Construction method of trichogramma gene silencing system

Abstract

The invention discloses a construction method of a trichogramma gene silencing system, which is characterized in that trichogramma pupae are dissected from host eggs, a microinjection method and a soaking method are combined, and an injection part and soaking time are optimized, so that the gene silencing efficiency is remarkably improved to about 80% at most, and meanwhile, the survival rate of trichogramma is ensured. The gene silencing system is suitable for different types of trichogramma and gene expression silencing in different development stages, and provides technical support for researching molecular mechanisms of importance characters of trichogramma.

Description

Technical Field

[0001] The invention provides a method for constructing an efficient gene silencing system of trichogrammatids, which realizes efficient silencing of genes of different trichogrammatids species and at different stages, meets the needs of gene function research and practical application, and belongs to the technical field of agricultural biological pest control. Background Art

[0002] Since the discovery of RNA interference (RNAi) technology, it has become an important tool in the study of insect gene function, especially in reverse genetics research. The successful application of RNAi technology in insects depends on whether double-stranded RNA (dsRNA) can be effectively delivered into cells. At present, there are five main methods for introducing dsRNA into insects: feeding, injection, immersion, transgenic method and virus-mediated method. However, the application of RNAi technology in some tiny insect species is difficult and still faces challenges.

[0003] Trichogramma Trichogramma Belonging to the family Trichogrammatidae of the order Hymenoptera, the adult Trichogrammatidae lays eggs inside the eggs of pests, preventing the host eggs from hatching, thereby achieving the purpose of eliminating pests. At present, the research on Trichogrammatidae is mostly focused on ecology and application fields, but there are few studies on the molecular mechanisms of Trichogrammatidae host localization and host regulation, which is related to the relatively backward research methods of Trichogrammatidae gene function. Therefore, in order to further study the functions of olfactory genes for Trichogrammatidae search and host localization and venom genes for regulating host immunity, it is urgent to establish a gene silencing system for Trichogrammatidae.

[0004] However, the development of trichogrammatids mainly occurs in the host eggs, and the development period and body size of the same trichogrammatid vary greatly depending on the host, which brings difficulties to the application of RNAi technology. In addition, trichogrammatids are tiny (adults are about 0.5-1 mm long), microinjection is difficult to operate, and the mortality rate is high when they are separated from the host eggs, which makes the implementation of common RNAi methods such as microinjection particularly difficult. So far, RNAi research on trichogrammatids has mainly focused on trichogrammatids of pine caterpillars bred from tussah eggs ( T. Dendrolimi ) on, silence VxD The gene was knocked out, which led to the stunted ovarian growth. However, there are still few research reports on RNAi technology in other trichogrammatids. Summary of the invention

[0005] The present invention provides an efficient and stable trichogrammatid gene silencing system, aiming to overcome the problems of low efficiency and limited application scope of existing trichogrammatid gene silencing technology, especially the deficiency that gene silencing is currently only achieved in pine caterpillar trichogrammatids. The present invention can achieve efficient silencing of genes of different trichogrammatid species and different stages, meeting the needs of gene function research and practical application.

[0006] 1) Select target genes: Screen out Trichogramma ostriniae laccase2 Trichogramma dendrolimus white Gene; the gene sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively; 2) Preparation of dsRNA solutions of different concentrations: According to the method of step 1, white Trichogramma ostriniae laccase2 Gene sequence design and synthesis of dsRNA, using RNase-free water to dilute dsRNA solutions of different concentrations to the final concentration; 3) Determine the spatial expression of genes: sample Trichogramma bees at different stages and use fluorescent quantitative PCR to determine the specific period of gene expression; select bee pupae: dissect Trichogramma pupae under a stereo microscope and select pupae with consistent development; 5) Preparation of artificial eggs: Use Bemis PM-996 sealing film and press the hemispherical protrusion with the round end of a stick brush; 6) Preparation of needle tube: The capillary glass needle tube made of borosilicate is pulled into an injection needle tube using a needle puller; 7) Soaking treatment: Place the dissected Trichogramma pupae of the same developmental period in artificial eggs and add 1 μl of dsRNA solutions of different concentrations; 8) Injection treatment: Use a syringe to suck the dsRNA solution into the needle, use the needle to gently pierce the chest and abdomen of the pupa, and use a microinjector to inject the dsRNA solution into the pupa; 9) Constant temperature culture: After being soaked for 48 hours, dry the pupae with filter paper and continue to culture. Place the injected pupae on 2.5% agarose gel and continue to culture.

[0007] As a preferred option, white The mutation of the gene that causes the white eyes of insects was first discovered by Morgan in Drosophila melanogaster. Drosophila melanogaster ) was found in the wild, and the white protein it encodes is the first ABC transporter to be comprehensively studied in arthropods, and is used as a representative gene for gene silencing in many insects; laccase2 The gene is essential for the normal hardening of the insect cuticle. Mutations in this gene may cause softening and wrinkling of the pupal cuticle or even pupa deformity and adult deformity. It is also a good characterization gene.

[0008] Preferably, in step 4), abnormal pupae, such as those with deformities, those with early or late development, and those with too small a body size, are manually removed, thereby avoiding some deaths and experimental errors.

[0009] Preferably, in step 4), the normal Trichogramma pupae are sequentially arranged in a sideways position to facilitate the injection.

[0010] Preferably, in step 5), artificial eggs are used for subsequent culture to increase the survival rate of Trichogramma pupae after treatment by the immersion method.

[0011] In step 6), the capillary glass tube is obtained by pulling with a P-2000 micropipette needle puller, and the needle tip is processed with a BV-10 needle grinder so that the needle tip has a certain tilt angle to facilitate puncture.

[0012] Preferably, exposing the dissected Trichogramma pupae to air for 1 hour before soaking in step 7) is more conducive to their absorption of the dsRNA solution, which helps to improve the silencing efficiency of the soaking method.

[0013] As a preferred solution, soaking for 48 hours in step 7) has a higher silencing efficiency.

[0014] More specifically, in step 8), a 1 ml syringe is used to connect the needle and the injection needle, and the connection port is sealed with a sealing film to more conveniently draw out the dsRNA mixture.

[0015] Preferably, in step 8), the injection position is at the junction of the thorax and abdomen of the pupa, which can make it easier to penetrate into the interior of the pupa and can greatly improve the injection survival rate.

[0016] As a preferred solution, in step 8), storing the trichogrammatid pupae in 2.5% agarose can ensure that the trichogrammatid pupae will not lose water and shrivel up, and can fix the trichogrammatids during the injection process, making the injection convenient. At the same time, after the injection, the trichogrammatid pupae can be cultured therein until they emerge.

[0017] In a specific embodiment, preferably, in step 9), the Trichogramma pupae are placed in an artificial climate incubator with a temperature of 25±1°C, a relative humidity of 75±5%, and L:D=16:8 for cultivation until they emerge.

[0018] The positive effects of the present invention are: disclosing high-efficiency gene silencing of different species of trichogrammatids; by determining the optimal dehydration and immersion time of immersion and the optimal injection position of the injection method, and using 2.5% agarose as the injection matrix and subsequent culture environment, the immersion survival rate, injection survival rate and silencing efficiency are significantly improved. The optimal dsRNA concentration is determined, and the gene silencing efficiency of trichogrammatids is significantly improved, and the silencing efficiency can reach up to about 80%. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is Trichogramma ostriniae in Example 1 of the present invention laccase2 The sequence of the gene and the location of the primers; Figure 2 It is Trichogramma ostriniae in Example 1 of the present invention laccase2 Agarose gel electrophoresis of dsRNA of the gene; Figure 3 In Example 1 of the present invention laccase2 The expression of genes in different stages of Trichogramma ostriniae; Figure 4 The effect of the immersion method in Example 1 of the present invention on the survival rate of Trichogramma ostriniae at different stages; Figure 5 The corn borer Trichogramma ostriniae treated with different concentrations of dsRNA in Example 1 of the present invention laccase2 Gene expression profile; Figure 6 In Example 1 of the present invention, Trichogramma ostriniae laccase2 Phenotypic diagram after gene silencing; Figure 7 It is the pine caterpillar trichogramma in Example 2 of the present invention white The sequence of the gene and the location of the primers; Figure 8 It is the pine caterpillar trichogramma in Example 2 of the present invention white Agarose gel electrophoresis of dsRNA of the gene; Fig. 9 The expression of the white gene in Example 2 of the present invention in each stage of the pine caterpillar trichogrammatid; Fig.10 The pine caterpillar trichogramma was treated with different concentrations of dsRNA in Example 2 of the present invention. white Gene expression profile; Fig.11 In Example 2 of the present invention, the pine caterpillar trichogrammatid was white Phenotypic diagram after gene silencing. DETAILED DESCRIPTION

[0020] The following examples are used to illustrate the present invention, but they are not intended to limit the scope of the present invention. Example 1

[0021] This example uses the immersion method to kill Trichogramma ostriniae laccase2 Gene silencing methods are as follows 1. Select target gene Trichogrammatus ostriniae was obtained from corn borer egg masses in corn fields in Jiaohe City, Jilin Province in 2020; Corn borer eggs: The experimental population of corn borer was purchased from the Institute of Zoology, Chinese Academy of Sciences; Trichogramma ostriniae laccase2 Gene sequence, specific sequence such as Figure 1 , design primers, the specific steps are as follows: qPCR primers were designed using the website (https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl); dsRNA primers were designed to isolate Trichogramma ostriniae laccase2 The gene duplication product was selected to be between 400 and 800 bp in length, and then the T7 promoter sequence TAATACGACTCACTATAGGG was added to the 5' end of the upstream and downstream primers, respectively. The specific primer sequences are shown in Table 1.

[0022] Table 1 laccase2 Primers used in gene dsRNA primer synthesis and fluorescence quantitative PCR

[0023] two, laccase2 Synthesis of dsRNA of different concentrations The cDNA of the 6th day of the pupal stage of Trichogramma ostriniae was used as a template and amplified under the following reaction system and reaction program. PCR reaction system: 2x Mix 25μL, 1μL of upstream primer and downstream primer (10 μmol / L), 2μL of cDNA template, and ddH2O was used to make up to a total volume of 50μL. PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56.5℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; finally 72℃ extension for 30 s. After the amplification reaction was completed, all amplified products were detected by electrophoresis on 1.5% agarose gel, and the fragments with the same size as the expected target band were recovered and purified. 10μL was taken and commissioned to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. After verifying the sequence, the T7 RNA Transcription Kit was used for subsequent dsRNA synthesis.

[0024] Use a sterilized RNA-specific PCR tube, follow the instructions of the T7 RNA Transcription Kit, add 1 μL of T7 RNA Polymerase, 1 μL of RNase Inhibitor, 5 μL of 10×Transcription Buffer, 8 μL of NTPMix, add 1 μg of linear template DNA with a promoter, and make up to a total volume of 50 μL with RNAase-free water. Gently mix the reaction solution, incubate at 37°C for 2 h, place at room temperature for 10 min, and slowly cool to form dsRNA; then use chloroform extraction and ethanol precipitation: add an equal volume of phenol / chloroform mixture for extraction; extract twice with chloroform; precipitate dsRNA with twice the volume of anhydrous ethanol; wash the dsRNA precipitate twice with 70% ethanol; resuspend the precipitate with Nuclease-free H2O, dissolve the dsRNA, and perform electrophoresis on 1% agarose gel for dsRNA detection. The results are as follows: Figure 2 Before use, the concentration was determined by Nanodrop, and dsRNA solutions of different concentrations were diluted to the final concentration using RNase-free water.

[0025] three, laccase2 Spatial expression of genes in different stages of Trichogramma ostriniae Fresh corn borer eggs were parasitized with Trichogrammatis ostriniae at a ratio of 6:1, and samples were collected from 9 developmental stages, including egg stage (1 day after parasitism), larval stage (2 days after parasitism), prepupal stage (4 days after parasitism), prepupal stage (5 days after parasitism), pupal stage (6 days after parasitism), pupal stage (7 days after parasitism), pupal stage (8 days after parasitism), pupal stage (9 days after parasitism), and adult bees (collected after bees emerged), with three biological replicates in each period. Total RNA of Trichogrammatis ostriniae was extracted using the Biomarker Micro Cell / Tissue Total RNAlsolation Kit according to the instructions, and the purity and concentration of total RNA were detected by agarose gel electrophoresis and Nanodrop 2000 UV spectrophotometer.

[0026] The cDNA synthesis operation is as follows: prepare 20 μL of mixed solution (4 μL of 5×TRUE RT MasterMix, 1 μL of gDNA Remover, 1 μg of total RNA from Trichogramma at different stages, and finally add RNase Free ddH2O to 20 μL) in a microcentrifuge tube, and gently mix with a pipette; incubate the mixture at 42°C for 15 min, then place it at 85°C for 5 sec; finally store it at -20°C.

[0027] The SGExcel FastSYBR qPCR kit was used for fluorescence quantitative PCR reaction: the reaction procedure was: 20 μL reaction system: 2×SGExcel FastSYBR Mixture 10 μL, 10 μmol / L upstream and downstream primers 0.4 μL each, cDNA template 1 μL, RNAse-Free ddH2O 8.2 μL. The sequences of the primers qlaccase2 and the amplification primers of the internal reference gene GADPH used in the fluorescence quantitative PCR amplification used in the experiment are shown in Table 1: RT-PCR reaction procedure: 95℃ pre-denaturation for 5 min; followed by 95 denaturation for 5s, 60℃ annealing for 20 s, and 40 cycles. Three biological replicates were set for each treatment, and qTOWER 3 G fluorescence quantitative PCR instrument test results Figure 3 .

[0028] 4. Preparation of artificial eggs Cut a piece of Bemis PM-996 sealing film and use the round end of a 3.5mm diameter round-headed brush to press out nine hemispherical protrusions with a diameter of 3.5mm and a height of about 3mm on a 96-well PCR plate. Irradiate with UV light for 30 minutes under a clean bench and set aside.

[0029] 5. Soaking treatment The corn borer pupae were dissected using a stereoscope, and 30 prepupae on the 4th and 5th day and pupae on the 6th, 7th and 8th day of development of the corn borer were selected and placed in an artificial egg. Three artificial eggs were repeated as a group, and three groups of repetitions were set up. Then, 1 μL of ddH2O and 500 ng / μL of dsGFP were used to soak them for 48 h, and then the excess liquid was absorbed with filter paper strips. The survival rate of the corn borer pupae was counted on the 10th day. The results are as follows: Figure 4 .

[0030] The corn borer pupae were dissected using a stereoscope, and 30 corn borer pupae with the same developmental stage that had been parasitized in corn borer eggs for 6 days were placed in an artificial egg. The test corn borer Trichogrammatis were divided into two groups. After being exposed to the air for 1 h, the treatment group was immersed in dsRNA solution and 1 μL of dsRNA solutions of different concentrations (100, 300, 500, 1000, 1500, 2000 ng / μL) was added and immersed for 48 h, and the control group was immersed in 500 ng / μL dsGFP solution; three replicates were set for each treatment group, and 90 corn borer pupae were treated in each replicate.

[0031] 6. Constant temperature culture After all the soaking is completed, mark them and place the corn borer trichogrammatid pupae in an artificial climate incubator at 25±1℃, relative humidity: 75±5%, L:D=16:8 for cultivation.

[0032] 7. Silence Efficiency Statistics Trichogrammatids of corn borers were collected 48 h after immersion treatment, RNA was extracted, and the template RNA was quantified at 1 mg for reverse transcription, and then the quantitative reaction was performed using the kit SGExcel FastSYBR qPCR. The reaction procedure was: 20 μL reaction system: 2×SGExcel FastSYBR Mixture 10 μL, 10 μmol / L upstream and downstream primers 0.4 μL each, cDNA template 1 μL, RNAse Free ddH2O 8.2 μL. The reaction procedure of qRT PCR was: 95℃ pre-denaturation for 5 min; followed by 95 denaturation for 5 s, 60℃ annealing for 20 s, and 40 cycles. Three biological replicates were set for each treatment, and qTOWER was used to analyze the quantitative reaction. 3 G fluorescence quantitative PCR instrument was used for detection.

[0033] After the reaction is completed, the fluorescence quantitative PCR results are exported to the Excel program for calculation. -ΔΔCt The expression levels of target genes under treatment with different concentrations of dsRNA were calculated.

[0034] 8. Results and Analysis The survival rates of Trichogrammatus ostriniae at different stages after immersion for 48 h were statistically analyzed. Figure 5 The results showed that immersion for 48 h resulted in 70% mortality of Trichogrammatidae prepupae 6 days after parasitism.

[0035] Trichogrammatids of Ostrinia furnacalis were collected 48 h after immersion treatment, RNA was extracted, reverse transcribed into cDNA, and qPCR was used to verify the efficiency of target gene silencing. Figure 5 At 1500 ng / μL and 2000 ng / μL, gene expression decreased by 70.46% and 72.17%, respectively. The higher the concentration, the more stable the silencing effect. At 300, 500, and 1000 ng / μL, gene expression decreased by 18.07%, 32.04%, and 57.23%, respectively. Figure 6 Shown, silence laccase2 The pupae of the corn borer trichogrammatid were genetically modified to show shrinkage and softening of the epidermis. Example 2

[0036] This example uses injection to kill Trichogramma dendrolimus white Gene silencing methods are as follows: 1. Select target gene The pine caterpillar trichogrammatid was obtained from the egg masses of Chilo suppressalis collected in the rice experimental field of Jilin Province in 2010; the silkworm eggs: obtained in Yongji County, Jilin Province in 2024, the variety was Dahua bisexual autumn silkworm cocoons, and stored in the 2-4℃ cold storage of the Institute of Biological Control of Jilin Agricultural University. white The specific gene sequence is Figure 7 , design primers, the specific steps are the same as Example 1, and the specific primer sequences are shown in Table 2.

[0037] Table 2 white Primers used in gene dsRNA primer synthesis and fluorescence quantitative PCR

[0038] two, white Synthesis of dsRNA of different concentrations The cDNA of the 8th day of the pupal stage of Trichogramma dendrolimi was used as a template and amplified under the following reaction system and reaction procedure. PCR reaction system: 2xMix 25μL, 1μL of upstream primer and downstream primer (10 μmol / L), 2μL of cDNA template, and ddH2O was used to make up to a total volume of 50μL. PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, and 35 cycles. After the amplification reaction was completed, all amplified products were detected by electrophoresis on 1.5% agarose gel, and the fragments with the same size as the expected target band were recovered and purified, and 10μL was taken and commissioned to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. After verifying the sequence, the T7 RNA Transcription Kit was used for subsequent dsRNA synthesis and the dsRNA was detected by electrophoresis on 1% agarose gel. The specific synthesis steps were the same as in Example 1, and the results were as follows Figure 8 .

[0039] three, white Spatial expression of genes in different stages of Trichogramma dendrolimi Pine caterpillar trichogrammatid: fresh tussah eggs were parasitized with pine caterpillar trichogrammatid in a ratio of 1:1, and samples were collected from 10 developmental stages, including egg stage (1 day after parasitism), larval stage (3 days after parasitism), prepupal stage (5 days after parasitism), prepupal stage (6 days after parasitism), pupa stage (7 days after parasitism), pupa stage (8 days after parasitism), pupa stage (9 days after parasitism), pupa stage (10 days after parasitism), pupa stage (11 days after parasitism), and bee, with three biological replicates in each period. Total RNA of pine caterpillar trichogrammatid was extracted using Biomarker Micro Cell / Tissue Total RNAlsolation Kit according to the instruction manual, and the purity and concentration of total RNA were finally detected by agarose gel electrophoresis and Nanodrop 2000 UV spectrophotometer; cDNA synthesis operation was the same as Example 1.

[0040] The SGExcel FastSYBR qPCR kit was used for fluorescence quantitative PCR reaction. The reaction procedure was as follows: 20 μL reaction system: 2×SGExcel FastSYBR Mixture 10 μL, 10 μmol / L upstream and downstream primers 0.4 μL each, cDNA template 1 μL, RNAse-Free ddH2O 8.2 μL. The sequences of the primers qwhite and the amplification primers of the internal reference gene GAPDH used in the fluorescence quantitative PCR amplification used in the experiment are shown in Table 2. The reaction procedure of RT-PCR was as follows: 95℃ pre-denaturation for 5 min; followed by 95 denaturation for 5 s, 60℃ annealing for 20 s, and 40 cycles. Three biological replicates were set for each treatment, and qTOWER 3 G fluorescence quantitative PCR instrument was used for detection, and the results are shown in Fig. 9 .

[0041] 4. Preparation of needle tube A P-2000 laser microelectrode needle puller was used to pull a borosilicate glass tube with an outer diameter of 1 mm into an injection needle under the parameters of HEAT: 350, FIL: 4, VEL: 50, DEL: 225, and PUL: 150, and the needle was processed using a BV-10 needle grinder to give the needle a certain inclination angle.

[0042] 5. Injection treatment The 5th day pre-pupae and 8th day pupae of Trichogrammatidae bred from tussah eggs were dissected using a stereoscope, and the damaged pupae and those that developed too fast or too slowly were removed. Then, a syringe connected to a needle was used to draw 1 μL of ddH2O and 500 ng / μL of dsGFP. The pupae were then injected using a microinjector (PV-850, WPI) at an injection pressure of 10.0 PSI and a maintenance pressure of 0.10 PSI. A total of 60 pupae were injected in each treatment group, and three replicates were set for each treatment group. The survival rate of Trichogrammatidae pupae was counted on the 12th day.

[0043] The test insects used were Trichogrammatid pupae of pine caterpillars that had been parasitizing in tussah eggs for 6 days. 80 pupae with the same developmental stage were dissected under a stereomicroscope and arranged in sequence and placed in 2.5% agarose gel. Then, about 15 nL of dsRNA solutions of different concentrations (100, 300, 500, 1000, 1500, and 2000 ng / μL) were injected into the prepupae and pupae of Trichogrammatids using a syringe, and about 15 nL of 500 ng / μL dsGFP solution was injected into the control group. Three replicates were set for each treatment group, and 80 pine caterpillar Trichogrammatids were treated in each replicate.

[0044] 6. Constant temperature culture After all the injections are completed, mark them and place the pine caterpillar trichogrammatid pupae in an artificial climate incubator at 25±1℃, relative humidity: 75±5%, L:D=16:8 for cultivation.

[0045] 7. Silence Efficiency Statistics The pine caterpillars and trichogrammatids were collected 48 hours after immersion treatment, and RNA was extracted respectively. The template RNA was quantified at 1 mg for reverse transcription, and then the quantitative reaction was performed using the kit SGExcel FastSYBR qPCR. The reaction procedure was: 20 μL reaction system: 2×SGExcel FastSYBR Mixture 10 μL, 10 μmol / L upstream and downstream primers 0.4 μL each, cDNA template 1 μL, RNAse Free ddH2O 8.2 μL. The reaction procedure of qRT PCR was: 95℃ pre-denaturation for 5 min; followed by 95 denaturation for 5 s, 60℃ annealing for 20 s, and 40 cycles. Three biological replicates were set for each treatment, and the fluorescence qTOWER 3 G quantitative PCR instrument for detection.

[0046] After the reaction is completed, the fluorescence quantitative PCR results are exported to the Excel program for calculation. -ΔΔCt The expression levels of target genes under treatment with different concentrations of dsRNA were calculated.

[0047] 8. Results and Analysis The survival rates of Trichogramma dendrobii at different stages 48 h after injection were statistically analyzed. The results are shown in Table 3. It shows that the survival rates of Trichogramma dendrobii pupae at 5 and 8 days after parasitism 48 h after injection were 37.22% and 68.2%, respectively.

[0048] Table 3. Effect of injection method on the survival rate of Trichogramma dendrolimi

[0049] The pine caterpillar trichogrammatids were collected 48 hours after injection, and RNA was extracted and reverse transcribed into cDNA. qPCR was then used to verify the efficiency of target gene silencing. Fig.10 , after interference white The silencing efficiency of the gene expression at 100 ng / μL was 57.46%; at concentrations of 300, 500, 1000, 1500, and 2000 ng / μL, the gene expression decreased by 54.85%, 76.6%, 73.63%, 77.34%, and 84.92%, respectively. Fig.11 As shown, white After gene silencing, the pigmentation of the eyes of the pine caterpillar trichogrammatid was significantly reduced.

Claims

1. A method for constructing a Trichogramma gene silencing system, comprising the following steps: 1) Select target genes: Screen out Trichogramma ostriniae laccase2 Trichogramma dendrolimus white Gene; the gene sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2 respectively; 2) Preparation of dsRNA solutions of different concentrations: Based on the laccase2 Gene, Trichogramma dendrolimus white The sequence design of the gene and the synthesis of dsRNA were performed, and dsRNA solutions of different concentrations were diluted to the final concentration using RNase-free water; 3) Determine the spatial expression of genes: sample Trichogramma bees at different stages and use fluorescent quantitative PCR to determine the specific period of gene expression; select bee pupae: dissect Trichogramma pupae under a stereo microscope and select pupae with consistent development; 5) Preparation of artificial eggs: Use Bemis PM-996 sealing film and press the hemispherical protrusion with the round end of a stick brush; 6) Preparation of needle tube: The capillary glass needle tube made of borosilicate is pulled into an injection needle tube using a needle puller; 7) Soaking treatment: Place the dissected trichogrammatid pupae of the same developmental period in artificial eggs and add 1 μl of dsRNA solutions of different concentrations; 8) Injection treatment: Use a syringe to suck the dsRNA solution into the needle, use the needle to gently pierce the chest and abdomen of the pupa, and use a microinjector to inject the dsRNA solution into the pupa; 9) Constant temperature culture: After being soaked for 48 hours, dry the pupae with filter paper and continue to culture. Place the injected pupae on 2.5% agarose gel and continue to culture.

2. The method for constructing a Trichogramma gene silencing system according to claim 1, characterized in that: In step 4), abnormal pupae such as those with deformities, those that develop too early or too late, and those that are too small are removed manually; normal Trichogramma pupae are placed in a sideways position to facilitate injection.

3. The method for constructing a Trichogramma gene silencing system according to claim 1, characterized in that: In step 5), artificial eggs are used for subsequent culture to increase the survival rate of Trichogramma pupae after treatment by the immersion method.

4. The method for constructing a Trichogramma gene silencing system according to claim 1, characterized in that: In step 6), the capillary glass tube is pulled by a P-2000 micropipette needle puller, and the needle is processed by a BV-10 needle grinder to give the needle a tilt angle.

5. The method for constructing a Trichogramma gene silencing system according to claim 1, characterized in that: Exposing the dissected trichogrammatid pupae to air for 1 hour before soaking in step 7) is more conducive to their absorption of the dsRNA solution and helps to improve the silencing efficiency of the soaking method. Soaking for 48 hours has a higher silencing efficiency.

6. The method for constructing a Trichogramma gene silencing system according to claim 1, characterized in that: In step 8), a 1 ml syringe is used to connect the needle and the injection needle, and the connection port is sealed with a sealing film to more conveniently absorb the dsRNA mixture; the injection position is at the connection between the chest and abdomen of the pupa; the trichogrammatid pupae are stored in 2.5% agarose to ensure that the trichogrammatid pupae do not lose water and shrink, and the trichogrammatids can be fixed during the injection process and cultured in it until they emerge.

7. The method for constructing a Trichogramma gene silencing system according to claim 1, characterized in that: In step 9), the trichogrammatid pupae are placed in an artificial climate incubator with a temperature of 25±1°C, a relative humidity of 75±5%, and L:D=16:8 for cultivation until they emerge.

Images