Dual fluorescence quantitative PCR primer probe combination, kit and application thereof for detecting snake adenovirus and lizard adenovirus
By designing a dual fluorescence quantitative PCR primer probe combination for snake adenovirus and lizard adenovirus and combining it with real-time fluorescence quantitative PCR technology, the detection difficulties in existing technologies have been solved, and rapid, accurate and simple virus detection has been achieved, which is suitable for virus monitoring in the snake and lizard breeding industry.
Patent Information
- Application Number
- CN202411294685.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-14
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2044-09-14
AI Technical Summary
Existing technologies make it difficult to quickly and accurately detect snake adenoviruses and lizard adenoviruses, making it difficult to diagnose viral infections in the snake and lizard farming industries. Existing methods are complex to operate, costly, and time-consuming, making them unsuitable for clinical testing.
A dual fluorescence quantitative PCR primer-probe combination for snake adenovirus and lizard adenovirus was designed, including specific primers and probes, combined with real-time fluorescence quantitative PCR technology to achieve simultaneous detection of the two viruses.
It achieves rapid, accurate and simple detection of snake adenovirus and lizard adenovirus, reduces the risk of cross-reaction, saves detection time and reagent consumption, has high sensitivity and can detect 80 copies/mL, making it suitable for clinical application.
Smart Images

Figure CN119193920B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological detection, and particularly relates to a dual fluorescent quantitative PCR primer probe combination, a kit and applications thereof for detecting snake adenovirus and lizard adenovirus. Background Art
[0002] Adenoviruses were first isolated from human tonsil tissue by Rowe et al. in Missouri, USA, in 1952-1953. Adenoviruses are a group of non-enveloped, double-stranded DNA viruses with virions measuring 80 to 100 nm in diameter, icosahedral symmetry, and a genome size of approximately 45 kb. According to the International Committee on Taxonomy of Viruses, the Adenoviridae family is divided into six genera: Mastadenovirus, Aviadenovirus, Atadenovirus, Siadenovirus, Ichtadenovirus, and Testadenovirus. Snake adenovirus (SnAdv) and lizard adenovirus (LzAdv) both belong to the genus Atadenovirus within the Adenoviridae family.
[0003] The genus Adenothymovirus may have co-evolved with reptiles, but it can undergo host switching, so the genus Adenothymovirus does not have strict host specificity. There are few reports of adenovirus infection in China, but there are many reports abroad, and infections have occurred in both wild snakes and lizards and in captivity. Inna Ball et al. used immunoneutralization experiments to investigate 138 snake samples and 263 lizard samples. The serum positive infection rates of one adenovirus were 44.9% and 33.8%, respectively, and the serum positive rates of two or more adenoviruses were 9.9% and 12.2%, respectively (Ball I, Öfner S, Funk RS, Griffin C, Riedel U, Möhring J, Marschang RE. Prevalence of neutralizing antibodies against adenoviruses in lizards and snakes. The Veterinary Journal. 2014 Oct 1;202(1):176-81.). Snakes infected with adenovirus can develop clinical symptoms such as pneumonia, loss of appetite, nausea, and abdominal distension. Snakes are closely associated with human life, and their use as exhibit animals and medicinal animals is increasing. This trend has led to the rapid growth of the snake farming industry. Adenovirus is a common respiratory virus that infects snakes, and its symptoms are similar to those of other respiratory viruses, such as reovirus, making it difficult to identify the infecting pathogen in clinical practice. Adenovirus infection can be transmitted between snakes through direct or indirect contact, leading to widespread illness and even mortality within the population, severely hindering the healthy development of the snake farming industry. Lizards infected with adenovirus can develop symptoms including loss of appetite, lethargy, limb paralysis, weakness, and anorexia. Younger bearded dragons are more susceptible to infection, and most severely infected individuals have a maximum lifespan of less than three months. Diagnosis and treatment of adenovirus are challenging because infection cannot be determined solely by symptoms, and there is currently no specific treatment for adenovirus infection. Treatment primarily relies on boosting the body's own immune system to combat the virus, with supplemental measures like oral / injectable antibiotics and enhanced nutritional supplementation to alleviate symptoms. Therefore, developing a rapid and effective test for adenovirus infection is crucial for the snake and lizard farming industries.
[0004] At present, the detection methods of adenovirus mainly focus on virus isolation and culture, electron microscopy, DNA in situ hybridization, plaque reduction and neutralization test, etc., which have the characteristics of long diagnosis time, low sensitivity and cumbersome operation in clinical diagnosis. Therefore, it is not easy to quickly diagnose the above two pathogens in clinical practice. Wellehan et al. reported a nested PCR method for detecting adenovirus (Wellehan, JF, Johnson, AJ, Harrach, B., Benkö, M., Pessier, AP, Johnson, CM, Garner, MM, Childress, A. and Jacobson, ER, 2004. Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses. Journal of virology, 78(23), pp.13366-13369.), but the nested PCR operation is complicated, the reagent cost is high, the detection time is long, and the method has high requirements for the operator, which is not suitable for clinical detection.
[0005] Therefore, there is an urgent need to establish a rapid, accurate and sensitive detection method to diagnose and monitor snake adenovirus and lizard adenovirus in this field to ensure the healthy development of the snake and lizard breeding industries. Summary of the Invention
[0006] To solve the above technical problems, the present invention provides a dual fluorescent quantitative PCR primer-probe combination for detecting snake adenovirus and lizard adenovirus, comprising a snake adenovirus primer-probe combination and a lizard adenovirus primer-probe combination, wherein:
[0007] The snake adenovirus primer probe combination includes:
[0008] A snake adenovirus upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a snake adenovirus downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a snake adenovirus probe with a nucleotide sequence as shown in SEQ ID NO: 3;
[0009] The lizard adenovirus primer probe combination includes:
[0010] The lizard adenovirus upstream primer has a nucleotide sequence as shown in SEQ ID NO: 4, the lizard adenovirus downstream primer has a nucleotide sequence as shown in SEQ ID NO: 5, and the lizard adenovirus probe has a nucleotide sequence as shown in SEQ ID NO: 6.
[0011] Specifically, the snake adenovirus probe carries a first fluorescent reporter group, and the lizard adenovirus probe carries a second fluorescent reporter group, and the first fluorescent reporter group is different from the second fluorescent reporter group.
[0012] Specifically, the first fluorescent reporter group is FAM, and the second fluorescent reporter group is HEX.
[0013] In a second aspect, the present invention provides a use of the aforementioned dual fluorescent quantitative PCR primer-probe combination for detecting snake adenovirus and lizard adenovirus in the preparation of a kit for detecting snake adenovirus and lizard adenovirus.
[0014] In a third aspect, the present invention provides a kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology, the kit comprising PCR amplification reagents, negative controls and positive controls, the PCR amplification reagents comprising the aforementioned dual fluorescence quantitative PCR primer probe combination for detecting snake adenovirus and lizard adenovirus.
[0015] Specifically, the PCR amplification reagent also includes 2×Taq Master Mix.
[0016] Specifically, in the dual fluorescent quantitative PCR primer probe combination for detecting snake adenovirus and lizard adenovirus, the concentrations of the snake adenovirus upstream primer, the snake adenovirus downstream primer, the lizard adenovirus upstream primer and the lizard adenovirus downstream primer are all 0.1-0.5 μM, and the concentrations of the snake adenovirus probe and the lizard adenovirus probe are both 0.05 μM-0.3 μM.
[0017] Specifically, the negative control is sterile double-distilled water, and the positive control is a mixture of a cloned plasmid containing a snake adenovirus target conserved sequence and a cloned plasmid containing a lizard adenovirus target conserved sequence.
[0018] In a fourth aspect, the present invention provides a real-time fluorescence quantitative PCR method for detecting snake adenovirus and lizard adenovirus. The method is based on the aforementioned kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology, and comprises the following steps:
[0019] 1) Extract total DNA from the sample to be tested;
[0020] 2) preparing a reaction system, wherein the reaction system includes the aforementioned PCR amplification reagents;
[0021] 3) Perform real-time fluorescence quantitative PCR using the extracted total DNA of the sample to be tested as a template and adding negative and positive controls as quality control templates;
[0022] 4) After the reaction is completed, analyze the PCR amplification products and determine the results.
[0023] Specifically, the procedure of the real-time fluorescence quantitative PCR reaction is:
[0024] Step 1: 94°C, pre-denaturation for 5 min;
[0025] Step 2: denaturation at 94°C for 5 seconds, and detection of the signal at 60°C for 30 seconds.
[0026] Step 2 executes 40 cycles.
[0027] In a fifth aspect, the present invention also provides a use of the above-mentioned kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology in detecting snake adenovirus and lizard adenovirus.
[0028] Beneficial effects:
[0029] 1. The present application provides a dual fluorescent quantitative PCR primer probe combination, a kit, and its application for detecting snake adenovirus and lizard adenovirus. In the early stage, the whole genomes of snake adenovirus and lizard adenovirus were analyzed by bioinformatics, and the above two pairs of primer probe sets were designed based on their conserved gene sequences. The primer sets have similar annealing temperatures and the amplified target fragments are similar in size. There is no mutual interference between the two pairs of primer probe sets, which enables the subsequent composition of the primer probe set for use. In actual operation, the primer probe set only amplifies the genomes of snake adenovirus and lizard adenovirus without causing nonspecific reactions, and the primers have strong specificity.
[0030] 2. This application establishes a real-time fluorescence quantitative PCR method for detecting snake adenoviruses and lizard adenoviruses. This method can quickly and accurately detect snake adenoviruses and lizard adenoviruses in test samples, without cross-reactivity with other pathogens. In practical applications, it is simple to operate, reduces the number of operations, significantly avoids cross-contamination, and saves detection time and reagent consumption. Because the established detection method amplifies conserved regions of the virus, it is highly targeted and sensitive, with a minimum nucleic acid detection concentration of 80 copies / mL. This method can meet the requirements of simple, economical, rapid, and accurate testing in clinical testing.
[0031] 3. The dual fluorescence quantitative PCR method established by the present invention enables the simultaneous identification and detection of two pathogens in the same reaction tube, which has important application value in the detection and identification of snake adenovirus and lizard adenovirus, disease monitoring and epidemiological investigation. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 This is a diagram showing the sample amplification results of dual fluorescence quantitative PCR in Example 1;
[0033] Figure 2This is a graph showing the sensitivity results of dual fluorescence quantitative PCR in Example 2;
[0034] Figure 3 This is the standard curve of snake adenovirus by dual fluorescence quantitative PCR in Example 2;
[0035] Figure 4 This is the standard curve of lizard adenovirus by dual fluorescence quantitative PCR in Example 2;
[0036] Figure 5 This is a diagram showing the specific results of dual fluorescence PCR in Example 3. DETAILED DESCRIPTION
[0037] The following is a clear and complete description of the technical solution of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0038] Example 1 Fluorescence quantitative PCR method for simultaneous detection of snake adenovirus and lizard adenovirus
[0039] (1) Extraction of nucleic acid from test samples
[0040] Respiratory samples of snakes with suspected symptoms were collected and nucleic acid was extracted using a commercially available viral genomic DNA / RNA extraction kit to obtain the total nucleic acid in the sample, i.e., total DNA and total RNA, which were then stored at -20°C;
[0041] (2) Primer design and synthesis
[0042] Based on the complete genome sequences of snake and lizard adenoviruses reported in GenBank, we compared and analyzed the genomes of different strains and screened for conserved sequences. Specific primer probes targeting these two viruses were designed using an online primer design tool (https: / / www.primer3plus.com / ). These primer probes were then analyzed and evaluated online at the National Center for Biological Investigations (NCBI) (https: / / www.ncbi.nlm.nih.gov). The evaluated primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and diluted to 10 μM in DEPC-H2O for later use. After experimental evaluation, the synthesized primer probes were selected and two primer probe sets were selected, as shown in Table 1.
[0043] Table 1 Primer and probe sequences for dual fluorescence quantitative PCR
[0044]
[0045] (3) Construction of quality control products
[0046] Quality control products are divided into negative and positive controls, used to monitor for possible abnormal results throughout the entire process. The negative control is composed of sterile double-distilled water and is used to monitor the operation process for contamination and other factors, thereby preventing false-negative results. The positive control is composed of a synthetic cloned plasmid containing a conserved target sequence of snake adenovirus and a cloned plasmid containing a conserved target sequence of lizard adenovirus, mixed and diluted, to monitor for abnormalities in the amplification system and further prevent false-negative results.
[0047] The pathogen target conserved DNA sequences contained in the above cloned plasmids are as follows:
[0048] SEQ ID NO: 7 (snake adenovirus target region conserved sequence):
[0049] 5'-CATGGGATGAGAAAGAGCGCTCGCATACATGCCGCAGATGTCGTAGCATAAATGGGGCTCGGTAAAAACGCCCAAGAAAGAAGGATAGCAACGCCCTCCTCTTACGCTCTTCCTGATGTGTTCGTACATGACTTCTGACGGAGCCTCT AAGTTAGGCAGGAATTTGCCTACGGCAGAGGGTTCGGACTTGTAAAACATTTGCTTAAACATGGCGTGCGTAGTGCTGCTGATGGTGGGCCTCTGAAAAACATTAAAGGTGCAATCTAGCTTGAGCACTTCGTCGCAGAACTGCTGGTAGCC -3'
[0050] SEQ ID NO: 8 (Lizard adenovirus target region conserved sequence):
[0051] 5'-AGAGGAGGAGGGAAACAGTCAGCTTTCACTATCATAGGAAGTATGTCTTTGTCAAAAAATGAAAGTTTGCCTGTAGACTCTAGCTTGTCTTGGAAGCGTGCCATTGCTACTGATGCATCTAACGGACTGAGAGTGAGCCCGTAAGGCA TAGGATGAGAAAGAGCGCTCGCATACATTCCACAAATATCATAAACGTAAATTGGCTCGGTGTACACTCCTAAGAATGAAGGATAGCAGCGACCTCCTCTTACACTTTGACGTATGTGTTCATACATGATCTCGGAAGGCGCTTGGATATTA -3'
[0052] The above plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0053] After receiving the plasmid powder, dissolve it in 100 μL TE buffer and measure the concentration of the recombinant plasmid using a spectrophotometer. The formula is: DNA (copies / mL) = (6.02x1023) × DNA (ng / μL) × 10 -6 / [DNA length (bp) × 660] to calculate the plasmid concentration. Spectrophotometer test data showed that the snake adenovirus OD 260 / OD 280 ratio was 1.82. The average nucleic acid concentration of three measurements was 36.73 ng / μL, and the calculated plasmid concentration was 1.11x10 13 copies / mL; the snake adenovirus OD 260 / OD 280 ratio was 1.79, the average nucleic acid concentration of three determinations was 45.71 ng / μL, and the calculated plasmid concentration was 1.39x10 13 The above plasmids were diluted 10-fold to form a mixed plasmid with equal concentration, and the plasmid concentration was 8.0x10 1 -8.0x10 8 copies / mL, for future use.
[0054] (4) Construction and optimization of PCR reaction system
[0055] Using the positive control as the template, 10 μL of 2×Taq Master Mix, 2 μL of DNA template, and 20 μL of reaction system, dual fluorescence quantitative PCR reaction was performed under different annealing temperatures (55-62°C), primer dosages of 0.1 μM-0.5 μM, and probe dosages of 0.05 μM-0.3 μM, and the reaction conditions were optimized.
[0056] The optimized optimal reaction system was (20 μL): 2×Taq Master Mix 10 μL, snake adenovirus upstream and downstream primers 0.3 μM each, probe 0.2 μM; lizard adenovirus upstream and downstream primers 0.25 μM each, probe 0.2 μM, DNA template 2 μL, and sterile double-distilled water to 20 μL.
[0057] The optimal reaction conditions after optimization were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 5 s, signal detection at 60°C for 30 s, and 40 cycles.
[0058] (5) Sample amplification and result determination
[0059] Turn on the qPCR instrument to preheat and prepare for testing. Take out the eight-tube reaction reagent corresponding to the qPCR instrument and add the negative control, sample nucleic acid and positive control. Each sample well has a system of 20 μL.
[0060] a. Negative control wells: Add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers for snake adenovirus, and 0.4 μL of probe, or 0.5 μL each of upstream and downstream primers for lizard adenovirus, and 0.4 μL of probe, and make up to 20 μL with sterile double-distilled water.
[0061] b. Sample nucleic acid wells: Using the sample nucleic acid as the template, add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers and 0.4 μL of probe for snake adenovirus, 0.5 μL each of upstream and downstream primers and 0.4 μL of probe for lizard adenovirus, and 2 μL of sample nucleic acid template. Make up to 20 μL with sterile double-distilled water.
[0062] c. Positive control wells: Add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers and 0.4 μL of probe for snake adenovirus, 0.5 μL each of upstream and downstream primers and 0.4 μL of probe for lizard adenovirus, 2 μL of positive control template, and make up to 20 μL with sterile double-distilled water.
[0063] The eight tubes with the sample were amplified according to the optimized reaction conditions mentioned above, and FAM and HEX / VIC were selected as the fluorescence channels. The validity was judged based on the amplification results. The negative control had no Ct value or the Ct value was zero, and the positive control had a Ct value of ≤30. Otherwise, the experiment was invalid. Figure 1 , where amplification curve number 1 is the positive control, number 2 is the negative control, number 3 is the lizard adenovirus sample, and number 4 is the snake adenovirus sample. It can be seen that the primer-probe combination and detection method provided in this example can quickly and accurately detect snake adenovirus and lizard adenovirus.
[0064] Example 2 Sensitivity Analysis of Dual Fluorescence Quantitative PCR
[0065] The plasmid prepared in Example 1 was diluted with equal concentration gradients and loaded onto the instrument. The qPCR instrument was turned on to preheat and prepare for detection. The eight-tube reaction reagent corresponding to the qPCR instrument was taken out and the negative control and plasmid nucleic acid (8x10 1 -8x10 8 copies / mL), and each sample well system is 20 μL;
[0066] a. Negative control wells: Using each diluted plasmid nucleic acid as a template, add 10 μL of 2× TaqMaster Mix, 0.6 μL each of the upstream and downstream primers for snake adenovirus, and 0.4 μL of the probe; 0.5 μL each of the upstream and downstream primers for lizard adenovirus, and 0.4 μL of the probe. Make up to 20 μL with sterile double-distilled water.
[0067] b. Plasmid nucleic acid wells: Add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers and 0.4 μL of probe for snake adenovirus, 0.5 μL each of upstream and downstream primers and 0.4 μL of probe for lizard adenovirus, 2 μL of plasmid nucleic acid template, and make up to 20 μL with sterile double-distilled water.
[0068] Amplify the eight-tube strips loaded with samples using the optimized reaction conditions from Example 1, selecting FAM and HEX / VIC as the fluorescence channels. Assess the effectiveness of the amplification results. If the negative control has no Ct value or a Ct value of zero, the experiment is invalid.
[0069] After confirming that the experimental results are valid, a standard curve is constructed to obtain the minimum detection limit of the reaction.
[0070] Figure 2 The sensitivity results of dual fluorescence quantitative PCR: amplification curve numbers 1-8 are the copy number 8x10 8 copies / mL-8x10 1 The plasmid was diluted in a gradient with the same concentration of 10 copies / mL, and No. 9 was used as a negative control.
[0071] Figure 3 、 Figure 4 The standard curve of dual fluorescence quantitative PCR is constructed based on the results of serial dilution plasmid amplification of snake adenovirus and lizard adenovirus. Figure 3 As shown, the correlation coefficient R 2 =0.9996; Figure 4 As shown, the correlation coefficient R of lizard adenovirus 2 =0.9966.
[0072] Combine Figure 2-3 The experimental results show that the correlation coefficients of all viruses are greater than 0.995, and the minimum detection limit of the present invention for snake adenovirus and lizard adenovirus plasmid templates is 80 copies / mL.
[0073] Example 3 Specificity Analysis of Dual Fluorescence Quantitative PCR
[0074] (1) Take samples of snake paramyxovirus, snake Cryptosporidium, lizard Cryptosporidium, bovine adenovirus, and duck adenovirus of other thymovirus genera, and extract nucleic acid using a viral genomic DNA / RNA extraction kit to obtain the total nucleic acid in the sample, namely total DNA and total RNA, and store them at -20℃.
[0075] (2) Samples were added to the negative control, snake adenovirus, lizard adenovirus, snake paramyxovirus, snake Cryptosporidium, lizard Cryptosporidium, bovine adenovirus, duck adenovirus and positive control respectively.
[0076] a. Negative control wells: Add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers for snake adenovirus, and 0.4 μL of probe, or 0.5 μL each of upstream and downstream primers for lizard adenovirus, and 0.4 μL of probe, and make up to 20 μL with sterile double-distilled water.
[0077] b. Viral nucleic acid wells: Using viral nucleic acids from snake adenovirus, lizard adenovirus, snake paramyxovirus, snake Cryptosporidium, lizard Cryptosporidium, bovine adenovirus, or duck adenovirus as templates, add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers and 0.4 μL of probe for snake adenovirus, 0.5 μL each of upstream and downstream primers and 0.4 μL of probe for lizard adenovirus, 2 μL of nucleic acid template, and make up to 20 μL with sterile double-distilled water.
[0078] c. Positive control wells: Add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers and 0.4 μL of probe for snake adenovirus, 0.5 μL each of upstream and downstream primers and 0.4 μL of probe for lizard adenovirus, and 2 μL of positive control template. Make up to 20 μL with sterile double-distilled water.
[0079] Amplify the eight-tube strips loaded with samples using the optimized reaction conditions from Example 1, selecting FAM and HEX / VIC as the fluorescence channels. Assess the effectiveness of the amplification results. The negative control should have no Ct value or a Ct value of zero, and the positive control should have a Ct value of ≤30. Otherwise, the experiment is invalid.
[0080] Figure 4 This figure shows the specificity results of dual fluorescence quantitative PCR. Amplification curve number 1 represents the positive control, number 2 represents snake adenovirus, number 3 represents lizard adenovirus, and number 4 represents snake paramyxovirus, snake Cryptosporidium, lizard Cryptosporidium, bovine adenovirus, duck adenovirus, and the negative control. After confirming the validity of the results, analysis of the experimental results revealed that only snake adenovirus and lizard adenovirus exhibited typical amplification curves, while no amplification curves were observed for the other pathogenic genomes, demonstrating the good specificity of the method.
[0081] Example 4 Repeatability Analysis of Dual Fluorescence Quantitative PCR
[0082] The plasmid prepared in Example 1 was diluted with equal concentration gradients and loaded onto the instrument. The qPCR instrument was turned on to preheat and prepare for detection. The eight reaction tubes corresponding to the qPCR instrument were taken out and the negative control and plasmid nucleic acid (8x10 1 ~8x108 copies / mL), each sample well system is 20μL;
[0083] a. Negative control wells: Add 10 μL of 2× Taq Master Mix, 0.6 μL each of upstream and downstream primers for snake adenovirus, and 0.4 μL of probe, or 0.5 μL each of upstream and downstream primers for lizard adenovirus, and 0.4 μL of probe, and make up to 20 μL with sterile double-distilled water.
[0084] b. Plasmid nucleic acid wells: Using each diluted plasmid nucleic acid as a template, add 10 μL of 2× Taq MasterMix enzyme mix, 0.6 μL each of upstream and downstream primers for snake adenovirus and 0.4 μL of probe, 0.5 μL each of upstream and downstream primers for lizard adenovirus and 0.4 μL of probe, 2 μL of plasmid nucleic acid template, and bring the volume up to 20 μL with sterile double-distilled water. For each plasmid nucleic acid well, set up eight replicate wells. Detection was performed using the dual fluorescence quantitative PCR method developed in this invention. Once the experimental results were confirmed to be valid, they were considered as intra-group reproducibility experiments.
[0085] The above experiment was repeated three times independently by different experimenters under the same conditions as the inter-group reproducibility experiment.
[0086] The Ct values of the intra-group repeatability experiment and the inter-group repeatability experiment were collected, and the coefficient of variation was calculated to verify the repeatability of the method.
[0087] The results of intra-group repeatability analysis and inter-group repeatability analysis are shown in Table 2. The results show that all coefficients of variation are less than 1%, indicating that the method has excellent repeatability and stability.
[0088] Table 2 Results of repeatability analysis of dual fluorescence quantitative PCR
[0089]
[0090] Example 5 Clinical Application
[0091] Clinical testing was performed on 59 suspected snake respiratory samples collected using the dual fluorescence quantitative PCR method established in Example 1, and validity was determined based on the amplification results. The negative control had no Ct value or a Ct value of zero, and the positive control had a Ct value of ≤30; otherwise, the experiment was invalid.
[0092] Comparison and analysis of the test results with those of the nested PCR assay developed by Wellehan et al. demonstrated 100% concordance between the dual fluorescence quantitative PCR assay developed by the present invention and the nested PCR assay for clinical samples. The amplified snake adenovirus (SnAdV) and lizard adenovirus (LzAdV) positive products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and bioinformatics analysis with their respective reference sequences. Nucleotide identity between the two products exceeded 98%, confirming that the PCR amplified products were snake adenovirus and lizard adenovirus, respectively. The clinical sample testing results are shown in Table 3.
[0093] Table 3 Clinical sample test results
[0094]
[0095] In fact, in order to simultaneously detect snake adenovirus and lizard adenovirus, a large number of primers and probes were designed during the development of the present invention. Table 4 lists some of them as an example. The primers and probes in Table 4 were used to replace the corresponding primers and probes in Table 1, and detection was performed. The detection results are shown in Table 5.
[0096] Table 4 Example primer probe sequences
[0097]
[0098] Table 5 Example primer probe sample detection results
[0099]
[0100] As shown in Table 5, the Ct values of the snake adenovirus and lizard adenovirus example primer probes listed in Table 4 were significantly delayed when testing samples compared with the primer probe group listed in Table 1. There was also a certain degree of missed detection, and the accuracy was not high.
[0101] In summary, the present invention designs specific amplification primers and probes in conserved regions based on the full genome sequences of snake adenoviruses and lizard adenoviruses, and establishes a specific method for detecting snake adenoviruses and lizard adenoviruses. The detection method of the present invention has the advantages of high sensitivity, strong specificity, and good repeatability for snake adenoviruses and lizard adenoviruses. The minimum detectable template concentration is 80 copies / mL. There is no specific amplification with other common snake and lizard infectious pathogens and other adenothymovirus viruses, no cross-reaction is found, and the intra- and inter-batch coefficients of variation are less than 1%.
[0102] In summary, the above embodiments are only several implementation methods of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A dual fluorescence quantitative PCR primer-probe combination for detecting snake adenovirus and lizard adenovirus, characterized in that: The invention comprises a snake adenovirus primer probe combination and a lizard adenovirus primer probe combination, wherein: The snake adenovirus primer probe combination includes: A snake adenovirus upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a snake adenovirus downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a snake adenovirus probe with a nucleotide sequence as shown in SEQ ID NO: 3; The lizard adenovirus primer probe combination includes: The lizard adenovirus upstream primer has a nucleotide sequence as shown in SEQ ID NO: 4, the lizard adenovirus downstream primer has a nucleotide sequence as shown in SEQ ID NO: 5, and the lizard adenovirus probe has a nucleotide sequence as shown in SEQ ID NO:
6.
2. The dual fluorescent quantitative PCR primer-probe combination for detecting snake adenovirus and lizard adenovirus according to claim 1, characterized in that: The snake adenovirus probe carries a first fluorescent reporter group, and the lizard adenovirus probe carries a second fluorescent reporter group, and the first fluorescent reporter group is different from the second fluorescent reporter group.
3. The dual fluorescent quantitative PCR primer-probe combination for detecting snake adenovirus and lizard adenovirus according to claim 2, characterized in that: The first fluorescent reporter group is FAM, and the second fluorescent reporter group is HEX.
4. Use of the dual fluorescent quantitative PCR primer-probe combination for detecting snake adenovirus and lizard adenovirus according to any one of claims 1 to 3 in preparing a kit for detecting snake adenovirus and lizard adenovirus.
5. A kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology, characterized in that: The kit comprises a PCR amplification reagent, a negative control and a positive control, wherein the PCR amplification reagent comprises the dual fluorescent quantitative PCR primer probe combination for detecting snake adenovirus and lizard adenovirus according to any one of claims 1 to 3.
6. The kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology according to claim 5, characterized in that: The PCR amplification reagent also includes 2×Taq Master Mix.
7. The kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology according to claim 5, characterized in that: In the dual fluorescent quantitative PCR primer-probe combination for detecting snake adenovirus and lizard adenovirus, the concentrations of the snake adenovirus upstream primer, the snake adenovirus downstream primer, the lizard adenovirus upstream primer, and the lizard adenovirus downstream primer are all 0.1-0.5 μM, and the concentrations of the snake adenovirus probe and the lizard adenovirus probe are both 0.05 μM-0.3 μM.
8. The kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology according to claim 5, characterized in that: The negative control is sterile double-distilled water, and the positive control is a mixture of a cloned plasmid containing a snake adenovirus target conserved sequence and a cloned plasmid containing a lizard adenovirus target conserved sequence.
9. A real-time fluorescence quantitative PCR method for detecting snake adenovirus and lizard adenovirus for non-disease diagnosis purposes, characterized in that: The method is based on the kit for detecting snake adenovirus and lizard adenovirus based on real-time fluorescence quantitative PCR technology according to any one of claims 5 to 8, comprising the steps of: 1) Extract total DNA from the sample to be tested; 2) preparing a reaction system, wherein the reaction system comprises the PCR amplification reagent according to any one of claims 5 to 8; 3) Perform real-time fluorescence quantitative PCR using the extracted total DNA of the sample to be tested as a template and adding negative and positive controls as quality control templates; 4) After the reaction is completed, analyze the amplification products and determine the results.
10. The real-time fluorescence quantitative PCR method for detecting snake adenovirus and lizard adenovirus for non-disease diagnosis purposes according to claim 9, characterized in that: The procedure of the real-time fluorescence quantitative PCR reaction is: Step 1: 94°C, pre-denaturation for 5 min; Step 2: denaturation at 94°C for 5 seconds, and detection of the signal at 60°C for 30 seconds. Step 2 executes 40 cycles.
Citation Information
Patent Citations
Primer probe combination, kit and method for simultaneously detecting parrot beak and feather disease virus and avian polyoma virus through real-time fluorescent quantitative PCR
CN117904371A
Primer probe combination, kit and method for detecting dragon adenovirus 1 based on real-time fluorescent quantitative PCR (Polymerase Chain Reaction) technology
CN118028533A