6-Tα1, pcDNA6-IFNγ, IFNγ-pIRES-Tα1 and pcDNA6 / His, was measured by spectrophotometer, and the concentration of the immunogen in the four plasmids was calculated. The four immunogens were diluted to the required concentration as needed.

[0424] 3.1 Immunoassay

[0425] 3.1.1 Experimental groups and treatments

[0426] 260 one-day-old white Leghorn SPF chickens were randomly divided into 13 groups, 20 in each group, and kept in an isolator in the special animal room of Guangdong Wenshi Dahuanong Branch. The drinking water and feed were sterilized by high pressure sterilization, and multivitamins were added to the drinking water after sterilization with a 0.22μm filter membrane. The group treatments are shown in Table 1. After being raised to 14 days of age, they were inoculated. The first group was a blank group without immunization; the second group was injected with 0.2 ml / bird of inactivated oil vaccine (RE-5) of avian influenza H5N1 subtype subcutaneously in the neck; the remaining 11 groups were several immune enhancement groups, and at the same time as RE-5 was injected subcutaneously in the neck of the chickens, the recombinant DNA vaccine was injected into the wing head muscle of the chickens: the third group was an empty plasmid control group, and the chickens were injected with 200 ug / bird of pcDNA6 endotoxin-free empty plasmid; the fourth, fifth, and sixth groups were high-dose groups (200 μg / bird), medium-dose groups (100 μg / bird), and low-dose groups (50 μg / bird) inoculated with recombinant plasmid pcDNA6-IFNγ, respectively; the seventh group was an empty plasmid control group, and the chickens were injected with 200 μg / bird of pcDNA6-IFNγ, medium-dose groups (100 μg / bird), and low-dose groups (50 μg / bird) respectively. Groups 1, 8, and 9 were high-dose (200 μg / bird), medium-dose (100 μg / bird), and low-dose (50 μg / bird) inoculated with recombinant plasmid pcDNA6-Tα1; Groups 10, 11, and 12 were high-dose (200 μg / bird), medium-dose (100 μg / bird), and low-dose (50 μg / bird) inoculated with recombinant plasmid IFNγ-pIRES-Tα1; Group 13 was a mixed immunization group of recombinant plasmids pcDNA6-IFNγ and pcDNA6-Tα1, with a dose of 100 μg / bird for each of pcDNA6-IFNγ and pcDNA-Tα1. 0.25% procaine was injected into the wing head muscle one day before the vaccine was injected, and the specific injection site was marked (i.e., when the chickens were 13 days old), and the DNA vaccine was injected into the same site the next day.

[0427] Table 1 Grouping and treatment of animals in immunization experiments

[0428]

[0429]

[0430] 3.1.2 Detection of HI antibodies in immune serum

[0431] It is carried out with reference to the "Quality Standards for Veterinary Biological Products of the People's Republic of China". On the day, 7, 14, 21, and 28 days after chicken immunization, 10 chickens are randomly selected from each group, and 0.5 mL of blood is drawn from the subvenous vein under the wing. Serum is separated and the HI antibody is detected.

[0432] 3.2.1 Hemagglutination test (HA)

[0433] (1) Preparation of 1% chicken red blood cell suspension: After sucking 1 mL of sodium citrate with a 10 mL test tube, 5 mL of blood is drawn from the hearts of 3 healthy chickens and placed in a centrifuge tube. Centrifuge at 3000 rpm for 10 min, pour off the supernatant, add 1×PBS solution and wash 3 times, each time centrifuge at 2,000 rpm for 5 min to thoroughly wash away plasma, white blood cells, etc. The deposited red blood cells are diluted with 1×PBS solution into a 1% suspension for standby.

[0434] (2) Add 25 μL of 1×PBS solution to wells 1 - 12 of a micro - hemagglutination plate. Use a micropipette to suck 25 μL of antigen and add it to the first well, and mix evenly.

[0435] (3) Suck 25 μL of antigen solution from the first well and add it to the second well. After mixing, suck 25 μL and add it to the third well, and so on for serial dilution to the 11th well. Suck 25 μL from the 11th well and discard it. Add 25 μL of 1×PBS solution to the 12th well as a control.

[0436] (4) Add 25 μL of 1% chicken red blood cell suspension to each well, mix evenly, and observe the results after standing at room temperature for 30 min.

[0437] (5) Result judgment: When red blood cells agglutinate into a thin film and evenly cover the bottom of the well, when strongly agglutinated, the agglutination clumps shrink into a mass or have a serrated edge, that is, 100% of the red blood cells are agglutinated; when red blood cells agglutinate into a thin layer but with a smaller area, and there is a small round dot of red blood cell deposition in the center of the well bottom, that is, 50% of the red blood cells are agglutinated; when all red blood cells sink to the center of the well bottom in a small round dot shape with a smooth periphery and no dispersed red blood cells, that is, there is no agglutination phenomenon. The highest dilution of the virus that can completely agglutinate red blood cells is used as the hemagglutination titer of the virus.

[0438] (6) Dilute the antigen according to the 4 - unit hemagglutination titer and conduct a calibration test: Add 25 μL of 1×PBS solution to the first four wells. Add 25 μL of the diluted antigen to the first well and dilute it to the third well. Then add 25 μL of red blood cells to the first well and to the fourth well. After 30 min at 37 °C, if the first two wells show 100% red blood cell agglutination, the third well shows 50% red blood cell agglutination, and the fourth well shows 100% non - agglutination, the antigen dilution is accurate; otherwise, re - dilute.

[0439] 3.1.2.2 Hemagglutination inhibition test (HI):

[0440] (1) Add 25 μL of 1×PBS solution to all wells of a micro - hemagglutination plate. Add 25 μL of the serum to be tested to the first well. After thorough mixing, aspirate 25 μL from the first well and transfer it to the second well, and so on until the tenth well. Discard 25 μL from the tenth well.

[0441] (2) Use the eleventh well as the antigen control and the twelfth well as the normal saline blank control.

[0442] (3) Add 25 μL of diluted antigen to each well except the twelfth well. Incubate at room temperature for 25 min, then add 25 μL of 1% chicken red blood cell suspension. Incubate at 37 °C for 30 min and observe the results.

[0443] (4) Result determination: Take the maximum dilution of the serum that completely inhibits red blood cell agglutination as the hemagglutination inhibition titer of the serum. The determination criteria are as follows: If the HI titer is less than or equal to 3log2, the HI test is negative; if the HI titer is equal to 4log2, it is suspicious and needs to be repeated; if the HI is greater than or equal to 5log2, it is positive.

[0444] 3.1.3 Measurement of lymphocyte transformation effect by MTT method

[0445] On the 7th, 14th, 21st, and 28th days after chicken immunization, randomly select 5 chickens from each group, collect 2 mL of blood aseptically, anticoagulate with sodium heparin, isolate lymphocytes, and use the MTT method (Yang Falong et al., 2002; Li Qingzhang et al., 1994) to detect the proliferation effect of peripheral blood T - lymphocyte transformation. The specific operation is as follows:

[0446] 3.1.3.1 Isolation of peripheral blood lymphocytes

[0447] Randomly select 3 chickens from each group, collect 2 mL of anticoagulated blood aseptically, dilute it with an equal volume of 1×PBS solution, and carefully layer it on an equal volume of lymphocyte separation medium. After centrifugation at 2,500 rpm for 20 min, transfer the middle white cell layer, wash it 3 times with serum - free RPMI1940, resuspend it in a small amount of culture medium, perform cell counting to make the cell content approximately 1×10 6 / mL, and use the trypan blue exclusion method to detect cell viability > 95%.

[0448] 3.1.3.2 Determination of peripheral blood lymphocyte proliferation reaction

[0449] Add the prepared lymphocytes to a 96 - well cell culture plate, 50 μL per well (the number of cells is 1×10 7 / mL). Add 50 μL of RPMI1640 medium with a final mass concentration of 15 μg / mL of ConA solution and a final concentration of 10% calf serum to each well. Set 3 replicates for each group, and at the same time set a blank control well (cells and medium, without adding ConA solution). Incubate at 37 °C, 5% CO 2Cultivate for 60 h under saturated humidity. Add 10 μL of MTT (5 mg / mL) to each well 3 hours before terminating the cultivation, and continue to cultivate for 3 h. Then add 100 μL of 10% SDS - 0.01 mol HCl, place it in the incubator for reaction for 2 h, and detect the OD value of each well at a wavelength of 570 nm with an enzyme - linked immunosorbent assay (ELISA) reader. Calculate the lymphocyte transformation rate according to the following formula:

[0450]

[0451] 3.1.4 Detection of dynamic changes in the number of peripheral blood T lymphocytes

[0452] Refer to the method of Collissona et al. (2000) to determine the changes in T - lymphocyte subsets in the peripheral blood of chickens using a flow cytometer (FACS).

[0453] 3.1.4.1 Preparation of lymphocyte samples

[0454] Randomly select 5 chickens from each group of experimental chickens to track the changes in their T - lymphocyte subsets. Collect 1 mL of heparin - anticoagulated blood from the wing vein of each chicken once a week after immunization. After serially diluting it with serum - free 1×PBS solution, slowly add it to 4 mL of lymphocyte separation medium containing meglumine diatrizoate (to make the floating density 1.070 - 1.080), and centrifuge at 2,500 rpm at room temperature for 20 min. Carefully aspirate the lymphocyte layer in the middle part and inject it into a centrifuge tube containing 8 mL of PBS solution with 3% - 5% bovine serum, and centrifuge at 1,500 rpm at room temperature for 7 - 8 min (if there are too many red blood cells in the precipitate, gently suspend the precipitate with PBS solution containing serum and re - separate the lymphocytes). Discard the supernatant, wash the cells with PBS solution containing 5% fetal bovine serum, centrifuge at 1,500 rpm at room temperature for 5 min, discard the supernatant, repeat the washing three times, and finally add an appropriate amount of PBS to make the lymphocyte content about 1×10 6 / mL to 5×10 6 / mL. Appropriately aliquot it into 4 1.5 - mL centrifuge tubes, label them as A, B, C, and D in sequence, and dry them by aspiration after centrifugation for standby.

[0455] 3.1.4.2 Determination of T - lymphocyte subsets

[0456] Use the appropriately diluted prepared lymphocytes with CD3 + , CD4 + and CD8 +Three kinds of monoclonal antibodies were added into three tubes respectively to resuspend lymphocytes. Tube D was resuspended with PBS solution and used as a control. The reaction was carried out in an ice-water bath for 30 min. After the reaction, centrifuge at 1,500 rpm for 5 min and discard the supernatant. Wash the lymphocytes with 200 μL PBS solution three times repeatedly, and finally resuspend the cell pellet with 1 mL PBS solution without serum, then the detection can be carried out on the FACS (canTM Flow Cytomer BDIS, San Joes, CA) instrument. If the determination is not carried out immediately, 0.7% formaldehyde solution can be added and stored at 4 °C, but the storage time generally does not exceed 24 h. Detect 20,000 cells by flow cytometry and perform statistical processing on the obtained data.

[0457] 3.1.5 Detection of organ immune coefficient

[0458] On the 14th and 28th days after chicken immunization, randomly select 3 chickens from each group, weigh them and then sacrifice them. After dissection, completely take out the spleen, bursa of Fabricius and thymus, dry the surface moisture and blood of the tissue with filter paper and then weigh and record. Calculate the immune index according to the following formula:

[0459] Bursa of Fabricius index = weight of bursa of Fabricius (g) / body weight (kg)

[0460] Thymus index = weight of thymus (g) / body weight (kg)

[0461] Spleen index = weight of spleen (g) / body weight (kg)

[0462] 3.1.6 Virulent challenge protection test

[0463] (1) Determination of LD 50 of H5N1 subtype avian influenza virus: Operate with reference to the "China Import and Export Animal Quarantine Specification"

[0464] Serial 10-fold dilutions of the allantoic fluid of H5N1 virus were made respectively, and diluted with sterile normal saline to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 , 10 -9 , 10 -10 and other 10 dilution degrees. Another control (i.e., inoculating normal saline) was set. The diluted allantoic fluid of H5N1 virus was inoculated into 35-day-old SPF chickens, 0.2 mL for each chicken; 10 chickens were inoculated with each dilution degree of the allantoic fluid of the virus, observe the death of chickens every day, and observe continuously for 7 days and record the results. The AIV challenge dose when half of the chickens died was used as LD 50 . The calculation formula is:

[0465] LD 50 Logarithm of LD = logarithm of virus dilution with mortality rate higher than 50% + distance ratio × logarithm of dilution multiple

[0466] Distance ratio = (percentage of deaths higher than 50% - 50%) / (percentage of deaths higher than 50% - percentage of deaths lower than 50%)

[0467] (2) Determine the challenge dose according to the value of LD 50

[0468] The detection results of the allantoic fluid of H5N1 virus LD 50 are shown in Table 2. The LD 50 of H5N1 virus was calculated to be 10 -7 / 0.2 mL according to the Reed-Muench method.

[0469] (3) 28 days after immunization, chickens in each group were challenged by intramuscular injection at a dose of 200LD 50 . Observe and record the conditions of the chickens after challenge and calculate the challenge protection rate:

[0470] Challenge protection rate = (total number of challenged chickens - number of dead chickens) / total number of challenged chickens

[0471] Table 2 Detection results of H5N1 virus LD 50

[0472]

[0473] All data in this experiment were analyzed by variance using SAS statistical software. When the difference was significant, the Duncan test was used for multiple comparisons between groups of data.

[0474] 3.2 Result statistics

[0475] 3.2.1 Preparation of immunogen

[0476] The plasmid DNA extracted using the TIANGEN endotoxin-free plasmid large extraction kit was measured for its concentration and purity using agarose gel electrophoresis and a spectrophotometer. Take 3 μL of the extracted plasmid and detect it by 1% agarose electrophoresis. According to the calculation formula for double-stranded DNA content in the ultraviolet spectrophotometer instruction manual: OD260nm × 50 × dilution multiple (μg / mL), the concentrations of the 4 immunogens were calculated. The results are shown in Table 3, indicating that the extracted plasmid DNA has a high purity.

[0477] Table 3 Concentrations of immunogens (mg / mL)

[0478]

[0479] ​​3.2.2 Detection of serum HI antibody

[0480] Four weeks after immunization, the average neutralizing antibody levels in the sera of experimental chickens in each group are shown in Table 4: As can be seen from Table 4, during the entire experimental period, the antibody titers in the blank group were all negative. Seven days after immunization, the antibody titers of experimental chickens in each vaccine group were all less than 3log2, which was negative. Fourteen days after immunization, the antibody titers of chickens in each vaccine group increased rapidly. There was no difference between the groups injected with inactivated H5N1 vaccine, empty plasmid group, pcDNA-Tα1, pcDNA-IFNγ booster immunization medium dose group, and IFNγ and Tα1 combined immunization group (P>0.05); there was no difference among the low, medium, and high doses of the pcDNA-Tα1 booster immunization group (P>0.05); among the pcDNA-IFNγ booster immunization groups, the difference between the medium dose and the low and high doses was significant (P<0.05), and there was no difference between the low and high doses; the differences among the doses of the IFNγ-pIRES-Tα1 booster immunization group were all significant (P<0.05). Twenty-one days after immunization, the antibody titers of each vaccine group continued to rise; there was no difference between the group injected with inactivated H5N1 vaccine and the empty plasmid group and the pcDNA-IFNγ low dose group (P>0.05), which was the highest (10.63log2); there were significant differences with other groups (P<0.05). There was no difference among the low, medium, and high doses of the pcDNA-Tα1 and pcDNA-IFNγ booster immunization groups respectively (P>0.05); there was no difference between the low and medium doses of the IFNγ-pIRES-Tα1 booster immunization group, and there were significant differences with the high dose (P<0.05); there was no difference between the IFNγ and Tα1 combined immunization group and the pcDNA-Tα1 and pcDNA-IFNγ medium dose groups and the IFNγ-pIRES-Tα1 low and medium dose groups, and there were significant differences with other groups (P<0.05). Twenty-eight days after immunization, the antibody titers among each immunization group reached the same level, and the differences were not significant (P>0.05).

[0481] Table 4 Average HI antibody titers of experimental chickens after immunization

[0482]

[0483]

[0484]

[0485] Note: Values with different superscript letters in the same column are significantly different (P<0.05), and values with the same superscript letters are not significantly different (P>0.05). The same applies to the following table.

[0486] 3.2.3 Detection of lymphocyte transformation effect

[0487] As can be seen from Table 5, after immunization of each group of chickens, over time, the transformation rate of peripheral blood lymphocytes showed a downward trend. The IFNγ-pIRES-Tα1 low-dose group had the highest lymphocyte transformation rate at all stages after immunization, showing significant differences compared with other groups, and there were also significant differences among its three dose groups (P<0.05). There was a difference between the low-dose group and the medium- and high-dose groups in the pcDNA-Tα1 booster immunization group (P<0.05), and there was no significant difference between the medium- and high-dose groups. There were significant differences among all dose groups in the pcDNA-IFNγ booster immunization (P<0.05). Based on the results four weeks after comprehensive immunization, there were differences between the IFNγ and Tα1 combined immunization group and the pcDNA-Tα1 booster immunization group as well as the pcDNA-IFNγ booster immunization group (P<0.05), and their lymphocyte transformation rates were lower than those of the two single immunization booster groups.

[0488] Table 5 Effects of Chicken IFNγ and Tα1 on the Transformation Rate of Chicken Peripheral Blood Lymphocytes

[0489]

[0490]

[0491] 3.2.4 Dynamic Changes in the Number of Peripheral Blood T Lymphocytes

[0492] 3.2.4.1 Peripheral Blood CD3 + Changes in T Lymphocytes

[0493] As can be seen from Table 6, the content of CD3 + T lymphocytes in chicken peripheral blood showed an upward trend from 7 to 21 days after immunization and then began to decline. Four weeks after immunization, the percentage of CD3 + T lymphocytes in the blank group, oil vaccine group, and empty plasmid group of chickens was significantly lower than that in each immunization booster group (P<0.05). Throughout the experimental stage, the IFNγ-pIRES-Tα1 low-dose group had the highest content of CD3 + T lymphocytes, with significant differences among the other groups (P<0.05); there were also significant differences between it and other dose groups (P<0.05). Among the three dose groups of pcDNA-Tα1, the low-dose group had a higher content of CD3 + T lymphocytes, with significant differences compared with the medium- and high-dose groups (P<0.05), and there was no significant difference between the high- and medium-dose groups. There were no significant differences among the dose groups of pcDNA-IFNγ (P>0.05). Based on the situation four weeks after comprehensive immunization, the content of CD3 + T lymphocytes in the IFNγ and Tα1 combined immunization group was higher than that in the pcDNA-Tα1 booster immunization group and the pcDNA-IFNγ booster immunization group, but the difference was not significant (P>0.05).

[0494] Table 6 Dynamic changes of CD3 + T lymphocyte counts (%) in peripheral blood after chicken immunization

[0495]

[0496] 3.2.4.2 CD4 + T lymphocyte changes in peripheral blood

[0497] As can be seen from Table 7, during the whole experiment, the percentages of CD4 + T lymphocytes in the blank group were basically the same. In other experimental groups, they reached the highest level at 14 - 21 days after immunization and then decreased, but were still higher than those at 7 days at 28 days. The percentages of CD4 + T lymphocytes in the peripheral blood of chickens in each booster immunization group were all higher than those in the blank group, oil vaccine group and empty plasmid group (P < 0.05). Among the sample results at 4 weeks after immunization, the values of the IFNγ - pIRES - Tα1 booster group were the largest, and the percentages of CD4 + T lymphocytes in their peripheral blood reached 33.59%, 30.58% and 27.99% respectively at 21 days after immunization. It can also be seen from this table that within four weeks after immunization, the percentages of CD4 + T lymphocytes in the peripheral blood of chickens in the low - dose IFNγ - pIRES - Tα1 booster group were the highest, and the differences were significant compared with other groups (P < 0.05). There was no difference in the pcDNA - Tα1 booster immunization group from 7 days to 14 days after immunization. From 21 days to 28 days after immunization, the percentages of CD4 + T lymphocytes in its low - and medium - dose groups were significantly higher than those in the high - dose group (P < 0.05). For the pcDNA - IFNγ booster immunization group, there was no significant difference among its three dose groups three weeks after immunization (P > 0.05); until 28 days after immunization, there was a significant difference between the low - dose group and the medium - dose group (P < 0.05), but there was no significant difference between the high - dose group and the low - and medium - dose groups. At 4 weeks after immunization, the percentages of CD4 + T lymphocytes in the peripheral blood of chickens in the IFNγ and Tα1 combined immunization group were higher than those in the pcDNA - Tα1 and pcDNA - IFNγ immunization groups, but the differences were not obvious (P > 0.05).

[0498] Table 7 Dynamic changes of CD4 + T lymphocytes (%) in peripheral blood after chicken immunization

[0499]

[0500]

[0501] 3.2.4.3 CD8 +Changes in T lymphocytes

[0502] As can be seen from Table 8, the percentage of CD8 + T lymphocytes in each experimental group began to increase rapidly 7 days after immunization, reached the highest level 21 days after immunization, and then showed a downward trend with the change of time. At each stage after immunization, the percentage of CD8 + T lymphocytes in the peripheral blood of chickens in the low-dose IFNγ-pIRES-Tα1 group was the highest, and was significantly higher than that of other experimental groups (P<0.05). Four weeks after immunization, the low-dose group in the pcDNA-Tα1 booster immunization group was the highest; from 14 to 28 days after immunization, it was significantly higher than the medium and high-dose groups (P<0.05). There was no difference between the pcDNA-IFNγ dose groups (P>0.05). There was no difference between the mixed immunization group of IFNγ and Tα1 and the immunization groups of pcDNA-Tα1 and pcDNA-IFNγ. The percentage of CD8 + T lymphocytes in the peripheral blood of chickens in each booster immunization group was higher than that of the blank group and the empty plasmid group (P<0.05). However, 14 days after immunization, there was no difference in the proportion of CD8 + T lymphocyte content in the peripheral blood of chickens in the oil vaccine group and the medium and high-dose groups of pcDNA-Tα1 and the low and medium-dose groups of pcDNA-IFNγ.

[0503] Table 3.9 Dynamic changes of CD8 + T lymphocytes (%) in the peripheral blood of chickens after immunization

[0504]

[0505]

[0506] 3.2.5 Detection of organ immune coefficients

[0507] 2.5.1 Effect of DNA vaccine on bursa of Fabricius index of chickens

[0508] As can be seen from Table 9, 14 and 28 days after chicken immunization, compared with the blank group, there were significant differences in each group injected with the vaccine (P<0.05), indicating that injecting the above vaccine had a promoting effect on the bursa of Fabricius of chickens. Compared with the three dose groups injected with pcDNA-Tα1, pcDNA-IFNγ alone and the combined immunization group of IFNγ and Tα1, there were significant differences in the low and medium dose groups injected with IFNγ-pIRES-Tα1 (P<0.05). The high dose group had the same immune enhancement effect as the low dose of pcDNA-Tα1 and the combined immunization group of IFNγ and Tα1, without significant difference (P>0.05). The combined immunization group of IFNγ and Tα1 had the same effect as the low dose group of pcDNA-Tα1 at 14 days after immunization, and there were differences at 28 days after immunization; there were significant differences between it and other groups at 14 and 28 days after immunization (P<0.05). The bursa of Fabricius indexes of the groups injected with the low dose of pcDNA-Tα1, pcDNA-IFNγ and IFNγ-pIRES-Tα1 were higher than those of the other two dose groups of these three plasmids. Among them, at 14 days after immunization with pcDNA-Tα1 and IFNγ-pIRES-Tα1, there were significant differences among the three dose groups (P<0.05); there was no significant difference between the low and medium dose groups injected with pcDNA-IFNγ, but there were significant differences with the high dose group (P<0.05); at 28 days after immunization with pcDNA-Tα1, pcDNA-IFNγ and IFNγ-pIRES-Tα1, there were significant differences among the three dose groups (P<0.05); while there was no significant difference between the high dose groups injected with pcDNA-Tα1 and pcDNA-IFNγ alone and the control group and the empty plasmid group (P>0.05). Compared with 14 days and 28 days after immunization, the bursa of Fabricius indexes of each group decreased, indicating that the bursa of Fabricius of chickens degenerated.

[0509] Table 9 Effects of Chicken IFNγ and Tα1 on the Bursa of Fabricius Index of Chickens Immunized with Avian Influenza Vaccine

[0510]

[0511]

[0512] 3.2.5.2 Effects of DNA Vaccine on the Thymus Index of Chickens

[0513] As can be seen from Table 10, the thymus index of chickens in the vaccinated group is higher than that in the blank group, indicating that the above-mentioned vaccine has a promoting effect on the thymus of chickens. After 14 days and 28 days of immunization, there were significant differences among the three dose groups of IFNγ-pIRES-Tα1 (P<0.05); among them, the low and medium dose groups were significantly different from other groups (P<0.05), the high dose group was not significantly different from the combined immunization group of IFNγ and Tα1 (P>0.05), and was significantly different from other groups (P<0.05). After 14 days of immunization, there were significant differences between the combined immunization group of IFNγ and Tα1 and each dose of pcDNA-Tα1 and pcDNA-IFNγ injected alone (P<0.05); there was no difference after 28 days of immunization compared with pcDNA-Tα1 injected alone. After 14 days and 28 days of chicken immunization, there were significant differences between the low dose group and the medium and high dose groups of pcDNA-Tα1 injected, the effects of the medium and high dose groups were equivalent, and there was no difference among the three dose groups of pcDNA-IFNγ injected (P>0.05).

[0514] Table 10 Effects of Chicken IFNγ and Tα1 on Thymus Index of Influenza A Vaccine-Immunized Chickens

[0515]

[0516]

[0517] 3.2.5.3 Effects of DNA Vaccine on Spleen Index of Chickens

[0518] As can be seen from Table 11, there were significant differences (P<0.05) between the DNA vaccine injection group and the blank group, the control group, and the empty plasmid group, indicating that injecting DNA vaccines at various doses promoted the spleens of chickens. There were significant differences (P<0.05) between the low-dose IFNγ-pIRES-Tα1 injection group and other groups in chickens, and there was no obvious difference (P>0.05) between the medium- and high-dose groups; there were obvious differences (P<0.05) between the medium-dose group and the groups injected with other vaccines, but there was no difference (P>0.05) between the high-dose group and the combined immunization group of IFNγ and Tα1. The combined immunization group of IFNγ and Tα1 had no difference from the low-dose pcDNA-Tα1 group and the low-dose pcDNA-IFNγ group 14 days after immunization, and had significant differences from other groups (P<0.05); 28 days after immunization, there were significant differences from each dose group of pcDNA-Tα1 and pcDNA-IFNγ injected alone (P<0.05). In chickens injected with pcDNA-Tα1 alone, there was no difference between each dose group 14 days after immunization; 28 days after immunization, there was a difference (P<0.05) between the low-dose group and the medium- and high-dose groups, but the effects of the medium- and high-dose groups were comparable (P>0.05). In chickens injected with pcDNA-IFNγ alone, there were significant differences (P<0.05) between the low-dose group and the medium- and high-dose groups 14 days and 28 days after immunization, and there was no difference between the medium- and high-dose groups.

[0519] Table 11 Effects of Chicken IFNγ and Tα1 on the Spleen Index of Chickens Immunized with Avian Influenza Vaccine

[0520]

[0521] 3.2.6 Detection of Antiviral Ability

[0522] On the second day after virus challenge, the chickens showed disease symptoms, with a sharp decline in feed intake and water intake, listlessness, ruffled feathers, dyspnea, and a preference to lie down. On the third day, chickens in the blank group, the H5N1 inactivated vaccine injection group, and the empty plasmid group began to die. Autopsy of the dead chickens revealed: severe congestion of the respiratory tract, especially the larynx and tracheal mucosa; bleeding of gastric gland papillae and hematoma of duodenal mucosa; pancreatic necrosis, and obvious bleeding points in the pericardial fat. On the 6th day after virus challenge, all the chickens in the blank group died, and chickens in other groups began to resume feed intake and water intake, with symptoms alleviating and spirits improving.

[0523] As can be seen from the results in Table 12, one week after virus challenge of the experimental chickens, all the chickens in the blank group died, with a virus challenge protection rate of 0 and no protective effect on the chickens; there were 2 dead chickens in the H5N1 inactivated vaccine injection group, with a virus challenge protection rate of 80%; the virus challenge protection rate of the empty plasmid group was 81.8%; chickens in other immune booster groups did not die, with a virus challenge protection rate of 100%, indicating good protective effects on the experimental chickens.

[0524] Table 12 Immunoprotection effect after virus challenge

[0525]

[0526] Part Four

[0527] Result analysis

[0528] 4.1 Four kinds of immunogens, IFNγ-pIRES-Tα1, pcDNA6-IFNγ, pcDNA6-Tα1 and pcDNA6 empty plasmid with high purity were obtained by using TIANGEN endotoxin-free plasmid large extraction kit, and their concentrations were 13.65 mg / mL, 17.45 mg / mL, 13.75 mg / mL and 15.70 mg / mL respectively.

[0529] 4.2 The detection results of neutralizing antibody levels in experimental chickens after immunization with H5N1 avian influenza vaccine showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ and pcDNA6-Tα1 could not improve the serum neutralizing antibody levels in chickens.

[0530] 4.3 The results of this invention preliminarily showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ and pcDNA6-Tα1 could significantly improve the transformation level of peripheral blood T lymphocytes in chickens. IFNγ-pIRES-Tα1 could more effectively promote the proliferation and differentiation of T lymphocytes than pcDNA6-IFNγ, pcDNA6-Tα1 and the mixed immunization of IFNγ and Tα1, and its effect showed a certain dose-effect relationship with the dosage of the recombinant plasmid IFNγ-pIRES-Tα1.

[0531] 4.4 The analysis results of the content of T lymphocyte subsets in peripheral blood of experimental chickens showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ and pcDNA6-Tα1 could significantly increase the proportions of CD3 + , CD4 + and CD8 + T lymphocytes in peripheral blood of chickens, enhancing the cellular immune function of the body. The effect of IFNγ-pIRES-Tα1 was the best, and its effect also showed a dose-effect relationship with the dosage.

[0532] 4.5 The research results of the immune organ indices of experimental chickens showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ and pcDNA6-Tα1 could significantly increase the immune indices of bursa of Fabricius, thymus and spleen tissues in chickens, promoting the immune function of the body. The effect of IFNγ-pIRES-Tα1 was also the best, and its effect showed a dose-effect relationship with the dosage.

[0533] The research on the protective effect against virus challenge in experimental chickens showed that the recombinant plasmids IFNγ-pIRES-Tα1, pcDNA6-IFNγ, and pcDNA6-Tα1 could significantly improve the protective ability of chickens against avian influenza virus.

[0534] In summary, chicken IFNγ and Tα1 as vaccine adjuvants could significantly improve the immune function of the inactivated H5N1 oil emulsion vaccine, and the co-expression (IFNγ-pIRES-Tα1) had the best effect. Moreover, there was a certain dose-effect relationship between the immune enhancement effect and the dosage of IFNγ-pIRES-Tα1, and the lowest dose (50 μg / chicken) was preferred.

[0535] The applicant declares that the process method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above process steps, which does not mean that the present invention must rely on the above process steps to be implemented. Those skilled in the art should understand that any improvement of the present invention, the equivalent substitution of the raw materials selected for the present invention, the addition of auxiliary components, and the selection of specific methods, etc., all fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A recombinant plasmid, characterized in that: The recombinant plasmid is composed of an expression vector and a target gene connected to the expression vector, wherein the target gene is an IFNγ gene and a Tα1 gene; The nucleotide sequence of the IFNγ gene is shown in SEQ ID No. 1; The nucleotide sequence of the Tα1 gene is shown in SEQ ID No. 2, and the expression vector is a eukaryotic expression vector pIRES.

2. A method for preparing a recombinant plasmid as claimed in claim 1, characterized in that: The method is specifically as follows: Primers Ts1 / Ts2 are used to add restriction sites on the Tα1 gene, and primers IF3 / IF4 are used to add restriction sites on the IFNγ gene; and the Tα1 gene and IFNγ gene with the restriction sites added are inserted into the expression vector; The nucleotide sequence of primer Ts1 is shown in SEQ ID No. 5; The nucleotide sequence of primer Ts2 is shown in SEQ ID No.6; The nucleotide sequence of primer IF3 is shown in SEQ ID No.9; The nucleotide sequence of primer IF4 is shown in SEQ ID No.

10.

3. The preparation method according to claim 2, characterized in that: The expression vector is the eukaryotic expression vector pIRES; the IFNγ gene with added restriction sites is inserted into the multiple cloning site A region of the eukaryotic expression vector pIRES; the Tα1 gene with added restriction sites is inserted into the multiple cloning site B region of the eukaryotic expression vector pIRES.

4. Use of the recombinant plasmid according to claim 1 in the preparation of an immunopotentiator for use in combination with a vaccine; The vaccine is an inactivated vaccine of avian influenza H5N1 subtype.

5. A combination vaccine, characterized in that Includes basic vaccines and immune boosters; The basic vaccine is a vaccine for preventing and treating viral infection, using inactivated or attenuated viruses as antigens; the vaccine is an inactivated vaccine of the avian influenza H5N1 subtype; The immunopotentiator is the recombinant plasmid according to claim 1.

Images