Multiplex qPCR primer probe set, detection system and application for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3

Abstract

The present invention provides a multiplex qPCR primer probe set, a detection system and an application for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, and belongs to the technical field of virus detection. The multiplex qPCR detection primer probe set of the present invention includes an upstream primer, a downstream primer and a fluorescent probe for detecting duck Tembusu virus; an upstream primer, a downstream primer and a fluorescent probe for detecting duck reovirus; an upstream primer, a downstream primer and a fluorescent probe for detecting duck hepatitis A virus type 1, and an upstream primer, a downstream primer and a fluorescent probe for detecting duck hepatitis A virus type 3. The primer probe set of the present invention has good specificity and sensitivity, and can detect four waterfowl infectious disease pathogens at the same time.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and in particular relates to a multiplex qPCR primer probe set, a detection system and an application thereof for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3. Background Art

[0002] In the daily breeding of waterfowl, duck Tembusu virus (DTMUV), novel duck reovirus (NDRV), duck hepatitis A virus type 1 (DHAV-1) and duck hepatitis A virus type 3 (DHAV-3) are more common. Duck Tembusu virus (DTMUV) belongs to the genus Flavivirus of the family Flaviviridae and is a positive-sense single-stranded RNA virus of the Ntaya virus group. The disease is characterized by rapid onset, rapid spread and high prevalence. It mainly causes a rapid decline or even cessation of egg production in ducks. In the early stages of the disease, ducks may have a persistent high fever, followed by neurological symptoms such as paralysis, rolling, unsteady standing and ataxia. The morbidity rate can reach 100%, but the mortality rate is relatively low, at 5% to 15%. Since April 2010, DTMUV has frequently broken out in many regions, causing serious economic losses to the duck industry. The novel duck reovirus (NDRV) belongs to the genus Orthoreovirus of the family Reoviridae. Its particle diameter is 70 to 80 nanometers, and its genome consists of 10 segments of double-stranded RNA. Since 2017, NDRV has successively broken out in many places. Compared with the previously reported duck reovirus, NDRV shows higher pathogenicity, wider host range and higher mortality. NDRV can infect different species of ducks and geese, causing hemorrhagic necrosis of the liver, spleen and bursa of Fabricius. It can also cause ovarian hemorrhage and ovarian follicle atrophy. These outbreaks have caused significant economic losses to the duck farming industry. Duck hepatitis A virus (DHAV) belongs to the Picornaviridae family and the Enterovirus genus. It is a single-stranded positive RNA virus with non-enveloped spherical virus particles. Duck viral hepatitis was first discovered by Levin and Hofstadter in 1945. The disease is characterized by liver enlargement and hemorrhage. Ducklings become ill within a week and die quickly after the onset of symptoms. Due to the significant genetic differences between DHAV strains and the absence of cross-reactivity, DHAV is divided into DHAV-1, DHAV-2 and DHAV-3. So far, the main strains prevalent in our country are DHAV-1 and DHAV-3.

[0003] DTMUV, NDRV, DHAV-1, and DHAV-3 are common pathogens of ducks. Due to their clinical immunosuppressive properties, DTMUV, NDRV, DHAV-1, and DHAV-3 can cause secondary or multiple infections with each other or with other viruses. It is challenging to diagnose whether certain diseases occur based solely on clinical symptoms. In recent years, nucleic acid detection technologies such as PCR and real-time qPCR have been widely used in the diagnosis of such diseases as a convenient and accurate means of detection. However, these molecular techniques are based on the detection of different pathogens using different PCR methods that target individual species-specific genes rather than simultaneously in one reaction. Therefore, there is a lack of research on the simultaneous detection of four viruses. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a multiplex qPCR primer probe set for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, wherein the primer probe set can simultaneously detect four waterfowl infectious pathogens, there is no cross-reaction between the four pathogens, and the stability is high.

[0005] The present invention also aims to provide a multiplex qPCR detection system for duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3.

[0006] The present invention also aims to provide a multiplex qPCR kit for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides a multiplex qPCR primer probe set for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3. The primer probe set comprises an upstream primer DTMUV-F, a downstream primer DTMUV-R and a fluorescent probe DTMUV-Probe for detecting duck Tembusu virus; an upstream primer NDRV-F, a downstream primer NDRV-R and a fluorescent probe NDRV-Probe for detecting duck reovirus; an upstream primer DHAV-1-F, a downstream primer DHAV-1-R and a fluorescent probe DHAV-1-Probe for detecting duck hepatitis A virus type 1, and an upstream primer DHAV-3-F, a downstream primer DHAV-3-R and a fluorescent probe DHAV-3-Probe for detecting duck hepatitis A virus type 3.

[0009] The nucleotide sequence of the upstream primer DTMUV-F for detecting duck Tembusu virus is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer DTMUV-R is shown in SEQ ID NO.2, and the nucleotide sequence of the fluorescent probe DTMUV-Probe is shown in SEQ ID NO.3;

[0010] The nucleotide sequence of the upstream primer NDRV-F for detecting duck reovirus is shown in SEQ ID NO.7, the nucleotide sequence of the downstream primer NDRV-R is shown in SEQ ID NO.8, and the nucleotide sequence of the fluorescent probe NDRV-Probe is shown in SEQ ID NO.9;

[0011] The nucleotide sequence of the upstream primer DHAV-1-F for detecting duck hepatitis A virus type 1 is shown in SEQ ID NO.12, the nucleotide sequence of the downstream primer DHAV-1-R is shown in SEQ ID NO.13, and the nucleotide sequence of the fluorescent probe DHAV-1-Probe is shown in SEQ ID NO.14;

[0012] The nucleotide sequence of the upstream primer DHAV-3-F for detecting duck hepatitis A virus type 3 is shown in SEQ ID NO.18, the nucleotide sequence of the downstream primer DHAV-3-R is shown in SEQ ID NO.19, and the nucleotide sequence of the fluorescent probe DHAV-3-Probe is shown in SEQ ID NO.20.

[0013] Preferably, the 5' end of the fluorescent probe in the primer probe set is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0014] Preferably, the fluorescent reporter group includes one of HEX, CY5, ROX or FAM; and the fluorescent quencher group includes BHQ1 or BHQ2.

[0015] The present invention also provides a multiplex qPCR kit for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, wherein the kit comprises the multiplex qPCR primer probe set.

[0016] The present invention also provides a multiplex qPCR detection system for duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, wherein the multiplex qPCR detection system comprises the multiplex qPCR primer probe set.

[0017] Preferably, the multiplex qPCR detection system comprises the following components in a total volume of 20 μL: 10 μL One StepPrimeScript qPCRMix, 2 μL of mixed template, 0.5 μL of 8-12 μM upstream primer DTMUV-F, 0.5 μL of 8-12 μM downstream primer DTMUV-R, 0.5 μL of 8-12 μM fluorescent probe DTMUV-Probe; 0.8 μL of 8-12 μM upstream primer NDRV-F, 0.7 μL of 8-12 μM downstream primer NDRV-R, 0.8 μL of 8-12 μM fluorescent probe NDRV-Probe; 0.3 μL of 8-12 μM upstream primer DHAV-1-F, 0.3 μL of 8-12 μM downstream primer DHAV-1-R, 0.5 μL of 8-12 μM fluorescent probe DHAV-1-Probe 0.2μL; 8~12μM upstream primer DHAV-3-F 0.6μL, 8~12μM downstream primer DHAV-3-R 0.6μL, 8~12μM fluorescent probe DHAV-13-Probe 0.7μL; 1.6μL ddH2O.

[0018] Preferably, in the mixed template, four pathogenic templates of duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 are mixed in an equal volume ratio.

[0019] The present invention also provides a multiplex qPCR detection method for duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 for non-diagnostic purposes, comprising the following steps:

[0020] Extract RNA from the sample to be tested and reverse transcribe it into cDNA;

[0021] Using the cDNA as a template, performing multiplex qPCR amplification using the multiplex qPCR primer probe set, the kit, or the detection system;

[0022] After the reaction is completed, whether DTMUV, NDRV, DHAV-1 and DHAV-3 in the sample to be tested are positive is determined based on the amplification curve.

[0023] Preferably, the judgment criteria are as follows: if the sample to be tested shows an amplification curve and Ct≤35, it is judged as positive; if the sample to be tested does not detect an amplification curve or the Ct value is >38, it is judged as negative.

[0024] Preferably, the reaction procedure of the multiplex qPCR amplification is as follows: reverse transcription at 25°C for 10 min, 52°C for 5 min; pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 52°C for 30 s, extension at 72°C for 20 s, 40 cycles.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides a primer probe set for detecting duck Tembusu virus DTMUV, duck reovirus NDRV, duck hepatitis A virus type 1 DHAV-1 and duck hepatitis A virus type 3 DHAV-3, which has good specificity and sensitivity for detecting four waterfowl infectious pathogens. Compared with the currently widely used PCR detection, pathogen isolation and identification and serological detection, it has considerable detection sensitivity. The primer probe set of the present invention can simultaneously detect four waterfowl infectious pathogens, and there is no cross reaction between the four pathogens, and the stability is high, and the coefficient of variation is all below 10%. The present invention also establishes a multiplex qRT-PCR system and method for simultaneously detecting DTMUV, NDRV, DHAV-1 and DHAV-3. The multiplex qRT-PCR detection system and method provided by the present invention can quickly detect the four viruses of DTMUV, NDRV, DHAV-1 and DHAV-3, which can provide effective prevention for the four viruses and is expected to reduce the economic losses in waterfowl breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 1 is a graph showing the annealing temperature optimization results of the multiplex qPCR detection of the present invention, wherein A is the DTMUV annealing temperature optimization result, B is the NDRV annealing temperature optimization result, C is the DHAV-1 annealing temperature optimization result, and D is the DHAV-3 annealing temperature optimization result;

[0028] Figure 2 The qPCR fluorescence quantitative sensitivity amplification curve and standard curve for the detection of single waterfowl infectious pathogens. In the figure, A is the sensitivity amplification curve and standard curve of DTMUV, B is the sensitivity amplification curve and standard curve of NDRV, C is the sensitivity amplification curve and standard curve of DHAV-1; D is the sensitivity amplification curve and standard curve of DHAV-3;

[0029] Figure 3 The multiplex qPCR fluorescence quantitative sensitivity amplification curve and standard curve for the detection of four waterfowl infectious disease pathogens. In the figure, A is the sensitivity amplification curve of the four waterfowl infectious disease pathogens, and B is the standard curve of the four waterfowl infectious disease pathogens;

[0030] Figure 4 It is a graph of the specific detection results of multiplex qPCR, in which 1-4: plasmid standard templates DTMUV, NDRV, DHAV-1 and DHAV-3, 1'-4': DTMUV, NDRV, DHAV-1 and DHAV-3 virus templates, 5-9: DEV, GPV, MDPV, NDV and AIV virus templates;

[0031] Figure 5 The multiplex qPCR detection system of the present invention uses qPCR instruments of different brands to systematically calibrate the various judgment standards of the established method. In the figure, A is the sensitivity amplification curve and standard curve of DHAV-1, B is the sensitivity amplification curve and standard curve of DTMUV, C is the sensitivity amplification curve and standard curve of DHAV-3; D is the sensitivity amplification curve and standard curve of NDRV;

[0032] Figure 6 A specific result diagram of the system calibration of various determination criteria of the established method using qPCR instruments of different brands in the multiplex qPCR detection system provided by the present invention;

[0033] Figure 7 The multiplex qPCR detection system of the present invention is used to detect serum and diseased tissue samples. DETAILED DESCRIPTION

[0034] The invention provides a multiplex qPCR primer probe set for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3. The primer probe set comprises an upstream primer DTMUV-F, a downstream primer DTMUV-R and a fluorescent probe DTMUV-Probe for detecting duck Tembusu virus; an upstream primer NDRV-F, a downstream primer NDRV-R and a fluorescent probe NDRV-Probe for detecting duck reovirus; an upstream primer DHAV-1-F, a downstream primer DHAV-1-R and a fluorescent probe DHAV-1-Probe for detecting duck hepatitis A virus type 1, and an upstream primer DHAV-3-F, a downstream primer DHAV-3-R and a fluorescent probe DHAV-3-Probe for detecting duck hepatitis A virus type 3.

[0035] The nucleotide sequence of the upstream primer DTMUV-F for detecting duck Tembusu virus is preferably ACTGGTTTCATGAYCTCAACTTACC (SEQ ID NO.1), the nucleotide sequence of the downstream primer DTMUV-R is preferably CATTTCCARTTTGYTTCCAGAGT (SEQ ID NO.2), and the nucleotide sequence of the fluorescent probe DTMUV-Probe is preferably ACRGGGTCATCAGCGGGGACG (SEQ ID NO.3); in a specific embodiment of the present invention, the nucleotide sequence of the upstream primer DTMUV-F for detecting duck Tembusu virus is more preferably ACTGGTTTCATGATCTCAACTTACC (SEQ IDNO.4), the nucleotide sequence of the downstream primer DTMUV-R is more preferably CATTTCCAATTTGCTTCCAGAGT (SEQ IDNO.5), and the nucleotide sequence of the fluorescent probe DTMUV-Probe is more preferably ACAGGGTCATCAGCGGGGACG (SEQ IDNO.6).

[0036] The nucleotide sequence of the upstream primer NDRV-F for detecting duck reovirus is preferably CTCCGGRCCTGCTGATG (SEQ ID NO.7), the nucleotide sequence of the downstream primer NDRV-R is preferably TCAATGGCAGGGGTCGTTAT (SEQ ID NO.8), and the nucleotide sequence of the fluorescent probe NDRV-Probe is preferably TYTTCAAGGTTGGTGAGTGGCTGGGA (SEQ ID NO.9); in a specific embodiment of the present invention, the nucleotide sequence of the upstream primer NDRV-F for detecting duck reovirus is more preferably CTCCGGGCCTGCTGATG (SEQ ID NO.10), and the nucleotide sequence of the fluorescent probe NDRV-Probe is more preferably TCTTCAAGGTTGGTGAGTGGCTGGGA (SEQ ID NO.11).

[0037] The nucleotide sequence of the upstream primer DHAV-1-F for detecting duck hepatitis A virus type 1 is preferably TATGGGYCTCAAAAAGCCAGC (SEQ ID NO.12), the nucleotide sequence of the downstream primer DHAV-1-R is preferably CTAAGGCAAAATCTGAAGTRCCC (SEQ ID NO.13), and the nucleotide sequence of the fluorescent probe DHAV-1-Probe is preferably TTCCACTCCCTGCTCCCACYTCCC (SEQ ID NO.14). In a specific embodiment of the present invention, the nucleotide sequence of the upstream primer DHAV-1-F for detecting duck hepatitis A virus type 1 is more preferably TATGGGTCTCAAAAAGCCAGC (SEQ ID NO.15), the nucleotide sequence of the downstream primer DHAV-1-R is more preferably CTAAGGCAAAATCTGAAGTACCC (SEQ ID NO.16), and the nucleotide sequence of the fluorescent probe DHAV-1-Probe is more preferably TTCCACTCCCTGCTCCCACCTCC (SEQ ID NO.17).

[0038] The nucleotide sequence of the upstream primer DHAV-3-F for detecting duck hepatitis A virus type 3 is preferably TATTCTGTTACRCCBTTACGCCC (SEQ ID NO.18), the nucleotide sequence of the downstream primer DHAV-3-R is preferably TGRTGCAGGCARTGGRAA (SEQ ID NO.19), and the nucleotide sequence of the fluorescent probe DHAV-3-Probe is preferably CGACCCATGCCAGYRTYTCAGGG (SEQ ID NO.20). In a specific embodiment of the present invention, the nucleotide sequence of the upstream primer DHAV-3-F for detecting duck hepatitis A virus type 3 is more preferably TATTCTGTTACRCCTTTACGCCC (SEQ ID NO.21), the nucleotide sequence of the downstream primer DHAV-3-R is more preferably TGGTGCAGGCAGTGGAAA (SEQ ID NO.22), and the nucleotide sequence of the fluorescent probe DHAV-3-Probe is more preferably CGACCCATGCCAGTGTTTCAGGG (SEQ ID NO.23).

[0039] In the above sequence, Y, R and B are degenerate bases, the base corresponding to Y is C or T, the base corresponding to R is A or G, and the base corresponding to B is G or T or C.

[0040] The present invention designs fluorescent probes and primers based on gene chip technology. The size of the fluorescent probe and the length of the target DNA will affect the hybridization signal. Generally, the oligonucleotide probe can take into account the sensitivity and specificity of the chip when it is 16 to 25 bp. At the same time, the smaller the target fragment, the higher the efficiency of amplification. However, when the length is too low, its stability is poor and the hybridization signal may be reduced. The length of each probe of the present invention is 21 to 26 bp, the target fragment of the DTMUV target gene is 197 bp, the target fragment of the NDRV target gene is 219 bp, the target fragment of the DHAV-1 target gene is 192 bp, and the target fragment of the DHAV-3 target gene is 156 bp, which ensures the stability and clarity of the response signal.

[0041] In the present invention, the fluorescent probe is an oligonucleotide, the 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. In the extension stage of PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the fluorescent probe, so that the reporter fluorescent group and the quencher fluorescent group are separated, and the fluorescent monitoring system can receive the fluorescent signal, presenting curves of different fluorescent colors to distinguish four waterfowl infectious disease pathogens. In the present invention, the fluorescent reporter group preferably includes one of HEX, CY5, ROX or FAM; the fluorescent quencher group preferably includes BHQ1 or BHQ2.

[0042] The primer probe set provided by the invention detects four waterfowl infectious disease pathogens with good specificity and sensitivity, can detect four waterfowl infectious disease pathogens at the same time, has no cross reaction between the four pathogens, and has high stability, with coefficients of variation all below 10%.

[0043] The present invention also provides a multiplex qPCR kit for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, wherein the kit comprises the multiplex qPCR primer probe set.

[0044] The present invention also provides a multiplex qPCR detection system for duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, wherein the multiplex qPCR detection system comprises the multiplex qPCR primer probe set.

[0045] In the present invention, the multiplex qPCR detection system comprises the following components in a total volume of 20 μL: 10 μL OneStep PrimeScript qPCR Mix, 2 μL of mixed template, 0.5 μL of 8-12 μM upstream primer DTMUV-F, 0.5 μL of 8-12 μM downstream primer DTMUV-R, 0.5 μL of 8-12 μM fluorescent probe DTMUV-Probe; 0.8 μL of 8-12 μM upstream primer NDRV-F, 0.7 μL of 8-12 μM downstream primer NDRV-R, 0.8 μL of 8-12 μM fluorescent probe NDRV-Probe; 0.3 μL of 8-12 μM upstream primer DHAV-1-F, 0.3 μL of 8-12 μM downstream primer DHAV-1-R, 0.5 μL of 8-12 μM fluorescent probe DHAV-1-Probe 0.2μL; 8-12μM upstream primer DHAV-3-F 0.6μL, 8-12μM downstream primer DHAV-3-R 0.6μL, 8-12μM fluorescent probe DHAV-3-Probe 0.7μL; 1.6μL ddH2O. In the present invention, the molar concentration of each primer and fluorescent probe is more preferably 10μM. The present invention determines the concentration and addition amount of each primer and fluorescent probe in the detection system by orthogonal test to ensure that the detection result has good stability.

[0046] In the present invention, the four pathogenic templates of duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 in the mixed template are preferably mixed in an equal volume ratio. In the present invention, the four pathogenic templates of duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 are more preferably mixed in a volume ratio of 1:1:1:1. As an practicable method, 1 to 3 μL of the four pathogenic templates of duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 are respectively aspirated and fully mixed, and the mixed template is aspirated as a mixed template.

[0047] The present invention also provides a multiplex qPCR detection method for duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 for non-diagnostic purposes, preferably comprising the following steps:

[0048] Extract RNA from the sample to be tested;

[0049] Using the RNA as a template, performing multiplex qPCR amplification using the multiplex qPCR primer probe set, the kit, or the detection system;

[0050] After the reaction is completed, it is determined whether DTMUV, NDRV, DHAV-1 or DHAV-3 in the sample to be tested is positive according to the amplification curve.

[0051] The present invention does not make special limitations on the methods for extracting sample RNA and reverse transcription. Conventional means well-known in the art can be used to extract the RNA of the sample to be tested and perform reverse transcription; or a conventional commercially available kit can be used to extract the RNA of the sample to be tested and perform reverse transcription. The detection method established by the present invention can simultaneously and rapidly detect four viruses, namely DTMUV, NDRV, DHAV-1 and DHAV-3, and can also perform single detection of each virus.

[0052] The detection instrument used in the present invention can collect fluorescence-labeled probe signals of different wavelengths, and the corresponding primer probes can be located according to different well positions and fluorescence signals. In the present invention, the judgment criteria are preferably as follows: if an amplification curve appears in the detection of the sample to be tested and Ct ≤ 35, it is determined to be positive; if 35 < Ct ≤ 38 in the fluorescence channel, it is determined to be suspicious and needs to be retested; if there is no amplification curve in the fluorescence channel or Ct value > 38, it is determined to be negative. In the present invention, as an implementable method, if it is still suspicious after retesting and environmental pollution is excluded, it is determined to be weakly positive for the viral nucleic acid in the corresponding channel.

[0053] In the present invention, the reaction procedure of the multiplex qPCR amplification is preferably as follows: reverse transcription at 25°C for 10 min, 52°C for 5 min; pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 52°C for 30 s, extension at 72°C for 20 s, 40 cycles. The present invention optimizes the annealing temperature through orthogonal experiments to determine the annealing temperature in the amplification reaction procedure of the present invention to ensure that the amplification reaction has good stability.

[0054] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0055] In the following embodiments, duck enteritis virus DEV, goose parvovirus GPV, Muscovy duck parvovirus MDPV, duck Tembusu virus DTMUV, novel duck reovirus NDRV, duck hepatitis A virus type 1 DHAV-1, duck hepatitis A virus type 3 DHAV-3, Newcastle disease virus (NDV Lasota strain) and avian influenza H9 (AIV-H9) were provided by the China Institute of Veterinary Drug Control.

[0056] Viral genomic RNA extraction kit and rapid plasmid extraction kit were purchased from Tiangen Biochemical Technology Co., Ltd., DH5α competent cells were purchased from Novozymes, MiniBESTAgarose Gel DNAExtraction Kit, One StepPrimeScript TM III RT-qPCRMix, with UNG, pMD TM 19-T Vector Cloning Kit was purchased from TAKARA.

[0057] Example 1 Establishment of multiplex qPCR detection method

[0058] 1. Design of primers and probes

[0059] To ensure the detection performance of the primers and probes used in the multiplex qRT-PCR method, all available DTMUV, NDRV, DHAV-1, and DHAV-3 sequences were obtained from GenBank and analyzed. Primers and probes for DTMUV, NDRV, DHAV-1, and DHAV-3 were designed based on the E gene of DTMUV, the Sigma C gene of NDRV, and the VP1 gene of DHAV-1 and DHAV-3. The specific primer and probe sequences are shown in Table 1.

[0060] Table 1 Multiplex fluorescence quantitative RT-qPCR primers and probes

[0061]

[0062] 2. Preparation of four virus recombination positive plasmids

[0063] 2.1 Sample nucleic acid extraction

[0064] According to the instructions of the Tiangen Virus Genome RNA Extraction Kit, nucleic acids of the four virus samples were extracted respectively.

[0065] 2.2 Amplification of each viral target fragment

[0066] Use the fragments of 156 to 219 bp in length containing the fragments amplified by the pathogen primers in Table 2 as the target fragments to be inserted into the T vector, and perform PCR amplification reaction to obtain the target product. Use the nucleic acid extracted in 2.1 as a template, and configure a single virus reaction system: 25 μL 2×One step MIX, 2.5 μL One step Enzyme MIX, 2 μL of the upstream and downstream primers corresponding to the amplified virus template in Table 2, 2 μL of a single virus template, 16.5 μL of double distilled water ddH2O, and the reaction program is: reverse transcription at 50°C, 30 min; pre-denaturation at 94°C, 3 min; denaturation at 94°C, 30 s, annealing at 48°C, 30 s, extension at 72°C, 30 s, 35 cycles; 72°C, 7 min, and storage at 4°C.

[0067] Table 2 Amplification primers

[0068]

[0069]

[0070] 2.3 Construction of recombinant T vector and extraction of recombinant positive plasmid

[0071] Purify the target PCR product according to the instructions of TAKARA's MiniBESTAgarose Gel DNA Extraction Kit Ver.4.0. TM 19-T Vector Cloning Kit instructions, construct T vector and coat it in Amp resistant medium. Select PCR positive bacterial samples for sequencing and use NCBINucleotide Blast to compare sequencing results. Finally, extract the recombinant positive plasmids of each virus according to the instructions of Tiangen's rapid plasmid extraction kit.

[0072] 3. Optimization of multiplex qPCR amplification conditions

[0073] To establish the multiplex qPCR method, the recombinant positive plasmid extracted in 2.3 was used as the plasmid standard and serially diluted. The copy numbers after dilution were as follows:

[0074] DTMUV:8.08×10 8 copies / μL~8.08×10 0 copies / μL;

[0075] NDRV: 1.24×10 8 copies / μL~1.24×10 0 copies / μL;

[0076] DHAV-1: 6.03×10 9 copies / μL-6.03×10 0 copies / μL;

[0077] DHAV-3: 1.88×10 8 copies / μL-1.88×10 0 copies / μL.

[0078] Mix all primers, probes and serially diluted plasmid standards of DTMUV, NDRV, DHAV-1 and DHAV-3 with 10 μL One Step PrimeScript TM III RT-qPCR Mix and sterile ddH2O were mixed in a 20 μL reaction system. Finally, the dosage of each primer and probe was optimized. The optimal dosage of primers and probes and the optimal annealing temperature were determined by orthogonal experiments. The optimal amount of primers, probes and annealing temperature should be determined based on the optimal amplification curve at a certain value in the orthogonal process, and the CT value is low to determine the optimal amount of primers and probes and annealing temperature. The specific primer and probe sequences are shown in Table 3.

[0079] Table 3 Multiplex fluorescence quantitative RT-qPCR primer and probe sequences

[0080]

[0081]

[0082] according to Figure 1The results in Tables 4 to 7 show that the optimal primer and probe dosages of DTMUV, NDRV, DHAV-1 and DHAV-3 are: 10 μM upstream primer DTMUV-F 0.5 μL, 10 μM downstream primer DTMUV-R 0.5 μL, 10 μM fluorescent probe DTMUV-Probe 0.5 μL; 10 μM upstream primer NDRV-F 0.8 μL, 10 μM downstream primer NDRV-R 0.7 μL, 10 μM fluorescent probe NDRV-Probe 0.8 μL; 10 μM upstream primer DHAV-1-F 0.3 μL, 10 μM downstream primer DHAV-1-R 0.3 μL, 10 μM fluorescent probe DHAV-1-Probe 0.2 μL; 10 μM upstream primer DHAV-3-F 0. 0.6 μL, 10 μM downstream primer DHAV-3-R 0.6 μL, 10 μM fluorescent probe DHAV-3-Probe 0.7 μL. The reaction system was 10μL One Step qPCRMix, 2μL of mixed template, 0.5μL each of 10μM DTMUV-F and DTMUV-R primers, and 0.5μL of 10μM DTMUV-Probe probe; 0.7μL each of 10μM NDRV-F and NDRV-R primers, and 0.8μL of 10μM NDRV-Probe probe; 0.3μL each of 10μM DHAV-1-F and DHAV-1-R primers, and 0.2μL of 10μM DHAV-1-Probe probe; 0.6μL of 10μM DHAV-3-F and DHAV-3-R primers, 0.7μL of 10μM DHAV-3-Probe probe, and 1.6μL of ddH2O. The annealing temperature optimization results showed that 52°C was the best annealing temperature. The reaction amplification conditions were reverse transcription 25°C, 10 min; 52°C, 5 min; 95°C, 30 s; 95°C, 5 s, 52°C, 30 s, 72°C, 20 s, 40 cycles.

[0083] Table 4 DTMUV primer and probe concentration optimization (CT value)

[0084]

[0085] Table 5 NDRV primer and probe concentration optimization (CT value)

[0086]

[0087] Table 6 DHAV-1 primer and probe concentration optimization (CT value)

[0088]

[0089] Table 7 DHAV-3 primer and probe concentration optimization (CT value)

[0090]

[0091] 4. Construction of standard curve

[0092] The four viruses were mixed and the plasmid standards were diluted 10 times in succession. In analytical chemistry experiments, the standard curve method is often used for quantitative analysis. The scale of the horizontal and vertical axes of the drawing paper used to draw the standard curve and the size of the experimental points should not be too large or too small, and should be able to approximately reflect the accuracy of the measurement. Therefore, the four virus plasmid standards were diluted 10 times with sterile double distilled water. 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 A total of 6 concentration gradients of 100 copies / μL were used as templates to establish the standard curve of each virus, and ddH2O was used as the negative control template for TapMan fluorescent quantitative RT-qPCR amplification ( Figure 2 ), and draw a standard curve based on the final result ( Figure 3 ). Among them, the DTMUV standard curve is y = -3.8209x + 37.023, the NDRV standard curve is y = -3.5859x + 34.679, the DHAV-1 standard curve is y = -3.4754x + 36.509, and the DHAV-3 standard curve is y = -3.3892x + 34.9. The R of a single virus detection is 2 The values ​​and amplification efficiencies are as follows: R 2 The R value and amplification efficiency were 0.9996 and 82%, respectively. 2 The R value and amplification efficiency were 0.9991 and 90%, respectively, and the R 2 The R value and amplification efficiency were 0.9995 and 93%, respectively, and the R 2 The value and amplification efficiency were 0.9917 and 97% respectively. The results showed that the multiplex qPCR established by the present invention can effectively detect the target genes of the four viruses, and each standard curve showed a good correlation coefficient and amplification effect: DTMUV, R 2 =0.97, Eff%=93; NDRV, R 2 =0.98, Eff%=81; DHAV-1, R 2 =0.96, Eff%=94; DHAV-3, R 2 =0.99, Eff%=82.

[0093] 5. Result determination

[0094] The instrument collects the fluorescence-labeled probe signals at different wavelengths. After being processed by software, the amplification curves of four fluorescence channels, namely FAM, HEX, CY5, and ROX, are presented. The corresponding primer probes can be located according to different well positions and fluorescence signals. The results are as Figures 1 to 4 shown. If obvious amplification curves appear in the sample detection and ct ≤ 35, it is determined as positive. If 35 < Ct ≤ 38 in the corresponding channel, it is determined as suspicious and needs to be retested; if it is still suspicious after retesting and excluding environmental pollution, it is determined as weak positive for the viral nucleic acid in the corresponding channel; if there is no well amplification curve or Ct value > 38 in the corresponding channel, it is determined as negative for the nucleic acid in that channel.

[0095] Example 2 Sensitivity detection of multiplex qPCR

[0096] To analyze the sensitivity of the established multiplex RT-qPCR detection, the plasmid standard products in step 2.3 of Example 1 were mixed and then serially diluted 10-fold in sterile ddH2O. The final concentrations after dilution were between 10 8 ~10 1 copies / μL. These diluted standard plasmids were used for the sensitivity amplification of RT-qPCR single virus plasmid standards ( Figure 2 ). The multiplex sensitivity amplification curves of the four virus plasmid standards for the detection of the four viruses in the mixed system are as Figure 3 and Table 8. The single detection sensitivity of DTMUV is 80.8 copies / μL, the single detection sensitivity of NDRV is 12.4 copies / μL, the single detection sensitivity of DHAV-1 is 60.3 copies / μL, and the single detection sensitivity of DHAV-3 is 18.8 copies / μL.

[0097] Table 8 Sensitivity of multiplex fluorescence quantitative RT-qPCR

[0098]

[0099] Example 3 Specificity detection of multiplex qPCR

[0100] Using the cDNA of 9 waterfowl viruses, namely DEV, MDPV, GPV, DTMUV, DHAV-1, DHAV-3, NDRV, AIV-H9, and NDV, as the amplification templates, the specificity of the multiplex RT-qPCR established in Example 1 was evaluated. Sterile ddH2O was used as the negative control template (see Figure 4). The results showed that NDRV, DHAV-1, DHAV-3, and DTMUV were successfully detected; no signals were detected for DEV, GPV, MDPV, AIV-H9, and NDV, and no signals were detected for the negative control.

[0101] Example 4 Multiplex qPCR Repeatability

[0102] In order to evaluate the repeatability of multiplex qPCR, the coefficient of variation (CV) of RT-qPCR was detected using 10-fold serial dilutions of the plasmid standard template, and all tests were repeated three times to evaluate the repeatability of the intra-batch experiment. In order to evaluate the repeatability of the inter-batch experiment, the test was repeated three times at different locations (see Table 9). The coefficient of variation within the DTMUV test was 1.7-2.3%, and the coefficient of variation between tests was 2.4-4.9%. The coefficient of variation within the NDRV test was 0.8-3.1%, and the coefficient of variation between tests was 1.3-4.3%. The coefficient of variation within the DHAV-1 test was 1.2-7.2%, and the coefficient of variation between tests was 1.9-7.1%. The coefficient of variation within the DHAV-3 test was 1.2-3.3%, and the coefficient of variation between tests was 0.8-1.6%. The results show that the multiplex qPCR detection system of the present invention has good repeatability.

[0103] Table 9 Repeatability test of 4 viruses in multiplex RT-qPCR detection system

[0104]

[0105] Example 5 Calibration of qPCR Instruments of Different Brands

[0106] All reactions established by the present invention for the multiplex qPCR method were performed on a QuantStudio 7Flex qPCR instrument system (Thermo Fisher SCIENTIFIC). In order to improve the adaptability of the present invention, the construction method of the standard curve of Example 1, the sensitivity detection of Example 2, and the specific detection of Example 3 were constructed on a Bio-Rad CFX 384qPCR instrument system. The standard curve results showed that the DTMUV standard curve was y=-3.6668x+37.11, the NDRV standard curve was y=-3.4772x+35.509, the DHAV-1 standard curve was y=-3.2884x+37.133, and the DHAV-3 standard curve was y=-3.6248x+35.63. The coefficient of variation (R 2 ) values ​​and amplification efficiency are as follows: DTMUV coefficient of variation (R 2 ) value and amplification efficiency were 0.98 and 87%, respectively. The R 2 The R value and amplification efficiency were 0.9966 and 93%, respectively, and the R2 The value and amplification efficiency were 0.9976 and 200%, respectively, and the R 2 The value and amplification efficiency were 0.9999 and 88%, respectively. The sensitivity results showed that the single detection sensitivity of DTMUV was 80.8 copies / μL, the single detection sensitivity of NDRV was 12.4 copies / μL, the single detection sensitivity of DHAV-1 was 60.3 copies / μL, and the single detection sensitivity of DHAV-3 was 18.8 copies / μL. The specificity results showed that NDRV, DHAV-1, DHAV-3, and DTMUV were successfully detected, and no signals were detected for DEV, GPV, MDPV, AIV-H9, and NDV, and no signals were detected for the negative control (see Figure 5 and Figure 6 ). The results show that the multiplex qPCR detection method established by the present invention has strong adaptability and can be applied to a variety of detection instruments.

[0107] Example 6 Multiplex qPCR sample diversity detection

[0108] In order to cope with the diversity of clinical samples, the present invention collected 58 cases of waterfowl diseased tissues in the clinic (Table 10) and 12 healthy serum samples from Nanchang, Jiangxi for testing. The results showed that 29 of the 58 diseased tissue samples were positive, including 5 positive DTMUV, 18 positive DHAV-3, 5 positive DHAV-1, and 1 positive NDRV. At the same time, the serum samples of healthy waterfowl were tested, and no positive amplification was found (see Figure 7 ).

[0109] Table 1058 Waterfowl Disease Tissue Sample Collection Information Summary

[0110] Collection location quantity Jiangxi 7 Fujian 16 Guangxi 7 Guangdong 6 Shandong 13 Jiangsu 4 Anhui 5

[0111] Example 7 Multiplex qPCR applied to clinical sample detection

[0112] In this embodiment, a total of 215 clinical samples from pathogen-positive or suspected waterfowl were collected, and the clinical samples were prepared according to the method of Example 1 for system amplification reaction, and multiple qPCR detection was performed. The results were determined by the result determination method in Example 1, and the positive rate was calculated. At the same time, the diagnostic technology of ordinary PCR was used for joint detection to analyze the consistency of the test results. The multiple qPCR method established by the present invention detected a total of 10 DTMUV samples, 5 NDRV samples, 12 DHAV-1 samples, and 35 DHAV-3 samples.

[0113] Table 11 Clinical sample test results

[0114] pathogen qPCR Positive rate (%) PCR Kappa test DTMUV 10 / 215 4.6％ 9 / 215 0.945(p＜0.001) NDRV 5 / 215 2.3％ 4 / 215 0.887(p＜0.001) DHAV-1 12 / 215 5.5％ 12 / 215 1.000(p＜0.001) DHAV-3 35 / 215 16.2％ 32 / 215 0.947(p＜0.001)

[0115] In the table, Kappa test:

[0116]

[0117] That is: κ = (consistency of two observations - chance consistency of two observations) / (1-chance consistency of two observations); κ≤0.40 means poor consistency, 0.40<κ≤0.60 means moderate consistency, 0.60<κ≤0.80 means high consistency, and κ>0.80 means excellent consistency.

[0118] According to the results in Table 11, the positive rate detected by the multiplex qPCR detection method established in the present invention is relatively consistent with the positive rate detected by the PCR detection technology, and the two have good consistency calculated by the Kappa test.

[0119] In summary, the present invention establishes a multiplex qRT-PCR system and method for simultaneously detecting DTMUV, NDRV, DHAV-1 and DHAV-3. The multiplex qRT-PCR detection system and method provided by the present invention can quickly detect the four viruses of DTMUV, NDRV, DHAV-1 and DHAV-3, and can provide effective prevention for these four viruses, which is expected to reduce the economic losses in waterfowl farming.

[0120] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A multiplex qPCR primer probe set for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, characterized in that: The primer probe group includes an upstream primer DTMUV-F, a downstream primer DTMUV-R and a fluorescent probe DTMUV-Probe for detecting duck Tembusu virus; an upstream primer NDRV-F, a downstream primer NDRV-R and a fluorescent probe NDRV-Probe for detecting duck reovirus; an upstream primer DHAV-1-F, a downstream primer DHAV-1-R and a fluorescent probe DHAV-1-Probe for detecting duck hepatitis A virus type 1, and an upstream primer DHAV-3-F, a downstream primer DHAV-3-R and a fluorescent probe DHAV-3-Probe for detecting duck hepatitis A virus type 3; The nucleotide sequence of the upstream primer DTMUV-F for detecting duck Tembusu virus is shown in SEQ ID NO.4, the nucleotide sequence of the downstream primer DTMUV-R is shown in SEQ ID NO.5, and the nucleotide sequence of the fluorescent probe DTMUV-Probe is shown in SEQ ID NO.6; The nucleotide sequence of the upstream primer NDRV-F for detecting duck reovirus is shown in SEQ ID NO.10, the nucleotide sequence of the downstream primer NDRV-R is shown in SEQ ID NO.8, and the nucleotide sequence of the fluorescent probe NDRV-Probe is shown in SEQ ID NO.11; The nucleotide sequence of the upstream primer DHAV-1-F for detecting duck hepatitis A virus type 1 is shown in SEQ ID NO.15, the nucleotide sequence of the downstream primer DHAV-1-R is shown in SEQ ID NO.16, and the nucleotide sequence of the fluorescent probe DHAV-1-Probe is shown in SEQ ID NO.17; The nucleotide sequence of the upstream primer DHAV-3-F for detecting duck hepatitis A virus type 3 is shown in SEQ ID NO.21, the nucleotide sequence of the downstream primer DHAV-3-R is shown in SEQ ID NO.22, and the nucleotide sequence of the fluorescent probe DHAV-3-Probe is shown in SEQ ID NO.

23.

2. The multiplex qPCR primer probe set according to claim 1, characterized in that: The 5' end of the fluorescent probe in the primer probe set is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

3. The multiplex qPCR primer probe set according to claim 2, characterized in that: The fluorescent reporter group includes one of HEX, CY5, ROX or FAM; the fluorescent quencher group includes BHQ1 or BHQ2.

4. A multiplex qPCR kit for detecting duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, characterized in that: The kit comprises the multiplex qPCR primer probe set according to any one of claims 1 to 3.

5. A multiplex qPCR detection system for duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3, characterized in that: The multiplex qPCR detection system comprises the multiplex qPCR primer probe set according to any one of claims 1 to 3.

6. The multiplex qPCR detection system according to claim 5, characterized in that: The multiplex qPCR detection system is based on a total volume of 20 μL and includes the following components: 10 μL One Step PrimeScript qPCR Mix, 2 μL of mixed template, 0.5 μL of 8-12 μM upstream primer DTMUV-F, 0.5 μL of 8-12 μM downstream primer DTMUV-R, and 0.5 μL of 8-12 μM fluorescent probe DTMUV-Probe; 0.8 μL of 8-12 μM upstream primer NDRV-F, 0.7 μL of 8-12 μM downstream primer NDRV-R, and 0.8 μL of 8-12 μM fluorescent probe NDRV-Probe; 0.3 μL of 8-12 μM upstream primer DHAV-1-F, 0.3 μL of 8-12 μM downstream primer DHAV-1-R, and 0.5 μL of 8-12 μM fluorescent probe DHAV-1-Probe. 0.2μL; 8~12μM upstream primer DHAV-3-F 0.6μL, 8~12μM downstream primer DHAV-3-R 0.6μL, 8~12μM fluorescent probe DHAV-13-Probe 0.7μL; 1.6μL ddH2O.

7. The multiplex qPCR detection system according to claim 6, characterized in that: In the mixed template, four pathogenic templates of duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 are mixed in equal volume ratio.

8. A multiplex qPCR detection method for duck Tembusu virus, duck reovirus, duck hepatitis A virus type 1 and duck hepatitis A virus type 3 for non-diagnostic purposes, characterized in that: The steps include: Extract RNA from the sample to be tested; Using the RNA as a template, multiplex qPCR amplification is performed using the multiplex qPCR primer probe set described in any one of claims 1 to 3, or the kit described in claim 4, or the detection system described in any one of claims 5 to 7; After the reaction is completed, whether DTMUV, NDRV, DHAV-1 and DHAV-3 in the sample to be tested are positive is determined based on the amplification curve.

9. The multiplex qPCR detection method according to claim 8, characterized in that: The judgment criteria are as follows: if the sample to be tested shows an amplification curve and Ct≤35, it is judged as positive; if the sample to be tested does not detect an amplification curve or the Ct value is >38, it is judged as negative.

10. The multiplex qPCR detection method according to claim 8, characterized in that: The reaction procedure of the multiplex qPCR amplification was as follows: reverse transcription at 25°C for 10 min, 52°C for 5 min; pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 52°C for 30 s, extension at 72°C for 20 s, and 40 cycles.

Images