Establishment and application of quadruple RT-RPA detection system for porcine intestinal coronavirus

Abstract

The invention discloses establishment and application of a porcine intestinal coronavirus quadruple RT-RPA (Reverse Transcription-Recombinase Polymerase Amplification) detection system, which comprises the following steps of: comparing N gene sequences of porcine epidemic diarrhea virus (PEDV), porcine delta coronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV) and porcine acute diarrhea syndrome coronavirus (SADS-CoV) to screen out conserved sequences of N genes; the invention relates to a primer composition, a standard substance and application in clinical detection.The primer composition, the standard substance and the application have the advantages that four porcine intestinal coronaviruses including PEDV, PDCoV, TGEV and SADS-CoV can be specifically detected, the detection upper limit is high, the four pathogens can be rapidly and simultaneously detected and diagnosed, and the detection sensitivity is high. And no cross reaction with common viruses infecting pigs, such as porcine reproductive and respiratory tract comprehensive viruses, is generated.

Description

Technical Field

[0001] The present invention relates to the establishment and application of a detection system, and more specifically, to the establishment and application of a porcine enteric coronavirus quadruple RT-RPA detection system, which belongs to the technical field of nucleic acid detection. Background Art

[0002] At present, six different coronaviruses have been identified that can naturally infect pigs, namely: Porcine epidemic diarrhea virus (PEDV), Porcine delta coronavirus (PDCoV), Porcine transmissible gastroenteritis virus (TGEV), Swine acute diarrhea syndrome coronavirus (SADS-CoV), porcine respiratory coronavirus (PRCoV), porcine hemagglutinating encephalomyelitis virus (PHEV). Among the six coronaviruses, TGEV, PEDV, SADS-CoV and PDCoV are the main enteric coronaviruses that cause diarrhea in piglets, causing huge economic losses to the pig industry worldwide. In addition, the above four enteric coronaviruses that can cause diarrhea in piglets have similar clinical symptoms after infection, such as loss of appetite, diarrhea and vomiting, weight loss, lethargy and death. The specific pathogens of infection cannot be distinguished by clinical symptoms alone, so effective detection methods are needed to identify them.

[0003] At present, the diagnostic methods of porcine enteric coronavirus are mainly divided into two categories: virological diagnosis and serological diagnosis. Among them, the detection target of the virological method is the genome of the virus, and the serological diagnosis method mainly diagnoses the antibodies induced by the virus infection of the host. At present, a variety of nucleic acid and protein-based porcine coronavirus identification and analysis methods have been established, among which protein-based methods include enzyme-linked immunosorbent assay (ELISA) and proteomics. However, these methods are time-consuming and labor-intensive, and the detection cost is high. Summary of the invention

[0004] In order to solve the above-mentioned problems of the prior art, the present invention provides the establishment and application of a porcine enteric coronavirus quadruple RT-RPA detection system which has the technical characteristics of being able to specifically detect four porcine enteric coronaviruses, namely PEDV, PDCoV, TGEV and SADS-CoV, having no cross-reaction with common viruses that infect pigs, such as porcine reproductive and respiratory virus, as well as having a high upper limit of detection and being able to rapidly detect and diagnose.

[0005] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0006] A quadruple RT-RPA detection system for porcine enteric coronavirus was established, and the conservative sequence of the N gene was screened out according to the N gene sequence alignment of porcine epidemic diarrhea virus (PEDV), porcine delta coronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV), and porcine acute diarrhea syndrome coronavirus (SADS-CoV), primers were designed and the ratio of each parameter was optimized to obtain the final RPA detection primers to form a quadruple RT-RPA detection system;

[0007] The quadruple RT-RPA detection system includes:

[0008] Sequence of swine acute diarrhea syndrome coronavirus (SADS-CoV) (5′-3′):

[0009] F: ATGCCTAGAAATGGAGTTCCGACAGGTAAA;

[0010] R: CTCAACAACAGTCAGGTCTGGTGGTAATTG;

[0011] Sequence of porcine deltacoronavirus (PDCoV) (5′-3′):

[0012] F:TCAGTTTCGTGGCAATGGAGTTCCGCTTAA;

[0013] R: CGTTTGGCAACATGAGGCTTAATAGAAGTGTCAG;

[0014] Sequence of porcine transmissible gastroenteritis virus (TGEV) (5′-3′):

[0015] F: CCAATAACAAGAAGGATGACAGTGTAGAAC;

[0016] R: CTAGTTCCATAGAATCTTGTCACATCACCT;

[0017] Sequence of porcine epidemic diarrhea virus (PEDV) (5′-3′): F: GTAGCAGGAGTCGTGGTAATGGCAACAACA;

[0018] R: TCTGTTCTTGGACTGGTTACGAGACTTGTTATTGT. The corresponding table of the quadruple RT-RPA detection system is:

[0019]

[0020] Preferably, the ratio of the quadruple RT-RPA detection system is: Buffer A 29.4 μL, primer F / R 2 μL each, test sample 1 μL, Buffer B 2.5 μL, ddH2O 0.1 μL, a total of 50 μL; wherein Buffer B is added last and mixed thoroughly by inverting upside down.

[0021] Preferably, the quadruple RT-RPA detection system design is established after optimizing the incubation temperature and time conditions;

[0022] Among them, the conserved sequences of the N genes of four coronaviruses, SADS-CoV, PEDV, TGEV and PDCoV, were first selected as targets for RPA enzyme amplification and two pairs of primers were designed according to the characteristics of RPA enzyme primers;

[0023] RPA reaction was performed based on the quadruple RT-RPA detection system: the components in the ratio as described in claim 2 were added to the dry powder tube respectively, the reaction system was mixed upside down and centrifuged, and the reaction was carried out at 40°C for 10 to 30 minutes, and at 56°C for 5 minutes to inactivate the enzyme;

[0024] Take 3 μL of the reaction product and perform 3% agarose gel electrophoresis to screen and determine the primer sequence;

[0025] Determine the optimal amplification time and temperature for quadruple RT-RPA detection, and adjust the amplification temperature and time respectively under the optimal primer ratio; wherein, the method for determining the optimal amplification temperature is: amplify the quadruple RT-RPA detection system at 30°C, 35°C, 40°C, 42°C, and 45°C, respectively, and perform 3% agarose gel electrophoresis on the amplified products to determine the optimal amplification temperature; wherein, the method for determining the optimal amplification time is: under the above-determined optimal temperature conditions, set the amplification times of 10min, 15min, 20min, 25min, 30min, and 35min respectively, and perform 3% agarose gel electrophoresis on the amplified products to determine the optimal amplification time of the system;

[0026] Then the specificity analysis and sensitivity analysis of the quadruple RT-RPA detection system were carried out.

[0027] Preferably, the method for sensitivity analysis of the quadruple RT-RPA detection system is:

[0028] The positive templates of the four viruses were mixed in equal proportions and tested by 10-fold gradient dilution. The final concentration of each template was ensured to be: 1.5×10 7 copies / μL, 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL, 3×10 0 The amplified products were subjected to 3% agarose gel electrophoresis to determine the lowest detection limit of the system.

[0029] The invention discloses an application of a porcine enteric coronavirus quadruple RT-RPA detection system, including application in primer compositions, standard products and clinical detection.

[0030] Beneficial effects: It can simultaneously and specifically detect four porcine enteric coronaviruses, PEDV, PDCoV, TGEV and SADS-CoV, and has no cross-reaction with common viruses that infect pigs, such as porcine reproductive and respiratory virus; the upper limit of detection can reach 3×10 5 With the help of nucleic acid gel electrophoresis, the reaction time is only about 25 minutes, which can realize rapid on-site detection and diagnosis in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a diagram showing the specificity verification results of the RT-RPA primers of the present invention.

[0032] Figure 2 This is a diagram of the ratio optimization results of the quadruple RT-RPA detection system of the present invention.

[0033] Figure 3 This is a diagram of the optimization results of the quadruple RT-RPA amplification time of the present invention.

[0034] Figure 4 This is a diagram of the temperature optimization results of the quadruple RT-RPA amplification of the present invention.

[0035] Figure 5 This is one of the results of the quadruple RT-RPA primer specificity verification of the present invention.

[0036] Figure 6This is the second figure of the specificity verification result of the quadruple RT-RPA primers of the present invention.

[0037] Figure 7 This is a graph showing the sensitivity test results of the quadruple RT-RPA test of the present invention. DETAILED DESCRIPTION

[0038] The following is in conjunction with the instruction manual Figure 1-7 , the present invention is further illustrated, but the present invention is not limited to the following embodiments.

[0039] At present, polymerase chain reaction (PCR) is widely used. It has high specificity and accuracy. However, PCR requires thermal cycling devices, additional electrophoresis detection and professional operators. These factors limit the application of PCR technology in clinical practice. Furthermore, in order to achieve rapid detection in clinical sites, a variety of isothermal amplification methods have been established to avoid the need for thermal cycling equipment. Among them, recombinase polymerase amplification (RPA) is a representative amplification technology that is effective under constant temperature (37-42°C) and can complete the reaction within 30 minutes. RPA only requires a pair of primers and uses the recombinase-primer complex to bring the primers into a specific DNA site. RPA can perform multiple RPA (mRPA) amplifications in a single reaction system to achieve simultaneous amplification of multiple coronavirus nucleic acids, and RPA can also be combined with other methods to detect RPA products, such as agarose gel electrophoresis (AGE). The AGE assay is fast and low-cost, so it is more suitable for the detection of RPA amplification products. The present invention combines RPA with AGE to achieve a fast and simple detection method.

[0040] Specifically: The principle of the present invention is to design RPA detection primers by comparing the N gene sequences of four porcine enteric coronaviruses and screening out the conservative sequences of the N gene. After optimizing the incubation temperature and time conditions, a quadruple RT-RPA detection system was established, and the established detection method was verified for specificity, sensitivity, etc. Finally, an RPA detection method that can be used for clinical rapid testing was established, and it involves primer compositions, standard products, and applications in clinical testing.

[0041] like Figure 1-7 The figure shows a specific example of the establishment and application of a porcine enteric coronavirus quadruple RT-RPA detection system, which includes experimental objectives, experimental materials, experimental methods, and experimental results.

[0042] 1. Purpose of the experiment

[0043] Establishment of a porcine enteric coronavirus detection system for preliminary clinical sample testing.

[0044] 2. Experimental Materials

[0045] 2.1 Sources

[0046] The genomes of porcine epidemic diarrhea virus (PEDV), pseudorabies virus (PRV), porcine deltacoronavirus (PDCoV), porcine reproductive and respiratory virus (PRRSV), porcine circovirus type 2 (PCV2), and porcine transmissible gastroenteritis virus (TGEV) were provided by Zhejiang Hongsheng Biotechnology Co., Ltd., and the genome of porcine acute diarrhea syndrome coronavirus (SADS-CoV) was provided by Associate Researcher Yang Yongle of Xianghu Laboratory. 50 porcine intestinal clinical tissue samples, porcine feces or anal swab samples were collected from pigs suspected of being infected with porcine enteric coronavirus in pig farms in Anji, Wenzhou and Jinhua, Zhejiang Province.

[0047] 2.2 Main reagents

[0048] RPA enzyme kit (Anpu Future); restriction endonuclease (Takara); DH5α competent cell (Hangzhou Kaitai Biotechnology Co., Ltd.); T4 ligase (Takara); DNA gel / PCR product cleaning and recovery kit (Novozyme); DNA Marker (Takara); agar (Biowest).

[0049] 3. Test methods

[0050] 3.1 Establishment of positive template

[0051] The N gene sequences of SADS-CoV, PEDV, TGEV, and PDCoV were searched from the NCBI database, and the conservative sequences were screened using the software MEGA7.0. The genes were sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for gene synthesis and connected to the PUC57 vector. The synthesized plasmid was transformed into DH5α competent cells using the heat shock method. The positive colonies were identified as correct by PCR and sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing. The strains with correct sequencing were mixed evenly with 50% glycerol at a ratio of 1:1 and stored at -80°C for a long time.

[0052] 3.2 Design of RPA primers

[0053] Combined with the results of genome comparison analysis, the conserved sequences of the N genes of four coronaviruses, SADS-CoV, PEDV, TGEV and PDCoV, were selected as targets for RPA enzyme amplification and two pairs of primers were designed according to the characteristics of RPA enzyme primers. The primer information is shown in Table 3.1.

[0054] Table 3.1 RT-RPAs ADS-CoV, PDCoV, TGEV, PEDVN gene primer sequences

[0055]

[0056] 3.3 Primer screening

[0057] According to the RPA kit operating instructions, add the following components to the dry powder tube as shown in the table. Mix the reaction system by inverting it upside down and centrifuging it. Incubate it at 42°C for 30 minutes and then inactivate the enzyme at 56°C for 5 minutes. Take 3 μL of the reaction product for 3% agarose gel electrophoresis to screen and determine the primer sequence.

[0058] Table 3.2 RT-RPA reaction system

[0059]

[0060]

[0061] 3.4 Optimization of primer ratios for quadruple RT-RPA

[0062] On the basis of the above, in order to enable the quadruple RT-RPA detection system to effectively detect SADS-CoV, PEDV, TGEV and PDCoV, the primer ratio was optimized and adjusted according to the table, and the final optimization results were observed by 3% agarose gel electrophoresis.

[0063] Table 3.3 Optimization experiment of primer ratios for quadruple RT-RPA

[0064]

[0065] 3.5 Optimization of time and temperature conditions for quadruple RT-RPA assay

[0066] In order to determine the optimal amplification time and temperature for quadruple RT-RPA detection, the amplification temperature and time were adjusted respectively under the optimal primer ratio.

[0067] Determine the optimal amplification temperature: The quadruple RT-RPA detection system was amplified at 30°C, 35°C, 40°C, 42°C, and 45°C, respectively, and the amplified products were subjected to 3% agarose gel electrophoresis to determine the optimal amplification temperature.

[0068] Determine the optimal amplification time: Under the optimal temperature conditions determined above, set the amplification time to 10 min, 15 min, 20 min, 25 min, 30 min and 35 min respectively. Perform 3% agarose gel electrophoresis on the amplified product to determine the optimal amplification time of the system.

[0069] 3.6 Specificity analysis of quadruple RT-RPA assay

[0070] In order to determine the specificity of these four pairs of primers and the mutual interference, quadruple RT-RPA detection was performed using the primer template combinations shown in the table.

[0071] Table 3.4 Specificity of quadruple RT-RPA assay

[0072]

[0073] 3.7 Sensitivity analysis of quadruple RT-RPA assay

[0074] In order to analyze the sensitivity of the established quadruple RT-RPA for detecting SADS-CoV, PEDV, TGEV, and PDCoV, the positive templates of the four viruses were mixed in equal proportions and tested with 10-fold gradient dilutions. The final concentration of each template was 1.5×10 7 copies / μL, 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL, 3×10 0 copies / μL. ddH2O was used as negative control for quadruple RT-RPA reaction. The amplified products were subjected to 3% agarose gel electrophoresis to determine the lowest detection limit of the system.

[0075] 3.8 Clinical sample testing

[0076] 50 samples of pig intestinal tissue, pig feces or anal swab samples were collected clinically, the sample genomes were extracted and intestinal coronavirus tests were performed, and the test results were compared with the fluorescent quantitative PCR test results.

[0077] 4. Experimental Results

[0078] 4.1 Primer screening

[0079] Two pairs of primers for SADS-CoV, PEDV, PDCoV, and TGEV were designed as shown in the table, and RT-RPA amplification was performed based on the positive template. Figure 1As shown: The two pairs of primers for the four viruses can amplify the target bands, but there is a certain difference in the amplification efficiency of different primers. Finally, F2 / R2 (309 bp) of SADS-CoV, F1 / R1 (179 bp) of PEDV, F2 / R2 (261 bp) of PDCoV, and F2 / R2 (213 bp) of TGEV were selected for the establishment of the subsequent system.

[0080] 4.2 Optimization of primer ratios for quadruple RT-RPA detection system

[0081] In order to establish a detection system that can effectively amplify the four viruses, the four pairs of primers were adjusted according to the table. The amplification results are as follows: Figure 2 As shown: the amplification effect of the TGEV primer pair is weak, and the amplification efficiency cannot be improved by increasing the concentration in proportion. The bands in lane 8 are obvious and separated. When SADS-CoV (2000nM), PDCoV (2000nM), TGEV (3000nM), and PEDV (3000nM) were finally selected, the amplification of the four substrates was the most balanced and the bands were the brightest.

[0082] 4.3 Quadruple RT-RPA amplification time and temperature optimization

[0083] In order to further optimize the amplification procedure of the quadruple RT-RPA system, the incubation temperature and incubation time were set to gradients for exploration. Figure 4 As shown in the figure: With the increase of incubation temperature, the concentrations of the four amplification products showed a trend of first increasing and then decreasing. Figure 3 As shown in the figure, with the increase of time, the concentration of amplified products gradually increased and then stabilized. Finally, the incubation temperature of 40℃ and the incubation time of 25min were selected for subsequent experiments.

[0084] 4.4 Quadruple RT-RPA detection of amplification specificity

[0085] Quadruple RT-RPA amplification was performed according to the primer template combination in the table to verify the specificity of the designed primers. Figure 5-6 As shown: 3% agarose gel electrophoresis analysis showed obvious bands at the corresponding positions and no obvious mixed bands, indicating that the four pairs of primers designed did not interfere with each other and had good specificity. The quadruple RT-RPA test can simultaneously detect the single or mixed infection of SADS-CoV, PDCoV, TGEV and PEDV.

[0086] 4.5 Quadruple RT-RPA Assay Sensitivity Analysis

[0087] To further determine the sensitivity of the established quadruple RT-RPA assay, the positive template was diluted 10-fold in sequence under the conditions of optimal incubation time and temperature. Figure 7As shown: The lowest detection concentration is 3×10 5 copies / μL, which is about 10 times more sensitive than the established quadruple RT-PCR.

[0088] 4.6 Clinical sample test results

[0089] 50 samples of pig intestinal tissue, feces or anal swabs were collected from pig farms in Anji, Wenzhou and Jinhua, Zhejiang, and tested using the established quadruple RT-RPA detection system. The results are shown in Table 4.1:

[0090] Table 4.1 Quadruple RT-RPA clinical sample testing

[0091]

[0092]

[0093] in conclusion:

[0094] The present invention successfully constructs a quadruple RT-RPA detection system with a high consistency rate with qPCR, and can be used for preliminary clinical diagnosis.

[0095] Finally, it should be noted that the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. Establishment of a quadruple RT-RPA detection system for porcine enteric coronavirus, characterized in that: Based on the N gene sequence alignment of porcine epidemic diarrhea virus (PEDV), porcine delta coronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV), and porcine acute diarrhea syndrome coronavirus (SADS-CoV), the conservative sequence of the N gene was screened, primers were designed, and the ratio of each parameter was optimized to obtain the final RPA detection primers to form a quadruple RT-RPA detection system; The quadruple RT-RPA detection system includes: Sequence of swine acute diarrhea syndrome coronavirus (SADS-CoV) (5′-3′): F: ATGCCTAGAAATGGAGTTCCGACAGGTAAA; R: CTCAACAACAGTCAGGTCTGGTGGTAATTG; Sequence of porcine deltacoronavirus (PDCoV) (5′-3′): F:TCAGTTTCGTGGCAATGGAGTTCCGCTTAA; R: CGTTTGGCAACATGAGGCTTAATAGAAGTGTCAG; Sequence of porcine transmissible gastroenteritis virus (TGEV) (5′-3′): F: CCAATAACAAGAAGGATGACAGTGTAGAAC; R: CTAGTTCCATAGAATCTTGTCACATCACCT; Sequence of porcine epidemic diarrhea virus (PEDV) (5′-3′): F: GTAGCAGGAGTCGTGGTAATGGCAACAACA; R:TCTGTTTCTGGACTGGTTACGAGACTTGTTATTGT.

2. The establishment of a quadruple RT-RPA detection system for porcine enteric coronavirus according to claim 1, characterized in that: The ratio of the quadruple RT-RPA detection system is: Buffer A 29.4μL, primer F / R 2μL each, test sample 1μL, Buffer B 2.5μL, ddH2O 0.1μL, totaling 50μL; Buffer B was added last and mixed thoroughly by inverting.

3. The establishment of a quadruple RT-RPA detection system for porcine enteric coronavirus according to claim 1, characterized in that: The quadruple RT-RPA detection system design was established after optimizing the incubation temperature and time conditions; Among them, the conserved sequences of the N genes of four coronaviruses, SADS-CoV, PEDV, TGEV and PDCoV, were first selected as targets for RPA enzyme amplification and two pairs of primers were designed according to the characteristics of RPA enzyme primers; RPA reaction was performed based on the quadruple RT-RPA detection system: the components in the ratio as described in claim 2 were added to the dry powder tube respectively, the reaction system was mixed upside down and centrifuged, and the reaction was carried out at 40°C for 10 to 30 minutes, and at 56°C for 5 minutes to inactivate the enzyme; Take 3 μL of the reaction product and perform 3% agarose gel electrophoresis to screen and determine the primer sequence; Determine the optimal amplification time and temperature for quadruple RT-RPA detection, and adjust the amplification temperature and time respectively under the optimal primer ratio; wherein, the method for determining the optimal amplification temperature is: amplify the quadruple RT-RPA detection system at 30°C, 35°C, 40°C, 42°C, and 45°C, respectively, and perform 3% agarose gel electrophoresis on the amplified products to determine the optimal amplification temperature; wherein, the method for determining the optimal amplification time is: under the above-determined optimal temperature conditions, set the amplification times of 10min, 15min, 20min, 25min, 30min, and 35min respectively, and perform 3% agarose gel electrophoresis on the amplified products to determine the optimal amplification time of the system; Then the specificity analysis and sensitivity analysis of the quadruple RT-RPA detection system were carried out.

4. The establishment of a quadruple RT-RPA detection system for porcine enteric coronavirus according to claim 3, characterized in that: Method for sensitivity analysis of quadruple RT-RPA detection system: The positive templates of the four viruses were mixed in equal proportions and tested by 10-fold gradient dilution. The final concentration of each template was ensured to be: 1.5×10 7 copies / μL, 3×10 6 copies / μL, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 1 copies / μL, 3×10 0 The amplified products were subjected to 3% agarose gel electrophoresis to determine the lowest detection limit of the system.

5. The use of a quadruple RT-RPA detection system for porcine enteric coronavirus according to claim 1, characterized in that: Including applications in primer compositions, standards and clinical testing.

Images