A set of nucleic acids, a kit and a detection method for detecting human adenovirus type 55 by ERA-CRISPR / Cas12a method

Abstract

The present invention relates to a set of nucleic acids, a kit and a detection method for detecting human adenovirus type 55 by the ERA-CRISPR / Cas12a method. The set of nucleic acids contains ERA probe HAdv55BP, forward primer F6, reverse primer R5 and CrRNA. The kit contains the set of nucleic acids. The detection method uses the kit. The present invention uses the conserved sequence of the Hexon gene of human adenovirus type 55 as a target, uses the above set of nucleic acids and uses the ERA-CRISPR / Cas12a method to effectively detect human adenovirus type 55, the results are reliable, the cost is relatively low, and it is particularly suitable for on-site or field instant detection.

Description

Technical Field

[0001] The present invention relates to a set of nucleic acids, a kit and a detection method for detecting human adenovirus type 55 by an ERA-CRISPR / Cas12a method. The set of nucleic acids comprises an ERA probe, a primer and a guide RNA (CrRNA) sequence, and belongs to the field of molecular biotechnology. Background Art

[0002] Human adenovirus (HAdV) belongs to the genus Adenovirus of mammals. It is a non-enveloped double-stranded DNA virus. Infection can cause related diseases in the respiratory tract, gastrointestinal tract, and urinary tract, such as pharyngitis, pneumonia, conjunctivitis, cystitis, etc. Adenovirus infection was once prevalent in my country, which had adverse effects on the health of the population, especially adenovirus pneumonia, which accounts for about 20% to 30% of viral pneumonia, and the mortality rate can be as high as 25%. More than 100 serotypes of HAdV have been discovered, divided into 7 subgroups from A to G. Different types of HAdV have different characteristics such as tissue tropism, pathogenicity, and epidemic areas. Among them, human adenovirus type 55 (HAdV-55) is widely prevalent in my country. It belongs to the adenovirus B subgenus. It is a new adenovirus formed by the genetic recombination of adenovirus types 11 and 14. It causes a higher proportion of pneumonia and severe cases. In recent years, large-scale outbreaks have occurred in many places where people gather, such as schools and military camps. For the needs of epidemic prevention and control and clinical diagnosis, establishing an on-site rapid detection method for HAdv-55 has important practical significance and value.

[0003] Enzymatic Recombinase Amplification (ERA) is an isothermal amplification technology developed by Suzhou Xinda Gene Technology Co., Ltd. in China. It uses specific tool enzymes from bacteria, viruses and bacteriophages to transform mutations and screen their functions. It can specifically amplify trace target DNA fragments under low temperature conditions (25℃-42℃). At the optimal temperature of 37℃-42℃, the amplification reaction time can be within 15 minutes. Compared with the LAMP technology of Japan's Rongyan Company, the RPA technology of the British TwistDx Company, and the currently widely used fluorescent quantitative PCR technology, this technology has made major breakthroughs in low temperature adaptability and sensitivity. Combined with the new generation of molecular diagnostic technology-CRISPR / Cas12a, when Cas12a recognizes and cuts the target DNA under the guidance of guide RNA, its "subordinate cutting" activity is activated, and it can arbitrarily and efficiently cut DNA in the system; using reporter DNA labeled with fluorescent groups and quenching groups, CRISPR / Cas12a can detect DNA templates and amplify signals. This feature can be used in the field of molecular diagnosis to detect pathogens. It not only improves the sensitivity of the detection analysis, but also avoids the need for complex and expensive equipment. The technology has now been successfully applied to the detection of human papilloma virus (HPV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0004] At present, the commonly used laboratory detection methods for HAdv-55 include virus isolation, serological antibody detection, antigen detection, molecular biology detection including gene chips, RT-PCR and metagenomic sequencing, but there is no technical means to quickly detect HAdv-55 using ERA combined with CRISPR / Cas12a amplification technology. Summary of the invention

[0005] The main purpose of the present invention is to overcome the problems existing in the prior art and provide a set of nucleic acids for detecting human adenovirus type 55 by the ERA-CRISPR / Cas12a method, taking the conserved sequence of the Hexon gene of human adenovirus type 55 (HAdv-55) as the target gene, which can be used to detect HAdv-55 by the ERA-CRISPR / Cas12a method; at the same time, a kit containing the set of nucleic acids and a corresponding detection method are also provided, which can accurately, quickly and effectively detect HAdv-55.

[0006] The technical solution of the present invention to solve the technical problem is as follows:

[0007] A set of nucleic acids for detecting human adenovirus type 55 by an ERA-CRISPR / Cas12a method, the set of nucleic acids consisting of an ERA probe, a forward primer, a reverse primer and CrRNA; the ERA probe is HAdv55BP, the sequence of which is that the 29th base in SEQ ID NO:1 is labeled with a fluorescent group, the 30th base is replaced with tetrahydrofuran, the 31st base is labeled with a quenching group, and a blocking group is added to the 3' end of SEQ ID NO:1; the forward primer is F6, the sequence of which is SEQ ID NO:9; the reverse primer is R5, the sequence of which is SEQ ID NO:14; the sequence of the CrRNA is SEQ ID NO:3.

[0008] The above-mentioned nucleic acid set can be used to detect human adenovirus type 55 by the ERA-CRISPR / Cas12a method. Experimental studies have shown that the detection limit of this method for HAdv55 positive control can reach 9 copies / reaction, and the detection limit of HAdv55 live strain gene can reach 2.5 copies / reaction.

[0009] Preferably, the fluorescent group is FAM, the quenching group is BHQ, and the blocking group is C3-spacer.

[0010] Preferably, the target gene of the set of nucleic acids is the Hexon gene sequence of human adenovirus type 55, and the Hexon gene sequence is SEQ ID NO:16.

[0011] The above preferred scheme can better realize the detection of human adenovirus type 55 by ERA-CRISPR / Cas12a method.

[0012] The present invention also provides:

[0013] A kit for detecting human adenovirus type 55 using the ERA-CRISPR / Cas12a method, the kit comprising the set of nucleic acids described above; in the kit, the ERA probe, forward primer, reverse primer, and CrRNA of the set of nucleic acids are respectively solutions.

[0014] Preferably, the kit further comprises a fluorescent amplification reagent, a dissolving agent, an activator, ultrapure water, a Cas12a enzyme, a fluorescent reporter, and a positive control; wherein the fluorescent amplification reagent is a lyophilized powder, and the dissolving agent, activator, Cas12a enzyme, fluorescent reporter, and positive control are solutions, respectively.

[0015] More preferably, the preparation process of the positive control is as follows: a plasmid containing a conservative sequence of the Hexon gene is subjected to an in vitro transcription reaction to obtain a Hexon gene RNA fragment, and the positive control is obtained after purification; wherein the conservative sequence of the Hexon gene is shown in SEQ ID NO:16.

[0016] More preferably, the kit adopts a 52.7μl reaction system; each reaction system contains an amplification system and a detection system; the amplification system consists of 20μl solvent, 2.1μl 10μM forward primer, 2.1μl 10μM reverse primer, 0.6μl 10μM fluorescent probe, 22.2μl ultrapure water, 2μl activator, and 1μl nucleic acid sample to be tested; the detection system consists of 1.2μl 10μM Cas12a enzyme, 1μl 10μM CrRNA, and 0.5μl 10μM fluorescent reporter; the fluorescent amplification reagent and solvent are provided by a commercially available basic universal ERA fluorescence kit; the activator is 280mM magnesium acetate solution; the concentration of the positive control is 10ng / μl.

[0017] The above kit can be used to effectively detect human adenovirus type 55 using the ERA-CRISPR / Cas12a method.

[0018] The present invention also provides:

[0019] An ERA-CRISPR / Cas12a detection method for detecting human adenovirus type 55 for non-diagnostic purposes, using the kit described above; the ERA-CRISPR / Cas12a detection method comprises the following steps:

[0020] The first step is to add the solvent, fluorescent probe solution, forward primer solution, reverse primer solution and ultrapure water in the kit to each reaction tube, and mix well to obtain a mixed reaction solution.

[0021] Step 2: Add the fluorescent amplification reagent freeze-dried powder to the mixed reaction solution, shake and mix until the amplification reagent is resuspended, and centrifuge.

[0022] Step 3: Divide the reaction tubes into a sample group and a positive control group; add the nucleic acid sample to be tested into the reaction tube of the sample group, add the positive control into the reaction tube of the positive control group, mix them well and centrifuge them.

[0023] Step 4: Add activator to the cap of each reaction tube, cover the cap tightly, centrifuge to allow the activator to enter the mixed reaction solution, shake to mix and centrifuge again.

[0024] Step 5: Place each reaction tube in a fluorescence thermostatic amplification instrument for ERA amplification.

[0025] Step 6. After the ERA amplification reaction is completed, Cas12a enzyme, CrRNA and fluorescent reporter are added to each reaction tube, and then placed in a fluorescent constant temperature amplification instrument for CRISPR / Cas12a amplification and fluorescence is collected.

[0026] Step 7. After the reaction is completed, the data is saved and a time-fluorescence value curve is obtained; based on the time-fluorescence value curve, the test results of the sample group are compared with the test results of the positive control group to determine whether the nucleic acid sample to be tested in the sample group contains human adenovirus type 55.

[0027] Preferably, in each reaction tube in the sixth step, the molar ratio of the fluorescent probe, forward primer, reverse primer, Cas12a enzyme, CrRNA, and fluorescent reporter is 1:3.5:3.5:2:1.67±0.01:0.83±0.01.

[0028] Preferably, in the fifth step, during ERA amplification, the temperature is 40°C-42°C for 20±1 minutes, and the FAM channel fluorescence value is collected every 30±1 seconds; in the sixth step, during CRISPR / Cas12a amplification, the temperature is 40°C-42°C for 10±1 minutes, and the FAM channel fluorescence value is collected every 30±1 seconds.

[0029] By using the above detection method, the non-diagnostic purpose of detecting human adenovirus type 55 (HAdv-55) by the ERA-CRISPR / Cas12a method can be successfully achieved, and the results can be intuitively judged on an ordinary fluorescence amplification instrument (conventional fluorescence quantitative PCR instrument or mini constant temperature fluorescence instrument), which is fast and accurate.

[0030] Compared with the prior art, the present invention uses the conservative sequence of the Hexon gene of human adenovirus type 55 as a target, and obtains a set of nucleic acids for the ERA-CRISPR / Cas12a method by design and screening, which is composed of ERA probe, forward primer, reverse primer and CrRNA, and has good detection sensitivity and detection specificity. The kit of the present invention is based on the set of nucleic acids, is simple to use, and is easy to operate experimentally; no large, complex and expensive instruments are required; the result identification is convenient and intuitive, and there is no need to open the lid after the reaction is completed, which can avoid the subsequent aerosol contamination false positive problem caused by opening the lid, and no subsequent nucleic acid electrophoresis and other cumbersome processes are required; fast and efficient, the whole process of amplification and result determination can be completed within 10-20 minutes; the detection sensitivity is high, and after experimental comparison testing, the detection limit of the kit for the HAdv55 live strain gene can reach 2.5 copies / reaction.

[0031] The present invention uses the conserved sequence of the Hexon gene of human adenovirus type 55 as a target to establish a simple, rapid, accurate and sensitive ERA-CRISPR / Cas12a detection method, which has reliable results and relatively low cost. It is particularly suitable for on-site or field instant detection, and is suitable for use in most hospitals and laboratories of epidemic prevention and control departments in China that lack real-time fluorescence quantitative PCR instruments. It is suitable for the rapid preliminary identification of cases of fever of unknown cause and the screening of its epidemic status, and is of great significance for infection prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the synthesis map of the HAdv-55 plasmid of Example 2 of the present invention.

[0033] Figure 2 This is a qPCR amplification curve diagram of the serial dilution concentrations of the positive control substance in Example 2 of the present invention.

[0034] Figure 3 This is the positive control standard curve of Example 2 of the present invention.

[0035] Figure 4 This is a graph showing the amplification efficiency results of fixing CrRNA1 and R1 in Example 3 of the present invention and combining them with F1 / F2 / F3 / F4 / F5 / F6, respectively.

[0036] Figure 5 This is a graph showing the amplification efficiency results of fixing CrRNA2 and R1 in Example 3 of the present invention and combining them with F1 / F2 / F3 / F4 / F5 / F6, respectively.

[0037] Figure 6 This is a diagram showing the reverse primer screening results for the highest amplification fluorescence value in Example 3 of the present invention.

[0038] Figure 7 This is a graph showing the screening results of the forward primer with the highest amplification fluorescence value in Example 3 of the present invention.

[0039] Figure 8 This is a diagram showing the negative screening results using HAdv55BP, F6 and R5 in Example 3 of the present invention.

[0040] Fig. 9 The positive control substance in Example 4 of the present invention is 9×10 5 ,9×10 3 ,9×10 2 The sensitivity test results of the copies / μl series concentration are shown in the figure.

[0041] Fig.10 This is a sensitivity test result diagram of the positive control substance at a concentration series of 90, 45, and 9 copies / μl in Example 4 of the present invention.

[0042] Fig.11 The live strain gene 10 in Example 4 of the present invention 7 , 10 6 , 10 5 Sensitivity test results of copies / T series concentrations.

[0043] Fig.12 This is a graph showing the sensitivity test results of the live strain gene at concentrations of 5000, 500, and 1.25 copies / T in Example 4 of the present invention.

[0044] Fig.13 This is a graph showing the sensitivity test results of the live strain gene 50, 5, and 2.5 copies / T concentration series in Example 4 of the present invention.

[0045] Fig.14 This is a specific amplification curve diagram of the potential cross-reactive pathogens of HAdv-55 in Example 5 of the present invention.

[0046] Fig.15 This is a specific amplification curve diagram of different subtypes of HAdv-55 pathogens in Example 5 of the present invention. DETAILED DESCRIPTION

[0047] After obtaining the live strain of HAdv-55 and the positive control, the inventor's research group of the present invention designed a fluorescent probe modified by a fluorescent group, 6 forward primers, 6 reverse primers, and 2 CRISPR guide RNAs (CrRNA) of the ERA fluorescence method for the conserved region sequence in the HAdv-55 Hexon protein gene (KP896478.1: 18234-21074). Using the positive control containing the target Hexon protein gene, a set of CrRNA / ERA probes and primers with the highest amplification efficiency were screened out through several combined tests. After the nucleic acid detection test of the actual virus strain, a positive result can be obtained in as fast as 9 minutes, and the minimum detection limit can reach 2.5 copies / reaction. Based on the above research results, the present invention proposes a set of nucleic acids for detecting HAdv-55 by the ERA-CRISPR / Cas12a method, a kit containing the set of nucleic acids, and a corresponding detection method.

[0048] The present invention will be described in further detail below with reference to the accompanying drawings and in combination with embodiments, but the present invention is not limited to the examples given.

[0049] For the experimental operations involved in the following content, if the specific experimental conditions are not specified, they shall be carried out according to conventional conditions, for example, the conditions described in "Molecular Cloning: A Laboratory Manual" edited by SAMBROOK.J et al., 4th edition (Molecular Cloning: A Laboratory Manual; NEW York: Cold Spring Harbor Laboratory Press, 2017), or the conditions recommended by the manufacturer.

[0050] The experimental materials and reagents involved in the following content are commercially available unless otherwise specified.

[0051] Example 1

[0052] In this embodiment, crRNA, ERA probes and primers for detection by ERA-CRISPR / Cas12a method were designed and synthesized for human adenovirus type 55 (HAdV-55).

[0053] Through the NCBI database ( https: / / www.ncbi.nlm.nih.gov ) The Hexon gene sequence of HAdv-55 (KP896478.1:18234-21074) was downloaded, and the conserved region of the Hexon gene was screened as the target sequence.

[0054] The design of probes and primers for ERA reaction follows the following principles: (1) The primer length should be 28-35 nt; (2) The GC content of the primer should be controlled at 35%-60%; (3) The length of the primer amplified fragment should be between 100-250 bp; (4) The probe length should be 46-52 nt, of which the 5' end of the restriction enzyme cleavage site should be at least 30 nt and the 3' end should be at least 15 nt; (5) The fluorophore and quencher of the probe should be labeled on thymine (T); (6) A blocking group should be added to the 3' end of the probe.

[0055] The design of CRISPR CrRNA follows the following principles: (1) It contains a scaffold sequence (fixed part) and a target sequence (variable part). The commonly used sequence of the scaffold sequence (fixed part) is UAAUUUCUACUAAGUGUAGAU, and the target sequence (variable part) is preferably 20-23 nt; (2) The PAM sequence can be TTTV or VTTT, where V is a degenerate base and can be G / A / C.

[0056] According to the above principles, the probe and primer sequences were first designed using Primer Premier 5.0 software, and then the primer quality (whether it contains hairpin structure, dimer, mismatch rate) was analyzed and evaluated using oligo7 software. The primer specificity was then verified by Primer-blast, and finally 1 probe sequence (HAdv55BP), 6 forward primer sequences (F1 to F6), 6 reverse primer sequences (R1 to R6) and 2 CRISPR CrRNA (CrRNA1 and CrRNA2) sequences were screened out. The specific sequences are shown in Table 1; among them, tetrahydrofuran (THF) was inserted into the fluorescent probe as the restriction exonuclease cleavage site, and the left and right thymine bases of THF were added with FAM fluorescent group and BHQ quenching group, respectively, and C3-spacer blocking group was added to the 3' end. All primers and modified probes were synthesized by Suzhou Zixi Biotechnology Co., Ltd.

[0057] Table 1. Screening probe and primer sequences

[0058]

[0059]

[0060] Example 2

[0061] In this example, a positive control substance for HAdv-55 detection was synthesized, and a standard curve was obtained by this detection.

[0062] The method for obtaining the positive control is as follows:

[0063] The pUC57 vector was cut with BamHI restriction endonuclease (Takara, Japan), and the Hexon target sequence of HAdv-55 (as shown in SEQ ID NO: 16) was cloned into the pUC57 vector (synthesized by GenScript Biotech Co., Ltd.) and sequenced, and named as HAdv-55 plasmid. The HAdv-55 plasmid was cut with NotI restriction endonuclease and purified by gel cutting as a positive control for HAdv-55.

[0064] The concentration of the positive control was determined using Qubit 4.0, which was 350 ng / μl. 23 )×[concentration (ng / μl)×10 -9 )] The calculated copy number concentration of the positive control was approximately 10x10 11 By 10-fold dilution, 1×10 copies / μl of the positive control was obtained. 2 copies / μl, 1.0×10 3 copies / μl, 1.0×10 4copies / μl, 1.0×10 5 copies / μl, 1.0×10 6 copies / μl, 1.0×10 7 The HAdv-55 nucleic acid detection kit (Jiangsu Hechuang Biotechnology Co., Ltd.) was used to detect the positive control substances in the series of dilution concentrations, and a standard curve was drawn.

[0065] The synthetic map of HAdv-55 plasmid is as follows Figure 1 As shown, the pUC57 vector is cut by BamHI restriction endonuclease, and the Hexon target gene is recombined into a standard plasmid. The Adv55 Target Gene shown in the figure is the Hexon target gene (i.e., the conserved sequence of the Hexon gene of HAdv-55), with a length of 446 bp and a sequence of SEQ ID NO: 16:

[0066] tgaaataaagcgcactgtggatggcgaaggctacaacgtagcccaatgcaaatgaccaaagactggttctgaa ggatacaaagatcgcattggtacagatgctcgccaactacaa(atcggctatcagggcttctacattccagtattcattttt cagaaacttccagccatgagcaggcaggtggttgatgaggtcaattacaaagacttcaaacaactctggctttgtgggtt acatgggccgtcgccataccctaccaacacactccgaccatgcgccaaggtcaaccctatcccgctaactatccctatccactcattggaacaactgccgtaaat agtgttacgcagaaaaagtataccgttctcgagcaacttcatgtctatgggggcccttacagactttcttgtgtgacagaaccatgtggcggggacagaacatgct

[0067] The concentration amplification diagram of the positive control serial dilution is shown in the figure below. Figure 2 Each concentration was repeated three times to provide a basis for the positive control standard curve. Figure 3 As shown, the fitting straight line is Y = --3.263X + 38.11, R 2 =0.9991. This standard curve can be used to calculate the copy number concentration of the live strain.

[0068] Example 3

[0069] In this example, the HAdv-55 positive control obtained in Example 2 was used as a template to screen the optimal CrRNA / ERA probe and primer combination.

[0070] The ERA fluorescence detection kit was used, which included a fluorescent probe (10 μM) solution, a forward primer (10 μM) solution, a reverse primer (10 μM) solution, a fluorescent amplification reagent (lyophilized powder), a dissolving agent (provided by the basic universal ERA fluorescence kit, product number KS104), an activator (280 mM magnesium acetate), ultrapure water, Cas12a protease (10 μM) solution, CrRNA (10 μM) solution, and a fluorescent reporter (10 μM) solution. The HAdv-55 positive control obtained in Example 2 was used as a template to screen the optimal CrRNA / ERA probe and primer combination.

[0071] The reaction system for each sample is as follows:

[0072]

[0073] The specific implementation steps are as follows:

[0074] The first step is to add the solvent, fluorescent probe solution, forward primer solution, reverse primer solution, ultrapure water and positive control substance in the kit to the transparent reaction tube, and mix well to obtain a mixed reaction solution.

[0075] Step 2: Add the fluorescent amplification reagent freeze-dried powder to the mixed reaction solution, shake and mix until the amplification reagent is resuspended, and centrifuge briefly.

[0076] Step 3: Add 2 μl of activator to the lid of the reaction tube, carefully close the lid, and briefly centrifuge to allow the activator to enter the mixed reaction solution. Briefly shake to mix and quickly centrifuge again to obtain the sample group; at the same time, use sterile water as the blank control group.

[0077] Step 4: Place the reaction tube in the fluorescence thermostatic amplification instrument GS8 (40℃-42℃) for 20 minutes to perform ERA amplification. Collect the fluorescence value of the FAM channel every 30 seconds.

[0078] Step 5. After the ERA amplification reaction is completed, add the premixed Cas12a enzyme, CrRNA and fluorescent reporter solution to the 50 μl reaction system, and then place it in the instrument for CRISPR / Cas12a amplification for 10 minutes and collect fluorescence.

[0079] Step 6: After the reaction is finished, the data is saved and analyzed to obtain a time-fluorescence value curve. In specific implementation, the time-fluorescence value curve can be compared with the test results of the positive control group to determine whether the nucleic acid sample to be tested contains HAdv-55.

[0080] In this example, CrRNA was first screened, the positive control was diluted to a concentration of 300 copies / μL, CrRNA1 and CrRNA2 were used, the reverse primer R1 was fixed, and the six forward primers F1 / F2 / F3 / F4 / F5 / F6 were combined for experimental testing. The results of the first round of screening were as follows: Figure 4 and Figure 5 As shown, it can be seen from the comparison that the amplification efficiency of CrRNA2 is better than that of CrRNA1.

[0081] Next, the optimal combination of probe primers was screened. The probe primer combination included a fluorescent probe, a forward primer and a reverse primer. The probe, forward primer and reverse primer synthesized in Example 1 were used, and 1 μl of positive control group (600 copies) was added to each reaction system. The reverse primer R was first screened, and the positive control group was diluted to a concentration of 300 copies / μL. The probe HAdv55BP was used, and the forward primer F1 was fixed and combined with 6 reverse primers (R1 to R6) for ERA amplification. The results are as follows: Figure 6 As shown, the reverse primer with the highest amplification fluorescence value was screened out as R5.

[0082] Next, the probe HAdv55BP was used, and the reverse primer R5 was fixed for screening. The positive control group was diluted to a concentration of 300 copies / μL, and combined with 6 forward primers (F1 to F6) for ERA amplification. The results are as follows: Figure 7 As shown, the forward primer with the highest amplification efficiency was screened out as F6.

[0083] Finally, the probe HAdv55BP, forward primer F6 and reverse primer R5 were used to perform negative verification with water as the test sample. Figure 8 All showed negative.

[0084] Based on the above results, the CrRNA / ERA probe primer combination with the highest amplification efficiency was finally screened out, which was CrRNA2 (SEQ ID NO: 3), probe HAdv55BP (modified based on SEQ ID NO: 1), forward primer F6 (SEQ ID NO: 9) and reverse primer R5 (SEQ ID NO: 14).

[0085] Example 4

[0086] In this example, the sensitivity of the crRNA / ERA probe primer combination obtained in Example 3 was tested.

[0087] First, the positive control substance was subjected to sensitivity testing. The positive control substance obtained in Example 2 was diluted in a 10-fold gradient to obtain a concentration of 9×10 5 copies / μl, 9×10 4 copies / μl, 9×10 3 copies / μl, 9×10 1 The optimal CrRNA / ERA probe primer combination was screened using Example 3, and 1 μl of the positive control was used as a template to perform the test according to the operating procedure of Example 3. The results are as follows: Fig. 9 and Fig.10 As shown, the detection limit (detection sensitivity) of the optimal CrRNA / ERA probe primer combination for the HAdv55 positive control can reach 9 copies / reaction.

[0088] Then, the sensitivity of the live strain gene was tested, and the live strain was amplified by qPCR using the HAdv-55 nucleic acid detection kit. The copy concentration was calculated to be 1.0×10 8 The concentration of the live strain gene serial dilution solution was obtained by multiple gradient dilution, and the optimal CrRNA / ERA probe primer combination screened in Example 3 was used for detection according to the operation process of Example 3. The results are as follows Fig.11 , Fig.12 and Fig.13 As shown, the detection limit (detection sensitivity) of the optimal CrRNA / ERA probe primer combination for the HAdv55 live strain gene can reach 2.5 copies / reaction.

[0089] Example 5

[0090] This example specifically detects the crRNA / ERA probe primer combination obtained in Example 3.

[0091] Other pathogens (influenza A virus IVA, influenza B virus IVB, parainfluenza virus HPIV, respiratory syncytial virus RSV, Mycoplasma pneumoniae MP, and new coronavirus SARS-CoV-2) with the same infection site or similar infection symptoms as HAdv-55 and potential cross-reactions were selected, and their nucleic acids were extracted. The optimal CrRNA / ERA probe primer combination screened in Example 3 was used for detection, and the experimental results were observed using the fluorescence thermostatic amplification instrument GS8. The results are shown in Fig.14As shown, except for HAdv-55, all other viruses were negative. Fig.14 It can be seen that the A8 well position has an obvious peak, and the system displays it as pending due to the threshold monitoring error, but it is actually a positive result.)

[0092] Pathogens of different subtypes from HAdv-55 (HAdv-3, HAdv-7, HAdv-21, HAdv-11, HAdv-14) were selected, their nucleic acids were extracted, and the optimal CrRNA / ERA probe primer combination screened in Example 3 was used for detection, and the experimental results were observed using a fluorescent thermostatic amplification instrument GS8. The results are shown in Fig.15 As shown, except HAdv-55 which was positive, all other viruses were negative.

[0093] Based on the above results, it can be seen that the CrRNA / ERA probe primer combination designed for HAdv-55 in Example 3 has good specificity.

[0094] In addition to the above embodiments, the present invention may also have other implementation modes. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A set of nucleic acids for detecting human adenovirus type 55 by ERA-CRISPR / Cas12a method, characterized in that: The nucleic acid set consists of an ERA probe, a forward primer, a reverse primer and CrRNA; the ERA probe is HAdv55BP, whose sequence is that the 29th base in SEQ ID NO:1 is labeled with a fluorescent group, the 30th base is replaced with tetrahydrofuran, and the 31st base is labeled with a quenching group, and a blocking group is added to the 3' end of SEQ ID NO:1; the forward primer is F6, whose sequence is SEQ ID NO:9; the reverse primer is R5, whose sequence is SEQ ID NO:14; the sequence of the CrRNA is SEQID NO:

3.

2. A set of nucleic acids for detecting human adenovirus type 55 by ERA-CRISPR / Cas12a method according to claim 1, characterized in that: The fluorescent group is FAM, the quenching group is BHQ, and the blocking group is C3-spacer.

3. A set of nucleic acids for detecting human adenovirus type 55 by ERA-CRISPR / Cas12a method according to claim 1, characterized in that: The target gene of the nucleic acid set is the Hexon gene sequence of human adenovirus type 55, and the Hexon gene sequence is SEQ ID NO:

16.

4. A kit for detecting human adenovirus type 55 using the ERA-CRISPR / Cas12a method, characterized in that: The kit comprises the nucleic acid set according to any one of claims 1 to 3; in the kit, the ERA probe, forward primer, reverse primer and CrRNA of the nucleic acid set are respectively solutions.

5. A kit for detecting human adenovirus type 55 by ERA-CRISPR / Cas12a method according to claim 4, characterized in that: The kit also includes a fluorescent amplification reagent, a dissolving agent, an activator, ultrapure water, a Cas12a enzyme, a fluorescent reporter, and a positive control; wherein the fluorescent amplification reagent is a lyophilized powder, and the dissolving agent, activator, Cas12a enzyme, fluorescent reporter, and positive control are solutions, respectively.

6. A kit for detecting human adenovirus type 55 by ERA-CRISPR / Cas12a method according to claim 5, characterized in that: The preparation process of the positive control is as follows: a plasmid containing a conservative sequence of the Hexon gene is subjected to an in vitro transcription reaction to obtain a Hexon gene RNA fragment, and the positive control is obtained after purification; wherein the conservative sequence of the Hexon gene is shown in SEQ ID NO:

16.

7. A kit for detecting human adenovirus type 55 by ERA-CRISPR / Cas12a method according to claim 5, characterized in that: The kit adopts a 52.7μl reaction system; each reaction system contains an amplification system and a detection system; the amplification system consists of 20μl solvent, 2.1μl 10μM forward primer, 2.1μl 10μM reverse primer, 0.6μl 10μM fluorescent probe, 22.2μl ultrapure water, 2μl activator, and 1μl nucleic acid sample to be tested; the detection system consists of 1.2μl 10μM Cas12a enzyme, 1μl 10μM CrRNA, and 0.5μl 10μM fluorescent reporter; the fluorescent amplification reagent and solvent are provided by a commercially available basic universal ERA fluorescence kit; the activator is 280mM magnesium acetate solution; the concentration of the positive control is 10ng / μl.

8. An ERA-CRISPR / Cas12a detection method for detecting human adenovirus type 55 for non-diagnostic purposes, characterized in that: The kit according to any one of claims 4 to 7 is used; the ERA-CRISPR / Cas12a detection method comprises the following steps: Step 1: Add the dissolving agent, fluorescent probe solution, forward primer solution, reverse primer solution, and ultrapure water in the kit to each reaction tube, and mix well to obtain a mixed reaction solution; Step 2: Add the fluorescent amplification reagent freeze-dried powder to the mixed reaction solution, shake and mix until the amplification reagent is resuspended, and centrifuge; Step 3: Divide the reaction tubes into a sample group and a positive control group; wherein, add the nucleic acid sample to be tested to the reaction tube of the sample group, add the positive control to the reaction tube of the positive control group, mix them respectively and then centrifuge; Step 4: Add activator to the cap of each reaction tube, cover the cap tightly, centrifuge to allow the activator to enter the mixed reaction solution, shake and mix well, and centrifuge again; Step 5: Place each reaction tube in a fluorescence thermostatic amplification instrument for ERA amplification; Step 6. After the ERA amplification reaction is completed, Cas12a enzyme, CrRNA and fluorescent reporter are added to each reaction tube, and then placed in a fluorescent thermostatic amplification instrument for CRISPR / Cas12a amplification and fluorescence is collected; Step 7. After the reaction is completed, the data is saved and a time-fluorescence value curve is obtained; based on the time-fluorescence value curve, the test results of the sample group are compared with the test results of the positive control group to determine whether the nucleic acid sample to be tested in the sample group contains human adenovirus type 55.

9. The ERA-CRISPR / Cas12a detection method for detecting human adenovirus type 55 for non-diagnostic purposes according to claim 8, characterized in that: In each reaction tube in the sixth step, the molar ratio of the fluorescent probe, forward primer, reverse primer, Cas12a enzyme, CrRNA, and fluorescent reporter was 1:3.5:3.5:2:1.67±0.01:0.83±0.

01.

10. An ERA-CRISPR / Cas12a detection method for detecting human adenovirus type 55 for non-diagnostic purposes according to claim 8, characterized in that, in the fifth step, during ERA amplification, the temperature is 40°C-42°C, lasts for 20±1 minutes, and the FAM channel fluorescence value is collected every 30±1 seconds; in the sixth step, during CRISPR / Cas12a amplification, the temperature is 40°C-42°C, lasts for 10±1 minutes, and the FAM channel fluorescence value is collected every 30±1 seconds.

Images