A NADC34-like PRRSV-2 vaccine candidate strain and its application

Abstract

The present invention discloses an rBJ-VVL plasmid and a NADC34-like PRRSV-2 mutant strain, and a preparation method and application thereof. The present invention also discloses a NADC34-like PRRSV-2 specific vaccine. The present invention obtains a modified strain rBJ-VVL tropistic to Marc-145 cells by precisely mutating the 91 / 97 / 98 amino acid sites in GP2a; the modified virus constructed by the present invention is inoculated with Marc-145 cells for passage cultivation, which can cause cytopathic effects and form plaques; the Marc-145 cell-passaged virus obtained by the present invention has an extremely high viral load, and a large number of new progeny viruses can be obtained in a short time; the Marc-145 cell-adapted modified passage strain cultivated by the present invention is used to create the first NADC34-like PRRSV-2 vaccine.

Description

Technical Field

[0001] The present invention belongs to the technical field of veterinary biological products, and specifically relates to a NADC34-like PRRSV-2 vaccine candidate strain and application thereof. Background Art

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) seriously endangers the development of the world's pig industry and causes huge economic losses. PRRSV infection can cause sow abortion and piglet respiratory syndrome. The latest research divides PRRSV-2 into PRRSV-1 and PRRSV-2. The main PRRSV-2 prevalent in my country is highly pathogenic PRRSV-2 (HP-PRRSV-2), NADC30-like PRRSV-2 and NADC34-like PRRSV-2. At present, NADC34-like PRRSV-2 is one of the most widely prevalent strains.

[0003] PRRSV-2 is a single-stranded positive-sense RNA virus belonging to the family Arteriviridae. Its genome size is about 15 kb and contains 10 open reading frames (ORFs). ORF1a and ORF1b encode at least 16 nonstructural proteins, and ORF2-7 encode 8 structural proteins. Among them, the three small envelope proteins (GP2a, GP3 and GP4) encoded by the ORF2-4 gene form heterotrimers on the viral envelope. Previous reports have shown that GP2a-GP3-GP4 determine the cellular tropism of arteriviruses.

[0004] At present, there is no report on the specific vaccine strain of NADC34-like PRRSV-2 strain. In addition, the inability of NADC34-like PRRSV-2 wild strain to adapt to Marc-145 cell culture in vitro is an important obstacle to the development of its specific vaccine.

[0005] In the previous study, we established an infectious clone virus of NADC34-like PRRSV-2rBJ1805-2 strain (invention name: Construction and application of a reverse genetic operation platform for NADC34-like porcine reproductive and respiratory syndrome virus, patent publication number CN115992100A), which was deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan University in Wuhan, China, with the deposit number being CCTCC NO: V202250 and the deposit date being 2022.06.29. In the above-mentioned previous invention, we replaced the ORF2-4 of the rBJ1805-2 infectious clone with ORF2-4CON as a whole, and adapted it to Marc-145 cell culture. However, the key amino acid sites in ORF2-4 that adapt the NADC34-like PRRSV-2 wild strain to Marc-145 cells have not yet been accurately analyzed, and there are no reports on the cultivation of NADC34-like PRRSV-2 specific vaccines. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide an rBJ-VVL plasmid capable of transfecting cells to obtain virus strains and a method for constructing the same.

[0007] In view of the NADC34-like PRRSV-2 strain that has appeared and spread widely in my country in recent years, the technical problem to be solved by the present invention is to provide a NADC34-like PRRSV-2 mutant strain or a passaged strain or a method for obtaining it. The pig immune challenge test of the passaged virus proved that the modified strain has a complete clinical protective effect against the NADC34-like PRRSV-2 wild strain.

[0008] The final technical problem to be solved by the present invention is to provide a NADC34-like PRRSV-2 specific vaccine.

[0009] Technical solution: The present invention provides an rBJ-VVL plasmid. The rBJ-VVL plasmid is prepared by using the plasmid of the pACYC177-rBJ1805-2 reverse genetic platform as a template, designing primer pairs for the mutation of the 91st, 97th and 98th amino acids of the GP2a protein of the rBJ1805-2 virus to V, V and L, amplifying the mutant fragments by PCR amplification method, and then connecting them to a linearized vector.

[0010] The primer pairs include a combination of rBJ-XbaI-F3 and rBJ-VVL-R and a combination of rBJ-VVL-F and rBJ-NOT1-2fu-1, and the front and rear segments of the rBJ-VVL mutant are respectively amplified by PCR. The rBJ-VVL plasmid is obtained by connecting the front and rear segments of the mutant with the linearized vector by homologous recombination. The sequences of the primer pairs are shown in the following table:

[0011]

[0012] The present invention also provides a NADC34-like PRRSV-2 mutant strain, wherein the mutant strain is obtained by mutating the 91st, 97th and 98th amino acids of the GP2a protein of the NADC34-like PRRSV-2 isolate BJ1805-2 from T, M and F to V, V and L respectively.

[0013] Wherein, the mutant strain is obtained by transfecting cells with the mutant plasmid.

[0014] On the one hand, the present invention provides a method for accurately modifying the amino acid mutation of the GP2a-91 / 97 / 98 amino acid of the NADC34-like PRRSV-2 isolate BJ1805-2 by mutating the amino acid from the T / M / F mode to the V / V / L mode, so as to adapt it to the culture of Marc-145 cells. Specifically, based on the NADC34-like PRRSV-2 reverse genetic platform, through the construction and screening of a large number of chimeric viruses, it is clarified that the amino acid mutation of the 91 / 97 / 98 position in the NADC34-like PRRSV-2GP2a is mutated to the V / V / L mode, which can adapt it to the subculture of Marc-145 cells. The Marc-145 cell adaptation strain rBJ-VVL is obtained. In addition, the modified viruses rBJ-TVL, rBJ-VML and rBJ-VVF, which respectively reverse the mutations at the three points of the V / V / L mode, are unable to adapt to Marc-145 culture. It was demonstrated that this three-point mutation pattern was the most accurate mutation pattern that could enable NADC34-like PRRSV-2 to acquire Marc-145 cell tropism.

[0015] The present invention also provides a method for constructing an rBJ-VVL plasmid, comprising the following steps:

[0016] (1) Designing mutant primer pairs targeting amino acids 91, 97, and 98 of the GP2a protein of the rBJ1805-2 virus; the sequences of the primer pairs are shown in the following table;

[0017]

[0018] (2) Using the plasmid of the pACYC177-rBJ1805-2 reverse genetics platform as a template, rBJ-XbaI-F3 and rBJ-VVL-R, and rBJ-VVL-F and rBJ-NOT1-2fu-1 were combined to obtain the front and back segments of the rBJ-VVL mutant by PCR amplification, and the linear vector fragment, the front and back segments of the mutant were homologously recombined to obtain the rBJ-VVL plasmid.

[0019] The present invention also provides a method for obtaining a NADC34-like PRRSV-2 mutant strain or a passaged strain thereof, comprising the following steps:

[0020] The method comprises the steps (1) and (2), and further comprises the step (3) of transfecting the rBJ-VVL plasmid into cells; or further subcultures the cells to obtain the subculture strains.

[0021] Wherein, the cells include PAM cells or Marc-145 cells.

[0022] In another aspect of the present invention, an in vitro passage strain of NADC34-like PRRSV-2 highly adapted to Marc-145 cells is provided. Specifically, rBJ-VVL is continuously passaged in vitro on Marc-145 cells, and the TCID50 growth curve of the passage strains of the tenth, 30th and 50th generations is measured on Marc-145 cells, thereby obtaining an in vitro passage virus of NADC34-like PRRSV-2 with extremely high yield.

[0023] The rBJ-VVL plasmid, the virus strain or its subcultured virus strain of the present invention are used in preparing a vaccine for preventing porcine reproductive and respiratory syndrome virus.

[0024] The present invention also provides a NADC34-like PRRSV-2 specific vaccine, which comprises the strain or its passaged strain or its inactivated strain.

[0025] Wherein, the vaccine is in the form of injection, drops, spray or other dosage forms.

[0026] The last aspect of the present invention provides the results of evaluating the immune protection effects of the rBJ1805-2 parent strain that cannot adapt to Marc-145 cells and the tenth and thirtieth generation in vitro passage strains of rBJ-VVL. Specifically, the tenth and thirtieth generation strains of rBJ1805-2 and rBJ-VVL were immunized in pigs, and the NADC34-like PRRSV-2 wild strain challenge test was performed 42 days after immunization. During this period, body temperature, body weight and viremia were monitored, and after the test, the pig lung lesions were observed, and HE staining and immunohistochemistry tests were performed. It was confirmed that the passage strains cultivated based on rBJ-VVL are not only safe, but also provide complete clinical protection for pigs against NADC34-like PRRSV-2 wild virus attack. Therefore, it can be used to create the first NADC34-like PRRSV-2 specific vaccine.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following advantages: based on the NADC34-like PRRSV-2 reverse genetic operation platform, the present invention obtains a modified strain rBJ-VVL that obtains Marc-145 cell tropism by accurately mutating the 91 / 97 / 98 amino acid sites in GP2a; the modified virus constructed by the present invention can cause cytopathic effect (CPE) and form plaques when inoculated into Marc-145 cells for subculture; the first-generation adapted virus of rBJ-VVL is used as the parent strain, and Marc-145 cells are continuously subcultured in vitro to cultivate Marc-145 cell-adapted NADC34-like PRRSV-2 strains rBJ-VVL-P10, rBJ-VVL-P30 and rBJ-VVL-P50; the Marc-145 cell-passaged virus obtained by the present invention has an extremely high viral load, and a large number of new progeny viruses (up to 10 6.9 TCID50 / mL); the Marc-145 cell-passaged virus obtained by the present invention has good safety, does not cause fever (in vitro <40°C) after inoculation into pigs, and will not cause death of piglets; when attacked by NADC34-like PRRSV-2 wild strain, the Marc-145 cell-passaged virus can provide complete clinical protection; the cultivated Marc-145 cell-adapted modified virus strain is used to create the first NADC34-like PRRSV-2 vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the strategy for screening the key structural proteins of the rBJ1805-2 infectious clone virus tropism for Marc-145 cells in Example 1;

[0029] Figure 2It is the indirect immunofluorescence image of PAM cell and Marc-145 cell rescue of each modified strain in Example 1;

[0030] Figure 3 Marc-145 cell growth curves and plaque plots of each modified strain in Example 1;

[0031] Figure 4 It is a schematic diagram of the comparison of rBJ-VVL and 91 / 97 / 98 sites in Example 1 with other strains;

[0032] Figure 5 It is the indirect immunofluorescence image of rBJ-VVL and 91 / 97 / 98 single-site reversion mutation verification strains in Example 1 in PAM cells and Marc-145 cells;

[0033] Figure 6 Marc-145 cell TCID50 growth curves of the tenth, thirtieth and fiftieth passage rBJ-VVL strains in Example 1;

[0034] Figure 7 The plaques formed by the tenth, thirtieth and fiftieth generations of rBJ-VVL in Marc-145 cells in Example 1;

[0035] Figure 8 It is the viremia produced in pigs during the tenth and thirtieth immunization and challenge period of BJ1805-2 and rBJ-VVL in Example 2;

[0036] Fig. 9 The dynamic changes in body temperature of the inoculated pigs during the 10th and 30th generation immunization and challenge of BJ1805-2 and rBJ-VVL in Example 2;

[0037] Fig.10 The weight changes in pigs during the 10th and 30th generation immunization and challenge of BJ1805-2 and rBJ-VVL in Example 2;

[0038] Fig.11 The neutralizing antibody titer and the number of IFN-gamma secreting cells produced by the 10th and 30th generation BJ1805-2 and rBJ-VVL viruses in Example 2;

[0039] Fig.12 The viral load of the pig lung tissue after the BJ1805-2 and rBJ-VVL tenth and thirtieth generation virus immunization groups were challenged in Example 2;

[0040] Fig.13 These are the lung pathological anatomy, pathological sections and immunohistochemistry results of the tenth and thirtieth generations of BJ1805-2 and rBJ-VVL in Example 2 after infection. DETAILED DESCRIPTION

[0041] The conventional experimental methods in the following examples are described in the third edition of Molecular Cloning Experiment Guide compiled by Sambrook et al. (Beijing: Science Press, 2002). The use of the instruments is described in the instrument operating instructions.

[0042] In the embodiments of the present invention, the viruses include SD17-38 (GeenBank accession number is MK689101), BJ1805-2 original strain (patent publication number is CN115992100A), rBJ1805-2 infectious clone (obtained by pACYC177-rBJ1805-2 plasmid rescue, patent publication number is CN115992100A), rBJ-VVL P10 subculture strain (cultivated by the present invention), rBJ-VVL P30 subculture strain (cultivated by the present invention) and rBJ-VVL P50 subculture strain (cultivated by the present invention). Cells include BHK-21 cell line, Marc-145 cell line and primary alveolar macrophage PAM (preserved in this laboratory).

[0043] In the examples of the present invention, plasmids and strains: plasmid pACYC177-rBJ1805-2 was stored in this laboratory (patent publication number is CN 115992100A), and TOP10 competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0044] In an embodiment of the present invention, the webpage tool is: https: / / benchling.com.

[0045] In the present embodiment, other reagents used: RNase Free H 2O, trypsin cell digestion solution (phenol red) were purchased from Solarbio; TRIpure Reagent total RNA extraction reagent was purchased from Adlai Biotechnology; PrimeScript 1st Strand cDNA Synthesis Kit, 2× PrimeSTAR MAX DNA Polymearse and TAKARA-Taq enzyme were purchased from TAKARA; FastPure Plasmid Mini Kit was purchased from Novezan Biotechnology Co., Ltd.; One Step CloneKit homologous recombination reagent was purchased from Novezan Biotechnology Co., Ltd.; DMEM culture medium was purchased from HyClone Biochemical Products Co., Ltd.; fetal bovine serum was purchased from Sigma; DyLight 594, Goat anti-Mouse IgG (H+L) Secondary Antibody were purchased from Invitrogen; DNA Marker was purchased from Zhejiang Boerjin Technology Co., Ltd.; 2× BioGoldTag Plus PCR MasterMix was purchased from Zhejiang Boerjin Technology Co., Ltd.; Gel Extraction Kit was purchased from Beijing Kangwei Century Biotechnology Co., Ltd.; DNA restriction endonucleases were purchased from Thermo Fisher; T4 DNA Ligase, Lipofectamine TM 3000 Transfection Reagent was purchased from Invitrogen.

[0046] Example 1 Obtaining the Marc-145 cell in vitro passaged adapted strain rBJ-VVL and its passaged strain based on the rBJ1805-2 reverse genetics platform 1 Screening of rBJ1805-2 infectious clone virus adapted to the key regions of Marc-145 cells

[0047] 1.1 Design of primers for screening strains modified at key amino acid sites adapted to Marc-145 cells

[0048] The nucleic acid sequences of pACYC177-rBJ1805-2 and Marc-145 adapted strain XJ17-5 (GeenBank accession number MK759853) were imported into the web tool https: / / benchling.com. Figure 1 The specific information of constructing primers is shown in Table 1.

[0049] Table 1. Primers for screening key amino acid sites of rBJ1805-2 infectious clone virus adapted to Marc-145 cells

[0050]

[0051] 1.2 Primer pair combination method for screening modified viruses

[0052] Table 2 includes all the primer combinations in Table 1, as well as plasmids obtained by PCR amplification and homologous recombination using these primer combinations. In Table 2, the product obtained by PCR amplification using primer pair 1 is called modified fragment 1, and the product obtained by PCR amplification using primer pair 2 is called modified fragment 2.

[0053] Table 2. Primer pair combinations of modified viruses used for screening and obtained plasmids

[0054]

[0055]

[0056] 1.3 Construction method of transformation cloning plasmid

[0057] First, construct pACYC177-rBTX234. The specific structural replacement diagram is shown in Figure 1 The construction method is as follows: primers rBJ-XbaI-F3 and rBTX234-ORF1b-R, rBTX234-ORF2-F and rBTX234-ORF4-R, and rBTX234-ORF5-F and rBJ-NOT1-2fu-1 are combined to obtain rBTX234-1, rBTX234-2, and rBTX234-3 segments by PCR amplification. Then, pACYC177-rBTX234 transformation cloning plasmid is obtained by homologous recombination.

[0058] Among them, the PCR amplification method and homologous recombination method of the transformed fragment are as follows:

[0059] 1.3.1 PCR amplification method and system for modified fragments

[0060] The modified fragments in the present invention are amplified by the following PCR amplification method. The system and procedure of PCR amplification are shown in Table 3 and Table 4. The commercial kit is 2× PrimeSTAR MAX DNA Polymearse (purchased from TAKARA Company) in the materials.

[0061] Table 3. Reaction system

[0062]

[0063] Table 4. Reaction procedure

[0064]

[0065] Using the above method, combined with the primer pair combination in Table 2, we can get Figure 1 The modified fragments 1 and 2 required for each modified strain were shown. Electrophoresis was performed using a large pore 1% gel for 30 min, and the enzyme-cut bands were separated by agarose gel electrophoresis. The target bands were cut out and gel-recovered. The amplified modified fragments were stored at -20°C.

[0066] 1.3.2 Vector digestion and homologous recombination methods and systems

[0067] All vector enzyme digestion and homologous recombination methods in the present invention are performed by the following method. First, the reverse genetic platform plasmid rBJ1805-2 plasmid is double-digested with XbaⅠ and NotⅠ to prepare a linearized vector pACYC177-BJ1805-2-F1+F2. The specific system of double enzyme digestion is shown in Table 5.

[0068] Table 5. pACYC177-rBJ1805-2 plasmid double restriction enzyme digestion system

[0069]

[0070] According to the above system, the enzyme digestion was carried out at 37℃ for 30min. The enzyme digestion bands were separated by agarose gel electrophoresis, and the target bands were cut out for gel recovery. The concentration of the pACYC177-BJ1805-2-F1+F2 linearized vector was measured to be 30ng / μL and stored at -20℃.

[0071] Then, the modified fragments 1 and 2 recovered from the gel were homologously recombined with the linearized vector pACYC177-BJ1805-2-F1+F2 (One Step Clone Kit). The specific system is shown in Table 6.

[0072] Table 6. Homologous recombination system

[0073]

[0074] After the system was placed at 37°C for 30 minutes, it was immediately placed on ice. Transformed into TOP10 super competent cells, independent colonies were picked for pure culture, and the bacterial solution was tested by PCR using detection primers. PCR-positive bacteria were selected to expand the bacterial solution overnight, plasmids were extracted, and double enzyme digestion was performed using XbaⅠ and AscⅠ for identification. Then, 0.9% agarose gel electrophoresis was performed. The correct length of the enzyme-cut band was 6061bp, and the plasmid of the correct size was selected for retention.

[0075] 1.4 Rescue of modified viruses in PAM cells and test of their adaptability to Marc-145 cell culture

[0076] 1.4.1 PAM cell rescue with transformed clone plasmid

[0077] BHK-21 cells were cultured in DMEM medium containing 10% FBS at a density of 2.5 × 10 5 The cells were seeded at a density of cells / well in a 24-well cell culture plate and placed at 37°C with 5% CO 2 Incubator until the cell density reaches about 80%. TM 3000Transfection Reagent Instructions Perform cell transfection.

[0078] Transfection method: First, mix 2 μg plasmid, 4 μL P3000 plasmid and 50 μL OPTI-MEM reagent to form solution A, then mix 3 μL Lip3000 and 50 μL DMEM to form solution B. Then, mix solution A and solution B and wait for 15 min at 25°C. Finally, add to BHK-21 cells. See Table 8 for the transfection system.

[0079] 48 h after cell transfection, the 12-well plate was sealed and frozen at -80°C. After repeated freezing and thawing twice, all the cell suspension was taken out and centrifuged at 10,000 × g for 4 min to collect the transfection supernatant.

[0080] Table 7. Transfection system

[0081] Type\Name Plasmids Lip3000 P3000 DMEM Plasmid Master Mix 2000ng - 3μL 50μL Lip3000 premix - 4μL - 50μL

[0082] Primary PAM cells were cultured at a rate of 2×10 5 Cells / well were plated and inoculated into 12-well cell culture plates and placed at 37°C with 5% CO 2 After the primary PAM cells adhered to the wall, 500 μL of the transfection supernatant was taken and covered on the primary PAM cells. After incubation for 2 hours, the supernatant was discarded and RPMI (1640) medium containing 2% FBS was added to continue the culture. In addition, the BJ1805-2 protovirus was used to infect the primary PAM cells as a positive control. After culturing for 3-4 days, the pathological conditions of the PAM cells were observed, the cell supernatant was collected, and the cells were left for IFA identification using the PRRSV-N-specific N protein monoclonal antibody 6A1.

[0083] The rescue results of PAM cells are shown in Figure 2 , after IFA identification, Figure 1 All modified viruses constructed in the experiment showed specific red fluorescence, indicating that Figure 1 All modified viruses constructed in the experiment were successfully rescued in PAM cells.

[0084] 1.4.2 Adaptation test and subculture of rescued venom in Marc-145 cells

[0085] Marc-145 cells were cultured in DMEM medium containing 10% FBS at a volume of 2 × 10 5 The cells were seeded at a density of cells / well in a 12-well cell culture plate and placed at 37°C with 5% CO 2 The cells were cultured in an incubator until the cell density reached about 80%, and then the medium was changed to DMEM containing 2% FBS.

[0086] Take 500 μL of the virus solution successfully rescued in PAM cells in 1.4.1 and inoculate Marc-145 cells. The strain was blindly propagated for 5 generations, and the fifth generation of modified virus was inoculated into Marc-145. After 144 hpi, IFA identification was performed using PRRSV-2 anti-N protein monoclonal antibody 6A1.

[0087] like Figure 2 As shown in the IFA identification results, rBTX2, rBTX23, rBTX24 and rBTX234 can detect specific red fluorescence in Marc-145 cells. This shows that rBTX2, rBTX234, rBTX23 and rBTX24 can infect Marc-145, while rBTX3, rBTX4 and rBTX34 cannot infect Marc-145 cells. Figure 1 As shown in the figure, strains adapted to Marc-145 cells all replaced ORF2, indicating that the key amino acid site is in the GP2a protein encoded by the ORF2 gene.

[0088] GP2a has a total length of 256 amino acids (aa), and its specific structure is as follows: the overlap with GP3 is 202-256aa, the same region between rBJ1805-2 and XJ17-5 is 191-202aa, and the difference region between rBJ1805-2 and XJ17-5 is 1-191aa. The IFA identification results are shown in Figure 2 , among the three modified viruses rBTX2-1-191aa, rBTX2-1-76aa and rBTX2-77-191aa constructed based on the difference regions and similar regions. rBTX2-1-191aa and rBTX2-77-191aa can adapt to Marc-145 cell culture, while rBTX2-1-76aa cannot. Subsequently, 1-76+202-256aa was combined and replaced to verify whether the GP3 overlapping region was involved in Marc-145 cell culture. The IFA results showed that rBTX2-1-76+202-256aa could not infect Marc-145 cells. In summary, the 77-191aa of the GP2a protein encoded by the ORF2 gene is the minimum range for rBJ1805-2 to adapt to Marc-145 cells.

[0089] Then, in the 77-191aa of GP2a encoded by ORF2, the difference regions are 77-98aa and 118-191aa, and 99-117 are completely identical sequences. rBTX2-77-98aa and rBTX2-118-191aa were constructed based on the difference sequences and similar sequences. The IFA identification results are shown in Figure 2 , only rBTX2-77-98aa infected Marc-145 cells. The further constructed rBTX2-77-88aa and rBTX2-77-88aa+118-191aa could not infect Marc-145 cells. In summary, the remaining 89-98aa amino acids are the key region that determines the adaptation of rBJ1805-2 to Marc-145 cells.

[0090] 1.5 Transformed virus infected with Marc-145 cells was subcultured in Marc-145 cells

[0091] Marc-145 cells were cultured in DMEM medium containing 10% FBS at a volume of 2 × 10 5 The cells were seeded at a density of cells / well in a 12-well cell culture plate and placed at 37°C with 5% CO 2 The cells were cultured in an incubator until the cell density reached about 80%, and then the medium was changed to DMEM containing 2% FBS.

[0092] The modified strain virus solution successfully adapted to Marc-145 cells in 1.4.2 was inoculated into new Marc-145 cells at 0.01moi. After the virus was adsorbed for 2h, it was washed 3 times with PBS and replaced with DMEM medium containing 2% FBS. After new lesions were generated at 144hpi, the freeze-thaw-inoculation operation was repeated, and the virus was repeatedly passaged to the tenth generation and stored in a -80℃ refrigerator for later use.

[0093] 1.6 Determination of growth characteristics of strains adapted to Marc-145 cell culture

[0094] First, the TCID50 titer of each adapted strain of the tenth generation was determined. The TCID50 detection method was as follows: Marc-145 cells were cultured at 4×10 4 The cells were seeded at a density of cells / well in a 96-well cell culture plate and placed at 37°C with 5% CO 2Incubator culture until the cell density reaches about 80%, then switch to DMEM medium containing 2% FBS. Take the original virus solution and dilute it 10, 100, 1000, 10000, 100000, 1000000 times. Inoculate 96 wells with 4 replicates of each dilution gradient. After 2 hours of adsorption, switch to 200 μL of fresh DMEM medium containing 2% FBS. After 144 hpi, count the wells with lesions and calculate the TCID of the original virus solution. 50 Virus titer. The specific titers of each adapted virus stock solution are shown in Table 8:

[0095] Table 8. Titer of virus stock solution of modified virus

[0096]

[0097]

[0098] The growth of each adapted virus on Marc-145 cells was evaluated by drawing a multi-step growth curve. The specific method is as follows: inoculate each virus solution onto Marc-145 cells in a 6-well plate at an infection dose of 0.01moi. Take the supernatant at six time points, including 12hpi, 24hpi, 36hpi, 48hpi, 72hpi and 96hpi, and freeze them in a -80°C refrigerator. After all time points are collected, the supernatant at different time points is measured by the TCID50 titer determination method to determine the titer at different time points, and a standard curve is drawn. The results of the multi-step growth curve determination are shown in the figure. Figure 3 As shown in A, each modified strain can complete proliferation on Marc-145 cells.

[0099] 1.7 Adaptation of the virus to the plaque assay in Marc-145 cells

[0100] Marc-145 cells were cultured in DMEM medium containing 10% FBS at a volume of 1 × 10 5 The number of cells / well was inoculated into a 24-well cell culture plate and placed at 37°C with 5% CO 2 Incubate the cells in a 4% PBS incubator until the cell density reaches about 80%, then switch to DMEM medium containing 2% FBS. Observe the cell density the next day and proceed to the next step when the cells reach a dense state.

[0101] The original virus solution was diluted 10, 100, 1000, 10000, 100000, 100000, and 1000000 times, and then infected Marc-145 cells for 2 hours. After 2 hours, the virus solution was discarded, and the cells were gently washed 3 times with 1×PBS. 0.7% low-melting point agarose culture medium (30mL culture medium formula: 15mL DMEM + 600μL FBS + 300μL penicillin-streptomycin + finally poured in 15mL 1.4% low-melting point agar solution) was prepared, and after cooling to about 37 degrees, the monolayer of cells was directly covered. Then the 6-well plate was inverted for culture and observed after 6 days. After the cell lesions were formed, the culture medium was covered with 4% paraformaldehyde, and after fixing overnight, crystal violet staining was performed for 1 hour. After staining, rinse with water and observe. The results of the plaque experiment are as follows Figure 3 As shown in B, all the adapted viruses used were able to produce obvious plaques on Marc-145 cells.

[0102] 2. Rescue of rBJ-VVL virus and verification of reverse mutation of three amino acid points of GP2a-91 / 97 / 98

[0103] 2.1 Construction, rescue and Marc-145 adaptability test of rBJ-VVL virus

[0104] According to the final screening results in 1, the 89-98aa sequences of rBJ1805-2 and XJ17-5 GP2a were compared. The sequence comparison results are shown in Figure 4 The comparison results showed that in the 88-98aa of GP2a of PRRSV strain, only the 91st, 97th and 98th amino acids were different. Therefore, it was confirmed that the 91st, 97th and 98th amino acids of GP2a were the key amino acid sites for rBJ1805-2 to adapt to Marc-145 cells. Three point mutations were performed on these three sites.

[0105] On the Benchling web tool, a comparison analysis was performed based on the plasmid sequence information of the pACYC177-rBJ1805-2 reverse genetic platform (sequence composition shown in SEQ ID NO.1+SEQ ID NO.2) and the Marc-145 cell adaptation strain XJ17-5. Figure 1 As shown. The amino acid coding sequence of GP2a-91 / 97 / 98 "TMF" of rBJ1805-2 was changed to the "VVL" pattern of GP2a-91 / 97 / 98 of XJ17-5. The designed primers are used for homologous recombination, requiring a GC content of 40-60% and a length of ≥18bp. The specific transformation primers include the above-mentioned 2 transformation primers and 2 reverse genetic platform vector fixed transformation primers. Primer information is shown in Table 9.

[0106] Table 9. rBJ-VVL mutation primers

[0107] Primer name Sequence (5'-3') rBJ-VVL-F CGTCTGGGGAgtCAAGCACCCCCTGGGAgTGcTTTGGCACCACAAG rBJ-VVL-R CTTTGTGGTGCCAAAgCAcTCCCAGGGGGTGCTTGacTCCCCAGACG

[0108] Combine rBJ-VVL-R and rBJ-XbaI-F, and combine rBJ-VVL-F and rBJ-NOT1-2fu-1, and obtain modified fragment 1 and modified fragment 2 by the PCR amplification method in 1.3.1. Obtain the modified clone plasmid pACYC177-rBJ-VVL by the homologous recombination method in 1.3.2. The construction of pACYC177-rBJ-VVL modified clone plasmid, rescue of modified virus PAM cells and Marc-145 adaptive culture test were carried out by the method in 1.4. Figure 5 The IFA results showed that rBJ-VVL could successfully infect Marc-145.

[0109] The rBJ-VVL strain was repeatedly passaged for 10, 30 and 50 generations using the passage method described in 1.5 to obtain rBJ-VVL P10, rBJ-VVL P30 and rBJ-VVL P50.

[0110] The specific TCID50 titers of them were determined by the method in 1.6. The specific titers were rBJ-VVL P10:10 2.5 TCID50 / mL, rBJ-VVL P30: 10 6.3 TCID50 / mL, rBJ-VVL P50: 10 6.9 TCID50 / mL.

[0111] The multi-step growth curves of rBJ-VVL P10, rBJ-VVL P30 and rBJ-VVL P50 strains were determined by the method of 1.7. The results are shown in Figure 6 The growth ability of rBJ-VVL P30 and rBJ-VVL P50 on Marc-145 cells was significantly higher than that of rBJ-VVL P10.

[0112] Plaque assays were performed on rBJ-VVL P10, rBJ-VVL P30, and rBJ-VVL P50 strains using the method described in 1.8. The results are shown in Figure 7 In the plaque assay, the number of plaques of rBJ-VVL P30 and rBJ-VVL P50 at the 1000th dilution was significantly higher than that of rBJ-VVL P10. The above results show that rBJ-VVL P30 and rBJ-VVL P50 can produce a large amount of fresh progeny virus liquid.

[0113] 2.2 Verification of rBJ-TVL, rBJ-VML and rBJ-VVF revertant strains

[0114] To confirm the necessity of the three amino acid sites 91 / 97 / 98 for rBJ1805-2 to adapt to Marc-145 cells, reverse mutation verification was performed on each site. The specific primers are shown in Table 10.

[0115] Table 10. Reverse mutation primers

[0116] name Sequence (5'-3') rBJ-VVL-V91T-F CGTCTGGGGAACCAAGCACCCCCTGGGAgTGcTTTGGCACCACAAG rBJ-VVL-V91T-R CTTTGTGGTGCCAAAgCAcTCCCAGGGGGTGCTTGGTTCCCCAGACG rBJ-VVL-V97M-F CGTCTGGGGAgtCAAGCACCCCCTGGGAATGcTTTGGCACCACAAG rBJ-VVL-V97M-R CTTTGTGGTGCCAAAgCATTCCCAGGGGGTGCTTGacTCCCCAGACG rBJ-VVL-L97F-F CGTCTGGGGAgtCAAGCACCCCCTGGGAgTGTTTTGGCACCACAAG rBJ-VVL-L97R-R CTTTGTGGTGCCAAAACAcTCCCAGGGGGTGCTTGacTCCCCAGACG

[0117] The above primers rBJ-XbaI-F3, rBJ-VVL-V91T-F, rBJ-VVL-V97M-F and rBJ-VVL-L97F-F were combined with rBJ-NOT1-2fu-1 to amplify the posterior segments of rBJ-TVL, rBJ-VML and rBJ-VVF mutants. rBJ-XbaI-F3 was combined with rBJ-VVL-V91T-R, rBJ-VVL-V97M-R and rBJ-VVL-L97R-R to amplify the anterior segments of rBJ-TVL, rBJ-VML and rBJ-VVF mutants. Subsequently, the mutants rBJ-TVL, rBJ-VML and rBJ-VVF were obtained according to the PCR amplification method and homologous recombination method in 1.3. Then, the rescue of rBJ-TVL, rBJ-VML and rBJ-VVF in PAM cells and their adaptability to Marc-145 cells were tested according to the method in 1.4.

[0118] The results are as follows Figure 5 As shown, indirect immunofluorescence showed that rBJ-TVL, rBJ-VML and rBJ-VVF could successfully rescue PAM cells. However, no specific fluorescence signal could be detected after rBJ-TVL, rBJ-VML and rBJ-VVF were inoculated into Marc-145 cells. The above results prove that the three points of the V / V / L pattern are necessary for NADC34-like PRRSV-2 to acquire Marc-145 cell tropism.

[0119] Based on all the above results, it is proved that in addition to the modified virus successfully adapted to Marc-145 cell culture as described in 1, V / V / L is the key amino acid site that determines the adaptation of rBJ1805-2 to Marc-145 cell culture.

[0120] Example 2: Pig immune challenge test of rBJ1805-2, rBJ-VVL P10, and P30

[0121] 1. Immunization and challenge of pigs with rBJ1805-2, rBJ-VVL P10 and rBJ-VVL P30

[0122] Select 20 4-week-old piglets from a pig farm that is negative for important pathogens such as PRRSV-2, PRV (pseudorabies virus), PCV (circovirus), and PEDV (porcine epidemic diarrhea virus). 5 TCID 50 Five piglets were inoculated with 2 mL of rBJ1805-2 virus solution containing 10 5 TCID 50 Five piglets were inoculated with rBJ-VVL P10 and P30 virus solutions. Three other piglets were inoculated with 2 mL of DMEM medium. The remaining two pigs were used as negative controls. Immunization was performed by intramuscular injection.

[0123] After 42 days of immunization, when the viremia of the pigs completely disappeared, the virus challenge test was carried out. 5 TCID 50 The NADC30-like SD17-38 wild strain (the strain was isolated and preserved in our laboratory, and the GeenBank accession number is MK689101) was used for challenge. The challenge method was nasal drops.

[0124] 2. Monitoring of pig viremia, body temperature and weight

[0125] according to Figure 6 Pig serum was collected at the indicated time points, and the viral content was detected by qRT-PCR. Specifically, the serum was collected into a procoagulant blood vessel and placed at 37°C for 30 minutes to promote blood coagulation. Then, centrifugation was performed at 4000rpm for 30 minutes. Take 200μL of supernatant and use TRIpure Reagent total RNA extraction reagent (purchased from Adlai Biotechnology) to extract total RNA, and store the extracted total RNA at -20°C or -80°C for a long time. Use a reverse transcription kit (PrimeScriptTM1st strandcDNA Synthesis Kit, TAKARA) to reverse transcribe the viral RNA into cDNA, and store the obtained cDNA at -20°C for standby use. The reaction system and procedure are detailed in Tables 11 and 12.

[0126] Table 11. Total RNA pretreatment system and procedures

[0127]

[0128] Table 12. Total RNA reverse transcription system and procedure

[0129]

[0130] Table 13. qPCR system and procedure

[0131]

[0132] The system and procedure of qPCR are shown in Table 13. Take 1 μL of cDNA, 0.4 μL of probe, 0.5 μL of primers (upstream and downstream primers were pre-combined to a working concentration of 10 μM each), 10 μL of Taq enzyme (purchased from TAKARA) and 8.1 μL of H 2 O is a monitoring well. The probe and primer information is shown in Table 13. Three replicate wells are set for each sample. The program is 98℃10s, 60℃10s, 40 cycles, and signal acquisition is performed after each cycle. qPCR is performed to monitor the viremia of the inoculated pigs. The results are shown in Figure 8 As shown in the figure, the viremia of pigs immunized with rBJ-VVL P10 and P30 passage strains was significantly lower than that of the original rBJ1805-2 strain. It can provide protection against the wild virus SD17-38 and reduce the viremia rapidly.

[0133] Table 14. qPCR probe and primer information

[0134] name Sequence information (5'-3') PRRSV2N34-P FAM-TGTGAGCACCGTTTAT-MGB NADC34-F13240 TGGTTGGCGTTCTTGTCCTT NADC34-R13340 CATCATGAACGGCACAAATGA

[0135] according to Fig. 9 and Fig.10 The temperature and weight were measured at the time of the test. The temperature was measured by inserting the thermometer into the anus and holding it there until the temperature stopped changing, then recording the reading. Fig. 9 and Fig.10 As shown in the figure, when the rBJ-VVL P10 and P30 passage strains were immunized, the body temperature of the pigs was significantly lower than that of the rBJ1805-2 original strain. rBJ1805-2, rBJ-VVL P10 and P30 immunizations were able to provide protection against the wild-type SD17-38 virus, and the body temperature of the immunized pigs remained stable. The weight of the pigs in all groups after the virus attack was as follows: Fig.10 As shown, there is no significant difference.

[0136] 3. Analysis of pig protective immune response

[0137] To measure the protective humoral immune response, serum collected 14 days after the challenge was used for neutralization test. The specific method is as follows: Marc-145 cells were cultured at 1×10 5 The cells were seeded at a density of cells / well in a 24-well cell culture plate and placed at 37°C with 5% CO 2 Incubate in an incubator until the cell density reaches about 80%, then switch to DMEM medium containing 2% FBS. First, inactivate the collected serum at 56°C for 30 minutes. Then dilute it at a dilution ratio of 1:8, 1:16, 1:32, and 1:64. The serum dilution system is 50 μL. Take 50 TCID 50The virus solution was diluted to 50 μL. The serum gradient dilution solution and the virus solution were mixed and placed at 37°C with 5% CO 2 The mixture was then transferred to a 96-well plate of Marc-145 cells. Four replicate wells were made for each serum dilution gradient. The titer of the neutralizing antibody was calculated according to TCID 50 The algorithm is used to obtain the Log2 value of the dilution multiple. The specific dilution ratio can be obtained by calculating it according to the POWER (2, Log2 value) formula in the EXCEL table. The result is as follows Fig.11 As shown in A, the pigs in the rBJ1805-2, rBJ-VVL P10 and P30 immunization groups were able to stimulate the pigs to produce high titers of neutralizing antibodies, and there was no significant difference among the groups.

[0138] In addition, to determine the protective cellular immune response, we also measured the levels of PRRSV-specific IFN-γ secreting cells in PBMCs collected 42 days after vaccination and 14 days after challenge. Fig.11 As shown in B, rBJ1805-2, rBJ-VVLP10 and P30 can induce the production of PRRSV-specific IFN-γ secreting cells after immunization, and there is no significant difference between the immune groups. After the virus attack, the level of PRRSV-specific IFN-γ secreting cells in the immune virus attack group increased, but there was no significant difference with the virus attack group. This may be due to the large difference in the genome between the virus attack strain and the immune strain (the whole genome has only 80.39% similarity), so no significant memory IFN-γ secreting cell response was produced.

[0139] 4. Viral load detection in pig lung tissue

[0140] First, take 1g of lung lobule from each pig, add 1mL PBS and grind for 3min. Centrifuge at 5000rpm for 5min. Take 200μL supernatant to extract RNA. Then, quantify the lung RNA of each pig and record the RNA concentration. Subsequently, reverse transcribe the RNA to obtain lung tissue cDNA. The specific method and system for obtaining cDNA are shown in 2.

[0141] The viral load in lung tissue was monitored by qPCR. The specific method and system of qPCR are shown in 2. Fig.12 The viral loads in lung tissues of rBJ1805-2+SD17-38, rBJ-VVL P10+SD17-38 and BJ-VVL P30+SD17-38 groups were significantly lower than those in SD17-38challenge group. There was no difference in viral loads among rBJ1805-2+SD17-38, rBJ-VVL P10+SD17-38 and rBJ-VVL P30+SD17-38 groups.

[0142] 5. Pathological anatomy, pathological sections and immunohistochemistry

[0143] Pig autopsy results Fig.13 As shown, the piglets in the SD17-38 group had obvious lung virus, a small amount of lymphocyte infiltration was observed by HE staining, and PRRSV antigen was detected by IHC. The rBJ1805-2+SD17-38 group, rBJ-VVL P10+SD17-38 group, and rBJ-VVL P30+SD17-38 group were similar to the negative control group, with no obvious lung lesions, no significant pathological changes by HE staining, and no PRRSV antigen detected by IHC. The above results indicate that rBJ1805-2, rBJ-VVL P10, and rBJ-VVL P30 immunization can provide complete clinical protection for pigs.

Claims

1. An rBJ-VVL plasmid, characterized in that: The rBJ-VVL plasmid is prepared by using the plasmid of the pACYC177-rBJ1805-2 reverse genetic platform as a template, designing a primer pair for the mutation of the 91st, 97th and 98th amino acids of the GP2a protein of the rBJ1805-2 virus to V, V and L, amplifying the mutant fragments by PCR amplification method and connecting them with the linearized vector; wherein, the sequence of the plasmid of the pACYC177-rBJ1805-2 reverse genetic platform is shown in SEQ ID NO.1+SEQ ID NO.2; the rBJ1805-2 virus is an infectious clone virus of the NADC34-like PRRSV-2rBJ1805-2 strain, which is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University in Wuhan, China, the deposit number is CCTCCNO: V202250, and the deposit date is 2022.06.29; rBJ1805-2 The amino acid sequence of the viral GP2a protein is the amino acid sequence from positions 1888 to 2143 obtained by translating positions 2 to 9955 of the sequence SEQ ID NO.

2.

2. The rBJ-VVL plasmid according to claim 1, characterized in that The primer pairs include a combination of rBJ-XbaI-F3 and rBJ-VVL-R and a combination of rBJ-VVL-F and rBJ-NOT1-2fu-1, and PCR amplification is performed to obtain the front segment and the back segment of the rBJ-VVL mutant, respectively. The rBJ-VVL plasmid is obtained by connecting the front segment and the back segment of the mutant with the linearized vector through homologous recombination. The sequences of the primer pairs are shown in the following table:

3. A NADC34-like PRRSV-2 mutant strain, characterized in that: The mutant strain is a virus in which the 91st, 97th and 98th amino acids of the GP2a protein of the NADC34-like PRRSV-2 infectious clone virus rBJ1805-2 are mutated from T, M and F to V, V and L respectively. The NADC34-like PRRSV-2 infectious clone virus rBJ1805-2 is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University in Wuhan, China, the deposit number is CCTCC NO: V202250, and the deposit date is 2022.06.29; the amino acid sequence of the GP2a protein of the rBJ1805-2 virus is the amino acid sequence 1888-2143 obtained by translating the sequence SEQ ID NO.2 from positions 2 to 9955.

4. The mutant strain according to claim 3, wherein the mutant strain is obtained by transfecting cells with the mutant plasmid according to claim 1 or 2.

5. A method for constructing rBJ-VVL plasmid, characterized in that: The following steps are involved: (1) Designing mutant primer pairs for amino acids 91, 97, and 98 of the GP2a protein of the rBJ1805-2 virus; the rBJ1805-2 virus is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University in Wuhan, China, the deposit number is CCTCC NO: V202250, and the deposit date is 2022.06.29; the amino acid sequence of the GP2a protein of the rBJ1805-2 virus is the amino acid sequence 1888-2143 obtained by translating the sequence SEQ ID NO.2 from positions 2 to 9955, The primer pair sequences are shown in the following table: (2) Using the plasmid of the pACYC177-rBJ1805-2 reverse genetic platform as a template, rBJ-XbaI-F3 and rBJ-VVL-R were combined, and rBJ-VVL-F and rBJ-NOT1-2fu-1 were combined to obtain the front and back segments of the rBJ-VVL mutant by PCR amplification, and the linear vector fragment, the front and back segments of the mutant were homologously recombined to obtain the rBJ-VVL plasmid. The sequence of the plasmid of the pACYC177-rBJ1805-2 reverse genetic platform is shown in SEQ ID NO.1+SEQ ID NO.

2.

6. A method for obtaining a NADC34-like PRRSV-2 mutant strain or a passaged strain thereof, characterized in that: The following steps are involved: The method comprises steps (1) and (2) as described in claim 5, and further comprises step (3) of transfecting cells with the rBJ-VVL plasmid; or further subculturing the cells to obtain subculture strains, wherein the cells are PAM cells or Marc-145 cells.

7. Use of the rBJ-VVL plasmid according to claim 1 or 2, the strain according to claim 3 or 4 or its subcultured strain in the preparation of a vaccine for preventing porcine reproductive and respiratory syndrome virus.

8. A NADC34-like PRRSV-2 specific vaccine, characterized in that: The NADC34-like PRRSV-2 specific vaccine comprises the strain described in claim 3 or 4 or its subculture strain or its inactivated strain.

9. A NADC34-like PRRSV-2 specific vaccine according to claim 8, characterized in that: The vaccine is in the form of injection, drops or spray.

Images