Composition and kit for detecting cat stomatitis pathogens and application of composition and kit

Abstract

The invention belongs to the field of molecular biological detection, and particularly relates to a composition and a method for joint detection and distinguishing of feline calicivirus, feline herpes virus, feline leukemia virus and feline human immunodeficiency virus, and application of the composition and the method. According to the combined detection composition provided by the invention, four targets can be simultaneously detected in one-time sample detection through a multiple fluorescent RPA detection technology, the on-machine detection process can be completed within 30 minutes, and the detection method has the characteristics of high flux, short time and low cost. The invention greatly solves the problems of difficult and pain points in the industries of long time, low sensitivity, poor specificity and the like in the current cat stomatitis pathogen identification, improves the accurate and rapid detection of cat stomatitis diseases, and provides a simple and efficient detection reagent and method for scientific research and clinical detection of suspected cat stomatitis diseases.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology detection; specifically, it relates to the detection of pathogens causing feline stomatitis; more specifically, it relates to the detection of four kinds of pathogens causing feline stomatitis, namely feline calicivirus, feline herpesvirus, feline leukemia virus, and feline immunodeficiency virus. Background Art

[0002] With the development of social economy and the improvement of people's living standards, the pet industry in China has developed rapidly, and pet health has increasingly attracted the attention of pet owners and veterinarians. Feline stomatitis is one of the very common diseases in clinical practice. Both stray cats and domestic cats can be affected, with stray cats being more prevalent. Feline oral ulcerative inflammatory disease is an inflammation that occurs in the superficial or deep tissues of the feline oral mucosa. It can be secondary to primary oral diseases or systemic diseases. The manifestations of the inflammation may be local or diffuse. The causes of this disease are relatively complex. For example, the stimulation by various sharp foreign bodies such as bone fragments, thorns, iron wires, steel needles, wooden thorns, etc., damage to uneven teeth, and ingestion of corrosive chemical toxins or deficiency of vitamins A, B2, etc. may all lead to the occurrence of stomatitis. In addition, certain infectious pathogens can also cause stomatitis. The affected cats have varying degrees of reduced or lost appetite, abnormal eating and chewing. Cats with a longer course of disease show significant weight loss, extreme emaciation, listlessness, inflamed, ulcerated, and painful oral mucosa, inability to chew, excessive salivation, common foamy saliva around the lips, and bad breath when exhaling. In severe cases, there are erosions and ulcers, and a small number show flushing and sticky eyes around the eyes. This disease is difficult to cure and prone to recurrence.

[0003] Feline calicivirus (FCV) belongs to the family Caliciviridae and the genus Vesivirus, and is a single-stranded RNA virus. FCV is a feline viral respiratory infectious disease, mainly manifested as oral ulcers, increased ocular and nasal secretions, salivation, conjunctivitis, photophobia, stomatitis, tracheitis, bronchitis, accompanied by biphasic fever. FCV infection is a common disease in cats, with a high incidence. Infection with virulent strains can cause pneumonia, dyspnea, and even death. The main sources of infection are diseased cats and virus-carrying cats. Diseased cats can excrete a large amount of virus with secretions and excreta during the acute phase, directly infecting susceptible cats. Virus-carrying cats can become asymptomatic pathogen carriers after treatment, but they still excrete the virus for a long time after clinical recovery, which is a dangerous source of infection.

[0004] Feline herpesvirus type 1 (FHV-I), also known as feline rhinotracheitis virus, belongs to the family Herpesviridae, subfamily Alphaherpesvirus, and is an enveloped double-stranded DNA virus. FHV-I can cause acute and highly contact upper respiratory tract infections in cats, with a high incidence rate (up to 100%). The virus mainly proliferates in the nose, throat, trachea and bronchi of sick cats, as well as the tongue and conjunctiva. In addition, after the sick cat recovers, FHV-I can still lurk in the trigeminal nerve, optic nerve, tonsils and other parts, causing lifelong virus, and causing secondary infection when the cat has low immunity or a stress response, causing clinical symptoms such as chronic sinusitis, nasal turbinate degeneration, and dendritic keratitis. Suspected cases have been found many times in my country, and the virus has been isolated. However, there are currently no testing requirements and relevant regulations for experimental cats in the national and local standards for experimental animals.

[0005] Feline leukemia virus (FeLV) belongs to the subfamily of Oncovirus, the genus C-type Oncovirus, and the subgenus C-type Oncovirus of mammals. It is a retrovirus with an envelope and a single-stranded RNA virus. FeLV has four subtypes: FeLV-A, FeLV-B, FeLV-C, and FeLV-T. Persistently infected sick cats become a direct source of infection for feline leukemia virus (FeLv). Their saliva, feces, urine, milk, and nasal secretions all contain the virus, which is transmitted to healthy cats through the respiratory and digestive tracts. Isolating confirmed sick cats is an effective way to control feline leukemia virus (FeLv). If no immune response occurs after infection, the virus may cause persistent viremia (40%), making the sick cat a carrier of the virus. Viremia usually occurs 2 to 4 weeks after FeLV infection, and about 50% of cats with persistent viremia die within 1 year after infection with FeLV.

[0006] Feline Immunodeficiency Virus (FIV) is a member of the Lentivirus genus in the Retroviridae family and the feline lentivirus group. Mature FIV particles are round or oval, with a size of 105 nm to 125 nm. Its main components are the envelope, capsid, and core, and it contains reverse transcriptase. It has T-lymphocyte tropism and magnesium ion-dependent reverse transcriptase activity in vitro. The incubation period of FIV is long, and it takes about 3 to 10 years from infection to the appearance of clinical symptoms. A large proportion of infected cats will develop systemic symptoms such as elevated body temperature and generalized lymphadenopathy; stubborn and difficult-to-treat digestive system disorders such as recurrent or persistent chronic stomatitis and chronic diarrhea; chronic and sluggish respiratory system disorders such as uneven breathing and chest tightness; neurological disorders such as irritability, mania, accompanied by meningitis and myelitis; parasitic and sensory system disorders such as dermatitis and cryptococcosis; and locomotor system disorders such as joint swelling, lameness, and low back pain. Due to the destruction of the immune system in infected cats, resulting in functional disorders, it often causes the invasion of other pathogens and various tumors and secondary cross-infections, such as infections by bacteria, etc., which cause the imbalance of the intestinal flora, leading to bacillary dysentery or enteritis in infected cats. The risk of large felids in zoos being infected with FIV is very high, and existing lentivirus vaccines cannot effectively protect felids. Early diagnosis and interruption of the transmission route are the main preventive measures.

[0007] The clinical symptoms of felids infected with the above four pathogens are similar, all showing stomatitis symptoms and often having mixed infections, which causes difficulties in diagnosis.

[0008] Common methods for identifying feline stomatitis diseases include clinical diagnosis, physical and chemical diagnosis, and molecular biology diagnosis. Clinical diagnosis cannot distinguish which pathogen causes the disease and the severity of the condition. Immunostaining techniques (physical and chemical diagnosis) also have problems such as non-specific staining. The colloidal gold test strip technique (physical and chemical diagnosis) has poor sensitivity and is prone to false positive results. The commonly used single PCR method (molecular biology diagnosis) takes a long time. The RPA technique (molecular biology diagnosis) may have amplification bias when detecting multiple targets. Pathogens with low abundance are inhibited by other pathogens with high concentrations, and pathogens below the detection limit may not be detected. Since the RPA technique is usually carried out under isothermal conditions, it cannot avoid the mutual interference between multiple amplification products caused by the differences in Tm values and amplification efficiencies between different pathogen primer sets during multiple detections, like ordinary PCR amplification by adjusting the annealing temperature and cooling rate during the reaction. It is also very difficult to obtain highly specific RPA amplification primers suitable for multiple detections. Therefore, it is necessary to establish a rapid early diagnosis method to take effective prevention and control measures as soon as possible and reduce the harm caused by these diseases to the cat breeding industry. Summary of the Invention

[0009] In view of the above existing deficiencies, the present invention provides a composition for detecting feline stomatitis pathogens, including at least one set of primers and probes for detecting the following pathogens:

[0010] Upstream and downstream primers and probes for detecting feline herpesvirus as shown in SEQ ID NO: 1-3;

[0011] Upstream and downstream primers and probes for detecting feline calicivirus as shown in SEQ ID NO: 4-6;

[0012] Upstream and downstream primers and probes for detecting feline leukemia virus as shown in SEQ ID NO: 7-9;

[0013] Upstream and downstream primers and probes for detecting feline immunodeficiency virus as shown in SEQ ID NO: 10-12.

[0014] Furthermore, a composition for detecting feline stomatitis pathogens includes at least two sets of primers and probes for detecting the following pathogens:

[0015] Upstream and downstream primers and probes for detecting feline herpesvirus as shown in SEQ ID NO: 1-3;

[0016] Upstream and downstream primers and probes for detecting feline calicivirus as shown in SEQ ID NO: 4-6;

[0017] Upstream and downstream primers and probes for detecting feline leukemia virus as shown in SEQ ID NO: 7-9;

[0018] Upstream and downstream primers and probes for detecting feline immunodeficiency virus as shown in SEQ ID NO: 10-12.

[0019] Furthermore, a composition for detecting feline stomatitis pathogens includes at least three sets of primers and probes for detecting the following pathogens:

[0020] Upstream and downstream primers and probes for detecting feline herpesvirus as shown in SEQ ID NO: 1-3;

[0021] Upstream and downstream primers and probes for detecting feline calicivirus as shown in SEQ ID NO: 4-6;

[0022] Upstream and downstream primers and probes for detecting feline leukemia virus as shown in SEQ ID NO: 7-9;

[0023] Upstream and downstream primers and probes for detecting feline immunodeficiency virus as shown in SEQ ID NO: 10-12.

[0024] Furthermore, a composition for detecting feline stomatitis pathogens includes:

[0025] Forward and reverse primers and probes for feline herpesvirus as shown in SEQ ID NO: 1-3;

[0026] Forward and reverse primers and probes for feline calicivirus as shown in SEQ ID NO: 4-6;

[0027] Forward and reverse primers and probes for feline leukemia virus as shown in SEQ ID NO: 7-9;

[0028] Forward and reverse primers and probes for feline immunodeficiency virus as shown in SEQ ID NO: 10-12.

[0029] The above-mentioned combined detection composition provided by the present invention can, by using multiplex fluorescence RPA detection technology, achieve the simultaneous detection of 4 targets in 1 sample detection, complete the detection process on the machine within 30 minutes, and the detection method has the characteristics of high throughput, short time and low cost. The present invention greatly solves the problems of long time, low sensitivity and poor specificity in the current industry for differentiating the pathogenic agents of feline stomatitis, and greatly improves the accurate and rapid detection of feline stomatitis diseases. The present invention provides a simple and efficient detection reagent and method for the detection of suspected feline stomatitis diseases in scientific research and clinical practice.

[0030] Furthermore, the probe is labeled with a fluorescent group, a quenching group and a 3'-terminal C3-spacer and modified with tetrahydrofuran.

[0031] Furthermore, after being labeled and modified, the probe SEQ ID NO: 3 is CGTGACCCTAATCATAGATAGACACCCTCTCGCCTCTC[P-dT]G[TH F][B-dT]CTGTTTCC-C3 Spacer;

[0032] After being labeled and modified, the probe SEQ ID NO: 6 is TTGGATGAACTACCCGCCAATCAGCATGTGGTAACCGT[P-dT]A[THF][B-dT]TCGGT-C3 Spacer;

[0033] After being labeled and modified, the probe SEQ ID NO: 9 is TAAAACGAGCCATCAGCCCCCAACCGGCGCGCAAGTCTT[P-dT]G[THF][B-dT]GAGACTT-C3 Spacer;

[0034] The probe SEQ ID NO: 12, after being labeled and modified, is AGATAATATATTACAGCCATTCATTAAACAAAA[P-dT]T[THF][B-dT]GAATTAGATATT-C3 Spacer;

[0035] wherein, P is a fluorophore, THF is tetrahydrofuran, and B is a quenching group.

[0036] It should be noted that the above "P" only refers to the fluorophore, and does not limit that the fluorophores of the above 4 probes are the same. The same applies to "B". For example, P of probe SEQ ID NO: 3 can be any one of ATTO425, Quasar705, FAM, HEX, ROX, and CY5; P of probe SEQ ID NO: 6 can be any one of ATTO425, Quasar705, FAM, HEX, ROX, and CY5; P of probe SEQ ID NO: 9 can be any one of ATTO425, Quasar705, FAM, HEX, ROX, and CY5; P of probe SEQ ID NO: 12 can be any one of ATTO425, Quasar705, FAM, HEX, ROX, and CY5.

[0037] Furthermore, the fluorophores between the probes for detecting different viruses in the composition of the present invention are different from each other and do not interfere with each other.

[0038] In the present invention, "different from each other and do not interfere with each other" means that the fluorophores used for each probe in the composition are different, and do not affect the detection of each other, that is, different channels can be used for detection. For example, ATTO425, Quasar705, FAM, HEX, ROX, and CY5 can be used. The absorbance values of these groups are not close, and different channels can be selected, so they do not interfere with each other.

[0039] Furthermore, in some embodiments, the composition of the present invention may simultaneously include one or more groups of the above primer and probe pairs. In the present invention, "group" refers to the upstream primer, downstream primer, and probe that match each other for detecting one target.

[0040] The composition of the present invention can be arbitrarily combined into any combination form for detecting corresponding 4 targets. Those skilled in the art can combine according to needs. To detect which targets, just combine the primer and probe pairs corresponding to the targets. These combination forms are all included in the present invention.

[0041] For example, it may include any 3 groups of the above 4 groups of primers and probes, any 2 groups of the above 4 groups of primers and probes, or any 1 group of the above 4 groups of primers and probes.

[0042] In some specific embodiments, the compositions of the present invention are used in fluorescence RPA technology.

[0043] In a specific embodiment, the fluorophore of the probe for feline herpesvirus is FAM, the fluorophore of the probe for feline calicivirus is HEX, the fluorophore of the probe for feline leukemia virus is ROX, and the fluorophore of the probe for feline immunodeficiency virus is CY5.

[0044] Furthermore, the 3'-end of the probe also has a quenching group, such as BHQ1 or BHQ2.

[0045] Furthermore, the 3'-end of the probe is C3 spacer.

[0046] Furthermore, the dosage of a single primer in the composition is 0.02 - 0.25 μM; the dosage of a single probe in the composition is 0.02 - 0.25 μM.

[0047] In a specific embodiment, the components of the composition of the present invention are respectively present in separate packages.

[0048] In a specific embodiment, the components of the composition of the present invention are present in a package.

[0049] Furthermore, the components of the composition of the present invention are present in a mixed form.

[0050] In a second aspect, the present invention provides the use of the above composition of the present invention in the preparation of a kit for detecting feline stomatitis pathogens, wherein the feline stomatitis pathogens are one or more of feline calicivirus, feline herpesvirus, feline leukemia virus, and feline immunodeficiency virus.

[0051] In a third aspect, the present invention provides a kit for detecting feline stomatitis pathogens, and the kit includes the above composition of the present invention.

[0052] Furthermore, the kit also includes a negative control and a positive control.

[0053] In a specific embodiment, the negative control is at least one of DEPC water and physiological saline. The positive control is at least one of fragment plasmids or fragment DNA and fragment RNA of feline calicivirus, feline herpesvirus, feline leukemia virus, and feline immunodeficiency virus.

[0054] Further, the kit further includes a fluorescence reaction solution, which includes at least one of recombinase, reverse transcriptase, DNA polymerase, single-strand binding protein, and exonuclease III.

[0055] Further, the fluorescence reaction solution further includes Tris-HCl, dNTPs, KCl, glycerol, and Proclin 300.

[0056] In a specific embodiment, the fluorescence reaction solution includes Tris-HCl, dNTPs, KCl, glycerol, Proclin 300, recombinase, reverse transcriptase, DNA polymerase, single-strand binding protein, and exonuclease III.

[0057] Further, the kit further includes at least one of magnesium acetate and nuclease-free water.

[0058] Further, the kit further includes a nucleic acid release reagent and a nucleic acid extraction reagent.

[0059] Further, the system of the kit for RPA detection, calculated by 50 μL, includes the following components: 20 μL - 30 μL of fluorescence reaction solution, 0.25 μL - 1 μL of each upstream primer (20 μM), 0.25 μL - 1 μL of each downstream primer (20 μM), 0.25 μL - 1 μL of each probe (20 μM), and 2.2 μL - 2.7 μL of magnesium acetate (280 mmol / L).

[0060] Furthermore, the system of the kit for RPA detection, calculated by 50 μL, includes the following components: 25 μL of fluorescence reaction solution, 0.5 μL of 20 μM upstream primer per strip, 0.5 μL of 20 μM downstream primer per strip, 0.25 μL of 20 μM probe per strip, 10 μL of template, and the remainder is made up with nuclease-free water. Add 2.5 μL of magnesium acetate (280 mmol / L) to start the experiment before the experiment begins.

[0061] Fourthly, provided is a use of the above composition for preparing a reagent for detecting feline stomatitis pathogens, and the detection includes the following steps:

[0062] S1. Extract or release the nucleic acid of the sample to be tested;

[0063] S2. Perform fluorescence RPA analysis on the nucleic acid obtained in step S1 using the above composition or the above kit of the present invention;

[0064] S3. Obtain and analyze the results.

[0065] In the present invention, the sample for detection may be oral (oral mucosa, tongue, gum) secretion, nasal secretion, eye secretion, whole blood, serum, etc., but not limited thereto.

[0066] Further, the reaction conditions for the fluorescence RPA detection are as follows:

[0067] Amplify at 42°C for 30 s, with a total of 40 cycles. Description of the Drawings

[0068] Figure 1 It is a diagram showing the detection result of the composition of the present invention;

[0069] Figures 2 to 5 It is a diagram showing the detection result of the composition of the present invention (in the FAM channel for feline herpesvirus, in the HEX channel for feline calicivirus, in the ROX channel for feline leukemia virus, and in the CY5 channel for feline immunodeficiency virus, respectively and in sequence);

[0070] Figures 6 to 9 It is a diagram showing the sensitivity detection result of the composition of the present invention (in the FAM channel for feline herpesvirus, in the HEX channel for feline calicivirus, in the ROX channel for feline leukemia virus, and in the CY5 channel for feline immunodeficiency virus, respectively and in sequence);

[0071] Figure 10 It is the specific detection result of the composition of the present invention;

[0072] Figure 11 It is the detection result of the comparative composition of the present invention. Detailed Embodiments

[0073] To make the present invention easier to understand, the present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention. Unless otherwise defined, the professional terms used hereinafter have the same meaning as understood by those of ordinary skill in the art; unless otherwise specified, the raw materials and reagents involved herein can be purchased from the market or prepared by known methods.

[0074] Professional Terms

[0075] The RPA technology (full name: "Recombinase Mediated Amplification technology") is known as a nucleic acid detection technology that can replace the PCR technology. The RPA technology is a technology that can rapidly amplify nucleic acids at a constant temperature. The RPA technology mainly relies on three enzymes: recombinase that can bind primers, single-stranded DNA binding protein (SSB), and DNA polymerase; the optimal reaction temperature of the mixture of these three enzymes is around 37°C. The principle of the RPA technology is as follows: the protein-DNA complex formed by the binding of recombinase and primers can search for homologous sequences in double-stranded DNA. Once the primers search for homologous sequences that are completely complementary to them, with the help of single-stranded DNA binding protein, the double-stranded DNA template is unwound, the primers are paired and bound to the homologous sequences, and DNA synthesis is initiated under the action of DNA polymerase to exponentially amplify the target region on the double-stranded DNA template. At the same time, the replaced DNA strand binds to SSB to prevent further replacement. In the amplification system of the RPA technology, a synthesis event is initiated by two opposite primers. The whole process proceeds very fast, and usually detectable levels of amplification products can be obtained within 30 minutes. Compared with the PCR technology, the whole reaction of the RPA technology does not require high-temperature cycling, is simple and fast, and is therefore particularly suitable for use in non-laboratory testing sites with a large number of samples.

[0076] Example 1: Primers and probes used in the present invention

[0077] Table 1:

[0078]

[0079]

[0080] Among them, the fluorophore of feline herpesvirus is FAM; the fluorophore of feline calicivirus is HEX; the fluorophore of feline leukemia virus is ROX; the fluorophore of feline immunodeficiency virus is CY5.

[0081] The probe SEQ ID NO: 3 after being labeled and modified is CGTGACCCTAATCATAGATAGACACCCTCTCGCCTCTC[FAM-dT]G[THF][BHQ1-dT]CTGTTTCC-C3 Spacer;

[0082] The probe SEQ ID NO: 6 after being labeled and modified is TTGGATGAACTACCCGCCAATCAGCATGTGGTAACCGT[HEX-dT]A[THF][BHQ1-dT]TCGGT-C3 Spacer;

[0083] The probe SEQ ID NO: 9 after being labeled and modified is TAAAACGAGCCATCAGCCCCCAACCGGCGCGCAAGTCTT[ROX-dT]G[THF][BHQ2-dT]GAGACTT-C3 Spacer;

[0084] The probe SEQ ID NO: 12 after being labeled and modified is AGATAATATATTACAGCCATTCATTAAACAAAA[CY5-dT]T[THF][BHQ2-dT]GAATTAGATATT-C3 Spacer.

[0085] Example 2: Method for detecting feline stomatitis pathogen

[0086] The test sample is a mixed sample of pharyngeal, nasal, and ocular swabs / EDTA-anticoagulated whole blood (serum). DNA is extracted using the magnetic bead method, and the following operations are performed in the sample processing room:

[0087] 1.1 Take out the pre-packaged 96-well deep plate reagent in the kit, equilibrate it to room temperature, flick the liquid that may adhere to the deep plate sealing film or well wall to the bottom, and let it stand for 1 - 3 min.

[0088] 1.2 Remove the sealing film; add the sample and proteinase K to wells A2 - H2, A8 - H8 of the deep plate; the recommended sample addition amount is 200 μL / well and proteinase K is 40 μL / well.

[0089] 1.3 Turn on the extractor, place the deep plate and magnetic sleeve in the corresponding positions of the instrument, and start the program.

[0090] 1.4 After about 15 - 30 min, the extraction program ends.

[0091] 1.5 Take out the deep plate and transfer the nucleic acid for standby.

[0092] The real-time fluorescence RPA reaction system is shown in Table 2:

[0093] Table 2:

[0094] Component Volume and concentration in each reaction Primer (20 pmol / μL) 0.5 μL per strip Probe (20 pmol / μL) 0.25 μl per strip Fluorescence reaction solution 25 μL 280 mmol / L magnesium acetate 2.5ul Template 10ul Nuclease-free water To 50 ul

[0095] Reaction amplification program: Amplify at 42°C for 30 s, for a total of 40 cycles.

[0096] The above fluorescence reaction solution includes Tris-HCl, dNTPs, KCl, glycerol, proclin 300, recombinase, reverse transcriptase, DNA polymerase, single-strand binding protein, exonuclease III.

[0097] Result analysis:

[0098] The detection signals of the target targets are the amplification curves of the FAM, HEX, ROX, and CY5 channels;

[0099] Setting of Baseline: Baseline is generally set to 3 - 15 cycles, and can be adjusted according to the actual situation specifically. The adjustment principle is: select the area where the fluorescence signal is relatively stable before exponential amplification, the starting point (Start) avoids the signal fluctuation in the initial stage of fluorescence acquisition, and the ending point (End) is 1 - 2 cycles less than the Ct of the sample with the earliest exponential amplification. Setting of Threshold: The setting principle is that the threshold line just exceeds the highest point of the normal negative control.

[0100] 3) Judgment of positive and negative results:

[0101]

[0102] Example 3: Detection results of the test samples of the composition of the present invention

[0103] Using the primers and probes shown in Example 1, detect and distinguish the mixed samples and single samples of feline calicivirus, feline herpesvirus, feline leukemia virus, and feline immunodeficiency virus according to the method of Example 2. The detection results are as Figures 1 to 5 shown. Figure 1 are the detection results of the mixed samples, Figures 2 - 5 are respectively the detection results of the single samples of different concentrations of feline herpesvirus, feline calicivirus, feline leukemia virus, and feline immunodeficiency virus detected in separate tubes. Sanger sequencing was performed on the positive samples, and the sequencing results were completely consistent with the amplification results, indicating that the kit of the present invention has high accuracy in detecting 1 target alone and 4 targets simultaneously.

[0104] Example 4. Sensitivity of the combination of the present invention

[0105] Perform LOD (sensitivity) detection on each virulence gene. The detection results show that the composition can still accurately detect each channel of samples as low as 1000 copies / mL, indicating that the sensitivity of the composition of the present invention is 1000 copies / mL, as Figures 6 to 9 shown.

[0106] Example 5. Specificity of the combination of the present invention

[0107] For cross - reaction, mycoplasma, chlamydia, and feline panleukopenia virus samples with nucleic acid sequences having homology and likely to cause the same or similar clinical symptoms are used as test samples for specificity detection. The results are as Figure 10 shown, and it can be seen from Figure 10 that the composition of the present invention has good specificity.

[0108] Comparative Example 1. The remaining primers and probes with poor effects designed in the present invention

[0109] Due to the base complementary pairing principle, dimers may form between primers and / or probes, but this probability is very low and can be excluded at the initial design stage. However, when multiple pathogens are jointly detected, there are numerous primers and probes, and it is easy for dimers to occur between primers and primers, probes and probes, or primers and probes. To ensure the conservativeness of the design (conservativeness is crucial for the accuracy of detection) and also consider the mutual interference between different primers and probes, it is necessary to carefully design the primers and probes.

[0110] Therefore, the inventors also designed some other primers and probes (sequences not shown) to form different detection systems, which are also used to detect feline calicivirus, feline herpesvirus, feline leukemia virus, and feline immunodeficiency virus. The results are as Figure 11 shown. It can be seen from the figure that the fluorescence increase of the detection amplification curve is low and the sensitivity detection effect is poor, and there is even no amplification curve for some targets. Therefore, the overall detection effect is poor.

[0111] As described above, the above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the said claims.

Claims

1. A composition for detecting feline stomatitis pathogens, characterized in that: Includes at least one set of primers and probes for the detection of the following pathogens: Upstream and downstream primers and probes for detecting feline herpes virus as shown in SEQ ID NOs: 1 to 3; Upstream and downstream primers and probes for detecting feline calicivirus as shown in SEQ ID NOs: 4 to 6; Upstream and downstream primers and probes for detecting feline leukemia virus as shown in SEQ ID NOs: 7 to 9; The upstream and downstream primers and probes for detecting feline immunodeficiency virus are shown in SEQ ID NOs: 10-12.

2. The composition according to claim 1, characterized in that The composition includes upstream and downstream primers and probes as shown in SEQ ID NOs: 1-3, SEQ ID NOs: 4-6, SEQ ID NOs: 7-9 and SEQ ID NOs: 10-12.

3. The composition according to claim 1 or 2, characterized in that The probe is labeled with a fluorescent group, a quenching group and a 3'-terminal C3 spacer, and is modified with tetrahydrofuran.

4. The composition according to claim 3, characterized in that The probe SEQ ID NO: 3 is labeled and modified to CGTGACCCTAATCATAGATAGACACCCTCTCGCCTCTC[P-dT]G[TH F][B-dT]CTGTTTCC-C3Spacer; The probe SEQ ID NO: 6 is labeled and modified to TTGGATGAACTACCCGCCAATCAGCATGTGGTAACCGT[P-dT]A[THF][B-dT]TCGGT-C3Spacer; The probe SEQ ID NO: 9 is labeled and modified to TAAAAACGAGCCATCAGCCCCCAACCGGCGCGCAAGTCTT[P-dT]G[THF][B-dT]GAGACTT-C3Spacer; The probe SEQ ID NO: 12 is labeled and modified to AGATAATATATTACAGCCATTCATTAAACAAAA[P-dT]T[THF][B-dT]GAATTAGATATT-C3Spacer; Wherein, P is a fluorescent group, THF is tetrahydrofuran, and B is a quenching group; the fluorescent groups of the probes used by the composition to detect different viruses are different from each other and do not interfere with each other.

5. The composition according to claim 4, characterized in that The probe SEQ ID NO: 3 is labeled and modified to CGTGACCCTAATCATAGATAGACACCCTCTCGCCTCTC[FAM-dT]G[THF][BHQ1-dT]CTGTTTCC-C3 Spacer; The probe SEQ ID NO: 6 is labeled and modified to TTGGATGAACTACCCGCCAATCAGCATGTGGTAACCGT[HEX-dT]A[THF][BHQ1-dT]TCGGT-C3 Spacer; The probe SEQ ID NO: 9 is labeled and modified to TAAAAACGAGCCATCAGCCCCCAACCGGCGCGCAAGTCTT[ROX-dT]G[THF][BHQ2-dT]GAGACTT-C3 Spacer; The probe SEQ ID NO: 12 is labeled and modified to AGATAATATATTACAGCCATTCATTAAACAAAA[CY5-dT]T[THF][BHQ2-dT]GAATTAGATATT-C3 Spacer.

6. The composition according to claims 1 to 5, characterized in that The components of the composition are present in admixture.

7. Use of the composition according to any one of claims 1 to 6 in preparing a kit for detecting feline stomatitis pathogens, characterized in that: The feline stomatitis pathogen is one or more of feline calicivirus, feline herpesvirus, feline leukemia virus and feline AIDS virus.

8. A kit for detecting pathogens of feline stomatitis, characterized in that: The kit comprises the composition according to any one of claims 1 to 6.

9. The kit according to claim 8, characterized in that The kit also includes a fluorescent reaction solution, which includes Tris-HCl, dNTPs, KCl, glycerol, proclin 300, recombinase, reverse transcriptase, DNA polymerase, single-stranded binding protein and exonuclease III.

10. A use of a composition for preparing a reagent for detecting feline stomatitis pathogens, characterized in that: The detection comprises the following steps: S1. Extract or release nucleic acid from the sample to be tested; S2. Performing fluorescent RPA analysis on the nucleic acid obtained in step S1 using the composition according to any one of claims 1 to 6 or the kit according to claim 8 or 9; S3. Obtain and analyze the results.

Images