Preparation method of DNA tetrahedron-small nucleic acid drug compound suitable for industrial production

Abstract

The invention discloses a preparation method of a DNA tetrahedron-small nucleic acid drug compound suitable for industrial production, which comprises the following steps: adding four DNA single strands into a TM buffer solution, maintaining the temperature at 70 DEG C for 10 minutes, cooling to 4-25 DEG C, adding an antisense strand of siRNA, and maintaining the temperature for more than 20 minutes to obtain the DNA tetrahedron-small nucleic acid drug compound. One of the four DNA single strands is connected with a positive-sense strand of siRNA (small interfering Ribonucleic Acid). According to the preparation process provided by the invention, the yield of the TDNs-small nucleic acid drug compound can exceed 50%, the purity can reach 80% or above, and under the condition of a conventional TDNs preparation process, the TDNs-small nucleic acid drug has an obvious degradation process, so that the yield and the purity of the product are greatly influenced, and the requirements of process production cannot be met.

Description

Technical Field

[0001] The invention belongs to the field of nucleic acid drugs, and in particular relates to a method for preparing a DNA tetrahedron-small nucleic acid drug complex suitable for industrial production. Background Art

[0002] DNA tetrahedron (Tetrahedral DNA Nanostructures, TDNs) is a tetrahedral structure formed by four single-stranded DNAs through denaturation and renaturation and then through complementary base pairing between chains. It is easy to synthesize and has high biocompatibility. It not only has good biological activity, but also can be used as a carrier to efficiently deliver small nucleic acid drugs. The applicant's previous patent CN109646450B disclosed the use of TDNs in the preparation of drugs for treating corneal damage, the patent CN112007044B disclosed the TDNs-miR155 complex and its use in the preparation of drugs for preventing or treating wet macular degeneration, and the patent CN112843085B disclosed the TDNs-miR22 complex and its use in the preparation of drugs for treating optic nerve damage. In addition to the miRNA carried in the aforementioned patents, the applicant also successfully achieved intracellular delivery of siRNA based on TDNs and verified its gene silencing effect in the recently disclosed invention patent applications CN115969988A and CN115896107A.

[0003] As disclosed in the prior art, the synthesis process of TDNs mainly includes two stages: denaturation and annealing. In the denaturation stage, the four single-stranded DNAs of the DNA tetrahedron need to be placed at a temperature sufficient to denature them in an equimolar ratio, and then the temperature is lowered to anneal them to form a DNA tetrahedron structure through complementary base pairing between the chains. Among them, the reported TDNs synthesis process is mostly maintained at 95°C for 10 minutes, and then quickly cooled to 4°C for 20 minutes, corresponding to the denaturation process and annealing process respectively. In addition, the prior art documents such as CN115487309A and CN113134093B disclose the preparation of DNA tetrahedron structure by gradient annealing.

[0004] However, the inventors of this application have found that the conventional TDNs synthesis process or the reported gradient annealing method is only suitable for the laboratory-scale synthesis of individual TDNs. When it is loaded with active ingredients, especially small nucleic acid drugs, the aforementioned denaturing annealing conditions will cause serious degradation of small nucleic acid drugs during the synthesis process, which will significantly affect the yield and purity of the product and cannot meet the requirements for the synthesis of industrial-scale TDN-small nucleic acid drug complexes. On this basis, developing a synthesis process for TDN-small nucleic acid drug complexes that can ensure the stability of small nucleic acid drugs and meet the needs of industrial-scale product development is an urgent problem to be solved in the industry, and it is also a key link in realizing the industrialization of TDN-small nucleic acid drug complexes. Summary of the invention

[0005] In response to the above technical problems, the present invention provides a synthesis process of TDNs-small nucleic acid drug complexes that meets the requirements of industrial production, has high product purity, high yield, simple process and low energy consumption. Compared with the traditional TDNs synthesis process, the synthesis process can significantly improve the product purity and yield of TDNs-small nucleic acid drug complexes, and the process conditions are simple and easy to implement, which can reduce the energy consumption required in the industrial production process.

[0006] The present invention provides a method for preparing a DNA tetrahedron-small nucleic acid drug complex suitable for industrial production, which comprises the following steps:

[0007] Take four DNA single strands and add them to TM buffer, maintain at 70℃ for 10min, then cool to 4-25℃ and add the antisense strand of siRNA, maintain for more than 20min, and you have it.

[0008] One of the four DNA single strands is connected to the positive strand of siRNA.

[0009] Furthermore, the temperature is lowered to 25°C.

[0010] Furthermore, the positive strand of the siRNA is connected to one of the four single-stranded DNA strands via a linker.

[0011] Furthermore, the nucleotide sequence of the linker is TTTTT.

[0012] Furthermore, the four DNA single strands are fed in a molar ratio of 1:1:1:1.

[0013] Furthermore, the nucleotide sequences of the four DNA single strands are shown in SEQ ID NOs. 1 to 4 respectively.

[0014] Furthermore, the nucleotide sequence of the DNA single strand connected to the siRNA sense strand among the four DNA single strands is shown as SEQ ID NO.1.

[0015] Furthermore, the nucleotide sequence of the positive strand of the siRNA is shown in SEQ ID NO:5, which is connected to the single-stranded DNA shown in SEQ ID NO.1 through a linker sequence "-TTTTT-", and the resulting connected sequence is shown in SEQ ID NO.7; the nucleotide sequence of the antisense strand of the siRNA is shown in SEQ ID NO:6.

[0016] Furthermore, the step also includes purification; the purification is to purify the cooling and annealing liquid using an AKTA pure150 protein purification system.

[0017] Finally, the present invention provides a DNA tetrahedron-small nucleic acid drug complex, which is prepared according to the above-mentioned preparation method.

[0018] The preparation method of the DNA tetrahedron-small nucleic acid drug complex of the present invention explores a process method that can be applied to TDNs carrying small nucleic acid drugs on the basis of the traditional TDNs process, significantly improving the yield and purity of the TDNs-small nucleic acid drug complex, making it suitable for industrial-scale production requirements. Specifically, the preparation process provided by the present invention can make the yield of the TDNs-small nucleic acid drug complex exceed 50% and the purity reach more than 80%. Under the conventional TDNs preparation process conditions, the TDNs-small nucleic acid drug will undergo an obvious degradation process, resulting in a significant impact on the product yield and purity, and unable to meet the needs of process production.

[0019] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0020] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. DETAILED DESCRIPTION

[0021] Example - Preparation process of TDNs-siRNA

[0022] Assembly process:

[0023] (1) Before assembly, confirm that all batches of single-chain (S1R, S2, S3, S4, RF) used meet the quality standards. According to the labeled amount of single-chain, take 1 μmol of S1R, S2, S3, S4, and RF, add 10 ml of water for injection, vortex and completely dissolve, then take samples to test the single-chain concentration, and dilute with water for injection to a final concentration of 100 μM according to the test concentration.

[0024] (2) Take 10 ml of each dissolved S1R, S2, S3, and S4 single chains (concentration of 100 μM), add them to 0.95 L TM buffer, stir to mix, and take samples from the top, middle, and bottom of the reactor for testing. After mixing evenly, set the operation program to denature at 70°C for 10 min, cool to 25°C, add 10 ml of RF single chain (concentration of 100 μM), and finally maintain 25°C for annealing for 20 min. After the operation is completed, collect the feed liquid from the bottom of the reactor and temporarily store it at 2-8°C for purification.

[0025] Purification process:

[0026] Use AKTA pure150 protein purification system and perform the following steps

[0027] (1) System flushing: Use ultrapure water at a flow rate of 75 ml / min to flush pump A and pump B for 1 min each, and then flush the chromatography system at a flow rate of 10 ml / min, with pump A and pump B in a 50% ratio for 10 min each; then adjust the flow rate to 1 ml / min, connect the Source 15Q, 4.6 / 100PE prepacked column to the protein purification system in a drop-to-drop manner, and flush the chromatography column at a flow rate of 2 ml / min for 5CV until the UV baseline is stable and the conductivity value is 0 mS / cm.

[0028] (2) Balancing the column: Place the balancing solution into the inlet valve of pump A and the eluent into the inlet of pump B, and equilibrate the column at a flow rate of 2 ml / min and 100% A until the UV baseline is stable;

[0029] (3) Sample loading: After the column is balanced, the assembled sample is loaded from the inlet of pump A at a flow rate of 2 ml / min. After the loading is completed, continue to flush with ion exchange equilibrium solution for 5CV until the UV baseline and conductivity baseline are stable;

[0030] (4) Elution: Manual command is set to linear elution 0-70% B, 5 min to elute impurities with weaker binding force, then 70-80% B, 17 min gradient elution is used to elute the target product. After the gradient is completed, 100% B is used to elute impurities with stronger binding force. The main peak is collected in a separate collection method, and the collected samples are tested for purity respectively; the samples are combined according to the purity test results and temporarily stored in a 2-8°C refrigerator for ultrafiltration concentration and buffer replacement.

[0031] The nucleotide sequences of the four single strands of TDNs (5′→3′) are as follows:

[0032] S1:ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQ ID NO. 1);

[0033] S2:ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGAT TCAGACTTAGGAATGTTCG (SEQ ID NO. 2);

[0034] S3:ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQ ID NO.3);

[0035] S4:ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG (SEQ ID NO. 4);

[0036] The siRNA has the following sequence (5′→3′)

[0037] Sense strand: GGCAGAAACUAGAUGAUCAGA (SEQ ID NO: 5)

[0038] Antisense strand (RF): UGAUCAUCUAGUUUCUGCCGA (SEQ ID NO: 6)

[0039] The positive strand is connected to S1 through the linker sequence -TTTTT-, and the resulting S1R sequence is: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACA TTCCTAAGTCTGAATTTTTGGCAGAAACUAGAUGAUCAGA (SEQ ID NO: 7)

[0040] Comparative Example - Preparation Process of TDNs-siRNA

[0041] Assembly process:

[0042] (1) Based on the example, the denaturation temperature was adjusted to 60°C and the annealing temperature was maintained at 25°C.

[0043] (2) Based on the example, the denaturation temperature was adjusted to 80°C and the annealing temperature was maintained at 25°C.

[0044] (3) Based on the example, the denaturation temperature was adjusted to 95°C and the annealing temperature was maintained at 25°C.

[0045] (4) Based on the example, the denaturation temperature was maintained at 70°C and the annealing temperature was adjusted to 4°C.

[0046] (5) Based on the example, the denaturation temperature was maintained at 70°C and the annealing temperature was adjusted to 10°C.

[0047] (6) Based on the example, the denaturation temperature was adjusted to 60°C and the annealing temperature was adjusted to 4°C.

[0048] (7) Based on the example, the denaturation temperature was adjusted to 60°C and the annealing temperature was adjusted to 10°C.

[0049] (8) Based on the example, the denaturation temperature was adjusted to 80°C and the annealing temperature was adjusted to 4°C.

[0050] (9) Based on the example, the denaturation temperature was adjusted to 80°C and the annealing temperature was adjusted to 10°C.

[0051] (10) Based on the example, the denaturation temperature was adjusted to 95°C and the annealing temperature was adjusted to 4°C.

[0052] (11) Based on the example, the denaturation temperature was adjusted to 95°C and the annealing temperature was adjusted to 10°C.

[0053] (12) Prepare the required TDNs-siRNA complex with reference to the denaturation annealing process disclosed in Example 1 of the specification of CN115487309A, as follows: Take 10 ml of each dissolved S1R, S2, S3, and S4 single chains (concentration of 100 μM), add them to 0.95 L TM buffer, and anneal in a reactor from 95 °C to room temperature. The specific process is: 80 °C for 5 min → 65-61 °C for 5 min → 60-51 °C for 60 min → 50-38 °C for 20 min → 37-25 °C for 10 min → 25 °C, add 10 mL of RF single chain and maintain this temperature.

[0054] (13) The desired TDNs-siRNA complex was prepared by referring to the denaturation annealing process disclosed in Example 3 of the specification of CN113134093B, as follows: 10 ml of each of the dissolved S1R, S2, S3, and S4 single chains (concentration of 100 μM) were added to 0.95 L of TM buffer, and the temperature was raised to 95°C in a reactor and maintained for 5 min, then lowered to 54°C and maintained for 30 min, then lowered to 4°C and 10 mL of the RF single chain was added and maintained for 30 sec, and finally the temperature was raised to 24°C and maintained.

[0055] Purification process:

[0056] Each comparative example adopts the same purification steps as the examples.

[0057] Test Example 1 - Single Chain Stability Test

[0058] The inventors of the present application found that when TDNs-siRNA complexes were prepared under the TDNs synthesis conditions disclosed in the prior art, the yield and purity of the product were not ideal and could not meet the industrial production needs of TDNs-siRNA complexes. In order to explore the reasons, the inventors clarified the stability of each reaction raw material at the denaturation temperature through a single-strand stability test.

[0059] The specific test method is as follows:

[0060] 1. Prepare S1R, S2, S3, S4, and RF into 1 μM solutions using TM buffer;

[0061] 2. Divide the five prepared single-stranded solutions into five portions, heat them in a PCR instrument at set temperatures of 20°C, 40°C, 60°C, 80°C, and 100°C for 30 minutes, and then take them out for HPLC detection.

[0062] 3. The chromatographic conditions for detection are:

[0063] Chromatographic column: Waters Oligonucleotide BEH(4.6mm×50mm,2.5μm)

[0064] Mobile phase A: 100 mM glacial acetic acid-triethylamine solution (PH 7.0)

[0065] Mobile phase B: acetonitrile

[0066] Flow rate: 1.0ml / min; Detection wavelength: 260nm; Column temperature: 60℃; Injection volume: 10ul Elution procedure:

[0067] Time (min) Mobile phase A Mobile phase B 0 95 5 20 70 30 25 95 5

[0068] The experimental results are as follows:

[0069]

[0070] As shown in the results in the table above, the four single-stranded DNAs of TDNs have good heat resistance, so they can remain stable under conventional TDNs synthesis conditions and form a tetrahedral structure through annealing self-assembly. However, when the required TDNs need to form a complex with small nucleic acid drugs, the simple siRNA antisense chain (RF) has extremely poor stability under high temperature conditions. As the heating temperature increases, its degradation level increases significantly. By connecting the S1 single strand with the siRNA sense chain (S1R), its stability is greatly improved, but it still cannot withstand conventional TDNs synthesis conditions and meet the requirements of industrial production.

[0071] Test Example 2 - Purity / Yield Calculation

[0072] The inventors calculated the yield of the purified products in the examples and comparative examples by (yield % = final product amount × purity % / theoretical product amount), and quantitatively detected the purity of the products by HPLC, and recorded the impurity levels.

[0073] The elution conditions were as follows:

[0074] Mobile phase A: 100 mM glacial acetic acid-triethylamine solution (pH = 7.0);

[0075] Mobile phase B: acetonitrile;

[0076] Flow rate: 1mL / min Detection wavelength: 260nm Column temperature: 60℃ Injection volume: 10μL

[0077] Chromatographic column: Waters Oligonucleotide BEH C18(4.6×50mm, 2.5μm)

[0078] Elution procedure:

[0079] Time (min) Mobile phase A Mobile phase B 0 95 5 20 70 30 25 95 5

[0080] The experimental results of the embodiments and comparative examples (1) to (11) are as follows:

[0081]

[0082]

[0083]

[0084] The experimental results of Comparative Examples (12)-(13) are as follows:

[0085]

[0086] As shown in the above results, at the denaturation temperature (95°C) of the conventional TDNs synthesis process, the yield of the target TDN-siRNA complex is extremely low, and it is difficult to obtain a product with ideal purity. There are many impurities and the impurity content is high, which seriously affects the product quality. Lowering the denaturation temperature can avoid the degradation of the reaction raw materials during the denaturation process to a certain extent, but too low a denaturation temperature (60°C) will cause the reaction raw materials to be unable to fully denature, thereby affecting the self-assembly process of subsequent products. At the same time, the annealing temperature has a smaller effect on the product yield and purity than the denaturation temperature, but at each denaturation temperature, different annealing temperatures can still change the purity and yield of the product. On this basis, the inventors found through multiple screening that by controlling the denaturation temperature at around 70°C and combining it with the annealing temperature at around 25°C, a TDNs-siRNA complex product with a purity of 81.6% and a yield of 55.3% can be obtained. Compared with the purity (32.1%) and yield (11.8%) levels under conventional TDNs synthesis process conditions, the product quality has been significantly improved and can meet industrial production requirements.

[0087] In addition, when the inventors prepared the required TDNs-siRNA complex with reference to the gradient annealing process disclosed in the relevant prior art, they found that even if the temperature was complexly controlled by gradient, it still could not meet the industrial production needs of the TDNs-siRNA complex. In contrast, the present invention, through the appropriate control of the denaturation temperature and the coordination of the annealing temperature, does not require a complex gradient annealing process, and can achieve the high-purity / high-yield preparation of the TDNs-siRNA complex, laying a good foundation for the future industrial production of the TDNs-siRNA complex.

Claims

1. A method for preparing a DNA tetrahedron-small nucleic acid drug complex suitable for industrial production, characterized in that: It includes the following steps: Take four DNA single strands and add them to TM buffer, maintain at 70℃ for 10min, then cool to 4-25℃ and add the antisense strand of siRNA, maintain for more than 20min, and you have it. One of the four DNA single strands is connected to the positive strand of siRNA.

2. The preparation method according to claim 1, characterized in that: The temperature was lowered to 25°C.

3. The preparation method according to claim 1, characterized in that: The positive strand of the siRNA is connected to one of the four DNA single strands via a linker.

4. The preparation method according to claim 3, characterized in that: The nucleotide sequence of the linker is TTTTT.

5. The preparation method according to claim 1, characterized in that: The four DNA single strands have a feed molar ratio of 1:1:1:

1.

6. The preparation method according to claim 1, characterized in that: The nucleotide sequences of the four single-stranded DNAs are shown in SEQ ID NOs. 1 to 4 respectively.

7. The preparation method according to claim 1, characterized in that: The nucleotide sequence of the DNA single strand connected to the siRNA sense strand among the four DNA single strands is shown in SEQ ID NO.1; The nucleotide sequence of the siRNA sense strand is shown in SEQ ID NO:5; the nucleotide sequence of the siRNA antisense strand is shown in SEQ ID NO:

6.

8. The preparation method according to claim 7, characterized in that: The nucleotide sequence of the siRNA sense strand after being connected to the DNA single strand is shown in SEQ ID NO.

7.

9. The preparation method according to any one of claims 1 to 8, characterized in that: The step also includes purification; the purification is to purify the cooling and annealing liquid using an AKTA pure150 protein purification system.

10. A DNA tetrahedron-small nucleic acid drug complex, characterized in that: The invention is prepared according to the preparation method described in any one of claims 1 to 9.

Images