A method for screening Pacific oysters susceptible to methylmercury and its application

Abstract

The present invention provides a method for screening Pacific oysters susceptible to methylmercury and its application, that is, to detect methylmercury by detecting whether there are Pacific oysters with SNP sites that are sensitive to methylmercury, and using the screened Pacific oysters as marker organisms. The SNP site is located on the accTyr gene, which is located at the 168th position of the SEQ ID NO:1 sequence, and is a T / A substitution. The present invention screened and obtained the SNP site of Pacific oysters susceptible to mercury ion concentration. By screening Pacific oyster individuals with the genotype of AA at the SNP site, they are highly sensitive to changes in mercury content and will cause a large number of deaths at low mercury concentrations. They can be used as methylmercury biomarkers to monitor the content of methylmercury in water bodies.

Description

Technical Field

[0001] The invention belongs to the field of environmental detection marker biotechnology, and mainly relates to a method for screening Pacific oysters susceptible to methylmercury and an application thereof in detecting methylmercury. Background Art

[0002] Mercury is a highly toxic pollutant in the fishery ecological environment. Domestic environmental quality standards all list mercury as an indicator that must be controlled. Mercury in shellfish tissues is easily combined with sulfhydryl groups in proteins, so it mostly exists in the form of methylmercury. Methylmercury is a fat-soluble compound and the main form of mercury that is most harmful to the human body. Domestic research results on methylmercury in fish show that the methylmercury content in marine mollusks accounts for 42.1% to 61.6% of the total mercury content, fish accounts for 66.2% to 91.5%, and aquatic products (including marine and freshwater fish and shellfish) account for 20% to 94.99%.

[0003] At present, the detection of methylmercury is mainly based on gas chromatography (GB 5009.17-2021) and inductively coupled plasma mass spectrometry (ICP-MS). The sample pretreatment process of gas chromatography is complicated, and the derivatization step is difficult to master. The instrument of inductively coupled plasma mass spectrometry (ICP-MS) is expensive, and it is still difficult to promote it comprehensively.

[0004] Environmental markers are signals that indicate the harmful effects of environmental pollutants. They characterize the biochemical, cellular, physiological, behavioral or energetic changes in exposure and effects to one or more chemical pollutants by measuring body fluids, tissues or entire organisms. They are divided into exposure markers, effect markers and sensitivity markers. Environmental markers have specific environmental biomarkers for exposure to specific organic pollution or heavy metals, so they can diagnose the pollution status, and can provide early warnings of pollution exposure and toxic effects through the molecular level interaction between pollutants and organisms. They can also predict the long-term effects of pollutants through short-term changes in environmental biomarkers. Miscanthus, cypress and various alkali sedges can indicate soil changes. Miscanthus indicates acidic soil, cypress is an indicator plant for calcareous soil, various alkali sedges can indicate strongly salinized soil, Elsholtzia maris is an indicator plant for copper veins, and pikas are regarded by researchers as one of the indicators for observing global warming.

[0005] Among aquaculture animals, crayfish and mussels have been used as indicator organisms for water quality. Their health status and number can reflect whether the water is polluted and the degree of pollution. Aquatic insects such as mayflies, stoneflies, and caddisflies have different adaptability to water pollution, so their survival indicates the degree of water quality change.

[0006] Methylmercury pollution of water is a serious environmental problem with far-reaching and complex impacts. Methylmercury can dissolve in water and accumulate in the bodies of aquatic organisms. This accumulation is amplified step by step through the food chain, eventually causing the concentration of methylmercury in organisms at the top of the food chain (such as large fish, seals, etc.) to be much higher than the concentration in water, and can even reach tens of thousands to hundreds of thousands times. Methylmercury pollution causes excessive mercury content in aquatic organisms, affecting the normal physiological functions of the organisms, and even causing the death of the organisms, destroying the ecological balance. After humans eat fish and other aquatic products contaminated with methylmercury, they may suffer from methylmercury poisoning, and experience symptoms such as neurasthenia, mental disorders, tremors, ataxia, and in severe cases, death. It is more convenient and efficient to detect changes in methylmercury in water bodies through environmental markers.

[0007] Pacific oysters (Crassostrea gigas) are a general term for mollusks of the order Pectinata and family Ostrea. They have delicious meat and are rich in nutrition. They are also the world's largest farmed shellfish and are a worldwide widespread group, distributed in tropical, subtropical and temperate seas. Therefore, they can be used as an indicator organism to indicate the content of methylmercury in seawater. Summary of the invention

[0008] The invention provides a method for screening Pacific oysters susceptible to methylmercury and an application thereof in detecting methylmercury, namely, detecting methylmercury by using the screened Pacific oysters as marker organisms based on whether there are Pacific oysters with SNP sites that are sensitive to methylmercury.

[0009] The present invention first provides an application of the accTyr gene, which is to be used as an indicator gene to detect the methylmercury content in Pacific oysters.

[0010] The present invention also provides a SNP site of Pacific oyster that is sensitive to mercury ion concentration. The SNP site is located on the accTyr gene, is located at the 168th position of the SEQ ID NO: 1 sequence, and is a T / A substitution.

[0011] The present invention also provides a method for detecting the above-mentioned SNP site, which is detected by PCR amplification sequencing method;

[0012] The method described herein, wherein a specific primer pair used in PCR amplification sequencing has the following sequence information:

[0013] Upstream primer: F: 5′-CGCGATTTCGTCTGCTTGAG-3′ (SEQ ID NO: 2),

[0014] Downstream primer: R: 5′-TGACCGATCATGTACGTGTGT-3′ (SEQ ID NO: 3).

[0015] In yet another aspect, the present invention provides a method for screening Pacific oysters that are sensitive to mercury ion concentrations, wherein the method is to screen Pacific oyster individuals having the specific genotype of the above-mentioned SNP site.

[0016] The individual of the specific genotype is an individual of AA type;

[0017] The present invention also provides an application of the screened Pacific oysters that are sensitive to mercury ion concentration, which is an application as a biological indicator to detect the mercury content in the water environment;

[0018] The present invention also provides a method for monitoring mercury content in a water environment, which uses the screened Pacific oysters as biological indicators to monitor changes in mercury content in the water.

[0019] The present invention screened and obtained SNP sites of Pacific oysters that are susceptible to mercury ion concentrations. By screening Pacific oyster individuals with an AA genotype at the SNP site, it was found that the Pacific oysters are highly sensitive to changes in mercury content and will cause a large number of deaths under low mercury concentrations. The Pacific oysters can be used as methylmercury biomarkers to monitor the methylmercury content in water bodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 :The curve of total mercury content in Pacific oysters;

[0021] Figure 2 : Changes in methylmercury content in Pacific oysters;

[0022] Figure 3 :Chart of changes in methylmercury and acc1 gene in Pacific oysters;

[0023] Figure 4 : Screened SNP polypeptide loci associated with mercury sensitivity in Pacific oysters;

[0024] Figure 5 : Diagram of mortality of Pacific oysters in sensitive and common groups under low concentration mercury stress. DETAILED DESCRIPTION

[0025] The inventors studied the accumulation and metabolism of inorganic mercury in Pacific oysters in the detection of methylmercury content in oysters and found that HgCl 2 Under stress (no sediment involved, no methylmercury detected in seawater, no light), high levels of methylmercury appeared in shellfish tissues, suggesting that the process of mercury methylation in shellfish, that is, the production of methylmercury in oysters is the product of mercury metabolism in shellfish. 2+Specific genes for mercury methylation were screened and identified in the double-box kinetic experiment. The dose-effect relationship between gene expression and methylmercury was used to screen out SNP sites associated with methylmercury sensitivity. The SNP sites can be used to screen Pacific oyster individuals sensitive to methylmercury and use them as bioindicators to monitor changes in mercury content in water bodies.

[0026] The present invention is described in detail below in conjunction with embodiments and drawings.

[0027] Example 1: Changes of mercury in Pacific oysters

[0028] The experiment was divided into an enrichment phase and a drainage phase. During the enrichment phase, the drug solution was replaced once at 10:00 a.m. every day, and Chlorella was fed once at 8:00 a.m. and 17:00 p.m. every day (algae density was 2×10 5 cell / mL). On days 0, 5, 10, 15, 20, 25, 30, and 35 of the enrichment phase, three oysters were randomly selected from each tank, washed with deionized water, shelled, and all tissues were taken, homogenized for 3-5 minutes, and frozen at -20°C for analysis. On days 30 of the discharge phase, the oysters were placed in natural seawater, and the feeding and water changes were the same as those in the enrichment phase. On days 0, 5, 10, 15, 20, 25, and 30 of the discharge phase, three live shellfish were randomly selected from each tank, shelled, and all tissues were taken, homogenized for 3-5 minutes, and frozen for analysis of total mercury, methylmercury content, and gene expression levels related to mercury and methylation. The amount of feed during the experiment decreased according to the number of oysters remaining in the tank.

[0029] The experimental design consisted of 4 experimental groups and 1 blank group, with 3 parallels. 100 oysters were placed in each group at the beginning of the experiment. Dead oysters were picked out in time during the experiment and recorded. The concentrations, heavy metal categories and detection methods of each group of experimental designs are detailed in Table 1.

[0030] Table 1: Experimental design table

[0031]

[0032] From Table 2, C Amax (Total mercury content in oysters at equilibrium point) group data show that the C of mercury in oysters in the group with 0.0002 mg / L added to water Amax (Total mercury content in oysters at equilibrium point) is 6267 mg / kg, far greater than the national standard (GB18406.4-2001) safety limit (0.3 mg / kg), and the C of methylmercury AmaxThe total mercury content in the water was 864 mg / kg, which is also greater than the standard limit (NY5073-2006 limits methylmercury to 0.5 mg / L). The experiment was designed with the total mercury content in the water as the exposure solute, and the Chlorella vulgaris fed did not contain mercury. The total mercury and methylmercury content were detected in the oyster tissue. The production of methylmercury in oysters can be regarded as a product of mercury metabolism in their bodies.

[0033] Table 2: Accumulation and excretion test of total mercury and methylmercury in Pacific oysters

[0034]

[0035] Mercury and methylmercury data table and trend chart from oysters ( Figure 1 and Figure 2 ) can be seen from the data that the oyster's mercury enrichment rate is proportional to the exposure concentration, while the excretion rate in the excretion stage is not closely related to the initial exposure concentration because all groups were placed in natural clean seawater for testing. With the increase of exposure concentration, the oyster's mercury absorption rate and excretion rate showed a gradual downward trend. High-concentration mercury is not easy to excrete after enrichment. After the excretion stage, the mercury concentration in each group was Hg-4>Hg-3>Hg-2>Hg-1>Hg-0, which is consistent with the initial concentration of the experimental design. The Pacific oyster's ability to accumulate heavy metal mercury is higher than its excretion capacity, which is in line with the rule that heavy metals are easy to accumulate but difficult to excrete.

[0036] The enrichment rate of methylmercury in oyster tissues also showed a gradual increase with the increase of mercury concentration in the exposure solution, and the excretion rate was irregular. The time when the methylmercury content in the oysters of the methylmercury experimental group reached the highest point was greater than the enrichment test time of 35 days, indicating that it takes a certain amount of time for mercury to be converted into methylmercury in the oysters.

[0037] Example 2: Detection of the expression of genes related to mercury methylation in Pacific oysters

[0038] Oyster gill tissues were collected at the stress time points and quickly frozen in liquid nitrogen, then transferred to -80℃ for RNA extraction. RNA was extracted using the Trizol method, and the purity and quality of RNA were detected by a micro-spectrophotometer (Nano Photo meter TM, Germany) and agarose gel electrophoresis. cDNA was synthesized using Hi Script III RT Surper Mix for qPCR (Vazyme, China), and primers were designed using Primer 6. qRT-PCR was performed using oyster genes (ID: 29159) as an internal reference to detect the expression of oyster tissue genes before and after acute Hg stress. The qRT-PCR reaction system (20uL) included: 0.4uL of upstream and downstream primers, 2u1 of template cDNA (500ng / uL), 10uL of 2×ChamQ SYBR Color qPCR MasterMix, and 7.2uL of DEPC water. The reaction procedure was: pre-denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s; melting curve: 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. -△△Ct The relative gene expression was calculated.

[0039] Through the detection, it can be seen that under the acute stress of Hg, the expression of oyster genes changes, the expression of some genes is down-regulated, and the expression of some genes is up-regulated. It is speculated that these genes are related to the defense mechanism of oysters. The expression of defense genes is compared with the content of total mercury and methylmercury in oysters. It is found that there is a gene that is positively correlated with the content of methylmercury in oysters, which is named acc1( Figure 3 ).

[0040] The PCR product was sent to a biological company for sequencing and compared with the NCBI Blast, which revealed that the homology with the Pacific oyster Tyr gene (Gene ID: 105324827) was 99.1%, and was named accTyr.

[0041] As shown in Table 3, the gene expression of accTyr also showed a gradual increasing trend with the increase of mercury concentration in the exposure solution. The time when the expression reached the highest point was greater than 35 days in the enrichment test. It was unrelated to the change of mercury concentration in the tissue and was positively correlated with the change of methylmercury concentration.

[0042] Table 3: Detection of total mercury and methylmercury acc1 gene expression in Pacific oysters

[0043]

[0044] Results showed that mercury stress under external conditions would stimulate the expression of accTyr gene, and its expression was positively correlated with the methylmercury content in oysters. The expression of accTyr gene can be used to detect the degree of methylmercury pollution in oysters.

[0045] Example 3: Screening for SNP sites associated with methylmercury on the accTyr gene

[0046] 100 healthy oysters of the same age and size were selected, raised in seawater with a mercury content of 0.002 mg / L, and fed with Chlorella normally. The mortality of the oysters was observed, and the last surviving oysters were used as the tolerance group to construct an oyster tolerance group family.

[0047] The Tiangen Marine Animal Tissue Genomic DNA Extraction Kit was used to extract DNA from the oyster tolerance group and sensitive group. The extraction steps were as follows:

[0048] 1. Live sampling: Cut 30 mg of oyster gills and put them into a 1.5 ml centrifuge tube containing 180 ml tissue lysis buffer SL, and vortex for 15 seconds.

[0049] 2. Add 20 μl of proteinase K solution (20 mg / ml) and vortex to mix thoroughly. Place the lysate in a 55°C water bath for 1-3 hours or until the tissue is completely digested.

[0050] 3. Add 200 μl of binding solution CB, vortex and mix thoroughly immediately, and place at 70°C for 10 minutes.

[0051] 4. After cooling, add 100 mL of isopropanol and mix thoroughly by inverting or vortexing.

[0052] 5. Add the mixture and precipitate from the previous step into an adsorption column AC (the adsorption column is placed in a collection tube), centrifuge at 13,000 rpm for 60 seconds, and discard the waste liquid in the collection tube.

[0053] 6. Add 500ul inhibitor removal solution IR, centrifuge at 12,000rpm for 30 seconds, and discard the waste liquid.

[0054] 7. Add 600ul of washing buffer WB, centrifuge at 12,000rpm for 30 seconds, and discard the waste liquid.

[0055] 8. Add 600 ml of rinse buffer WB, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.

[0056] 9. Place the adsorption column AC back into the empty collection tube and centrifuge at 13,000 rpm for 2 minutes to remove the rinse solution to prevent residual ethanol in the rinse solution from inhibiting downstream reactions.

[0057] 10. Take out the adsorption column AC, put it into a clean centrifuge tube, add 100w elution buffer EB to the middle part of the adsorption membrane (preheat the elution buffer in a 65-70℃ water bath for better effect), leave it at room temperature for 3-5 minutes, and centrifuge it at 12,000rpm for 1 minute. Add the obtained solution back to the centrifugal adsorption column, leave it at room temperature for 2 minutes, and centrifuge it at 12,000rpm for 1 minute.

[0058] 11. Obtain DNA and detect its quality by agarose gel electrophoresis.

[0059] Based on the Pacific oyster Tyr gene (Gene ID: 105324827), primers were designed on its DNA sequence using the primer design software Primer5.0, and the gene sequencing results of the Pacific oysters in the mercury ion sensitive and tolerant groups were analyzed. A SNP site related to the sensitivity of the Pacific oyster was screened out. The genotype frequency and allele frequency of this site were significantly different between the Pacific oyster populations in the mercury ion sensitive and tolerant groups (P<0.05).

[0060] Table 4: Pacific oyster SNP marker site polymorphism information

[0061]

[0062] The SNP site is located at position 168 of SEQ ID NO:1 and is a T / A substitution ( Figure 4 ).

[0063] TAAAGTTTTATTTTAGAAAATAAACAATACACATTATTTAATTCACTAAATAGAAAATTAAGCGTCTTCTCGCGATTTCGTCTGCTTGAGATCAACAATCACCATTTACGGCGAGGCTGGCTGTTCCAATTCCAGGAATGATTATAAATAACATATAGGTATAAACAATTTCACGGTATTACTGCTGTTCAAATTTGGTAACGATGAGTTTGAAATTAACACACGTACATGATCGGTCATCAGAC (SEQ ID NO: 1) The sequence information of the primer pair used to detect the above sequence is as follows:

[0064] Upstream primer: F: 5′-CGCGATTTCGTCTGCTTGAG-3′ (SEQ ID NO: 2),

[0065] Downstream primer: R: 5′-TGACCGATCATGTACGTGTGT-3′ (SEQ ID NO: 3).

[0066] The SNP loci were typed and verified, and three genotypes of TT, AA, and TA were found in the SNP loci, and the AA type was significantly correlated with the sensitive trait.

[0067] Example 4: Application of SNP loci associated with sensitivity to methylmercury in Pacific oysters

[0068] 500 oysters of uniform shape were purchased from a farm in a coastal area. The genomic DNA of each oyster was obtained by non-destructive sampling. The primer pair with the sequence of SEQ ID NO: 2 and SEQ ID NO: 3 was used for detection to screen individuals with the genotype of the SNP site being AA.

[0069] 65 individuals with AA genotype were screened out of the 500 individuals and kept under the same conditions as the other individuals: water temperature at 18-23°C, salinity at 10%-25%, clear water and sufficient light. After 7 days of adaptive feeding, 0.0002 mg / L HgCl was added to each group. 2 , conducted a mercury emergency stress test, and observed and recorded the mortality of the two groups of oysters.

[0070] The mortality of oysters in the sensitive group and the common group within 7 days is shown in Figure 5 The mortality rate of oysters in the common group was 23%, while that in the sensitive group reached 94%, indicating that individuals with a specific genotype screened out using this SNP site are highly sensitive to low concentrations of mercury and are suitable for development and utilization as biomarkers of mercury in seawater.

[0071] In summary, the present invention screened genes related to methylmercury for the first time, and screened SNP sites associated with high mercury sensitivity in Pacific oysters. The primers provided by the present invention were used to detect the SNP sites and screen the genotypes. The Pacific oyster individuals obtained were also very sensitive to low concentrations of mercury and could be used as biological indicator animals, making it easier to monitor changes in mercury ion content in water bodies.

Claims

1. A method for screening Pacific oysters that are sensitive to mercury ion concentrations, characterized in that: The method is to screen individuals with a specific genotype of a SNP site, wherein the SNP site is located at position 168 of the SEQ ID NO:1 sequence and is a T / A substitution; the individuals with the specific genotype are AA-type individuals.

2. The method according to claim 1, characterized in that The screening of individuals with specific genotypes at SNP sites is performed by using PCR amplification sequencing.

3. The method according to claim 2, characterized in that In the PCR amplification sequencing, the upstream primer sequence of the primer pair used is SEQ ID NO: 2, and the downstream primer sequence is SEQ ID NO: 3.

Images