Method for constructing synovial sarcoma transgenic mouse animal experiment model

Abstract

The invention discloses a method for constructing a synovial sarcoma transgenic mouse animal experimental model, and belongs to the technical field of experimental animal model construction. The invention aims to solve the technical problem of how to construct a spontaneous passage synovial sarcoma transgenic mouse animal experiment model. In order to solve the technical problem, the invention provides a method for constructing a synovial sarcoma transgenic mouse animal experiment model, which comprises the following steps: introducing a coding gene of which the amino acid sequence is a protein shown in a sequence 1 in a sequence table into a mouse to obtain a transgenic target mouse containing the coding gene, and carrying out passage on the transgenic target mouse to obtain the synovial sarcoma transgenic mouse animal experiment model. The synovial sarcoma transgenic mouse animal experiment model is obtained. The invention also provides the protein and a biological material related to the protein. According to the method provided by the invention, the stable passage spontaneous conditional visual synovial sarcoma transgenic mouse model can be obtained.

Description

Technical Field

[0001] The invention belongs to the technical field of experimental animal model construction, and specifically relates to the construction and application of a spontaneous conditional synovial sarcoma transgenic mouse animal model. Background Art

[0002] Synovial sarcoma (SS) is a highly malignant soft tissue tumor (STS) that is common in children and adolescents and originates from mesenchymal tissue. It is one of the most common malignant soft tissue tumors. More than 95% of synovial sarcoma patients have characteristic chromosomal translocation (x; 18) (p11.2; q11.2), that is, the SS18 gene on chromosome 18 and SSX1, SSX2 and SSX4 on chromosome X form a fusion gene. The disease has a very high rate of local recurrence and distant metastasis. Although the treatment of synovial sarcoma includes surgical treatment, radiotherapy, chemotherapy and targeted drug therapy, the literature reports that its metastasis rate can be as high as 50%, and the 5-year metastasis-free survival rate is 40%-70%. The 5-year survival rate of patients with recurrence and metastasis is less than 20%, and there has been no significant improvement in recent years. Recent studies have found that the SS18-SSX gene fusion product is an important cause of the occurrence and development of synovial sarcoma, but research on the cause has not achieved effective results in recent decades. Analysis of the reasons is closely related to the lack of an effective model to conduct comprehensive mechanistic research on the SS18-SSX fusion product.

[0003] CRISPR (Clustered, regμLarly interspaced, short palindromic repeats) is an immune mechanism from bacteria that degrades invading viral DNA or other foreign DNA. In bacteria, CRISPR systems are divided into three categories, of which Class I and Class III require the participation of multiple CRISPR-associated proteins (Cas proteins) to work together, while Class II systems only require one Cas protein, which facilitates their widespread application. Currently, the CRISPR / Cas9 system from Streptococcus pyogenes is the most widely used. Cas9 protein (contains two nuclease domains, which can cut two single strands of DNA respectively. Cas9 first combines with crRNA and tracrRNA to form a complex, then binds and invades DNA through the PAM sequence to form an RNA-DNA complex structure, and then cuts the target DNA double strand to break the DNA double strand. Due to the simple structure of the PAM sequence (5'-NGG-3'), a large number of targets can be found in almost all genes, so it is widely used. CRISPR / Cas9 technology has been successfully applied to plants, bacteria, yeast, fish and mammalian cells, and is currently the most efficient genome editing technology. The crRNA and tracrRNA are modified by genetic engineering and connected together to obtain gRNA (guide RNA). The fused RNA has similar activity to the wild-type RNA, but because the structure is simplified, it is more convenient for researchers to use. Summary of the invention

[0004] The technical problem to be solved by the present invention is: how to construct a spontaneous and transgenic mouse animal experimental model of synovial sarcoma that can be passed on.

[0005] In order to solve the above technical problems, the present invention provides a method for constructing a transgenic mouse animal experimental model of synovial sarcoma in the first aspect, the method comprising introducing a DNA molecule into a mouse to obtain a transgenic target mouse containing the DNA molecule, and passaging the transgenic target mouse to obtain a transgenic mouse animal experimental model of synovial sarcoma;

[0006] The DNA molecule contains a gene encoding a SYT-SSX2 protein, and the SYT-SSX2 protein is a protein whose amino acid sequence is SEQ ID No.1.

[0007] Furthermore, in the method described above, the DNA molecule also includes a gene encoding a fluorescent protein.

[0008] Furthermore, in the method described above, the fluorescent protein is a protein whose amino acid sequence is SEQ ID No.2.

[0009] Furthermore, in the method described above, the nucleotide sequence of the DNA molecule is positions 2268-5728 of SEQ ID No.3.

[0010] In one embodiment of the present invention, the upstream of the DNA molecule contains a Cre-lox recombination system, and the nucleotide sequence of the Cre-lox recombination system is SEQ ID No. 3, positions 1370-2258. Among them, positions 1370-1403 of SEQ ID No. 3 are loxP, positions 1564-1698, 1818-1952, and 2072-2206 are polyA signal genes, and positions 2225-2258 are loxP.

[0011] Furthermore, in the method described above, in the synovial sarcoma transgenic mouse animal experimental model, the integration site of the encoding gene is located in the Rosa26 gene (Rosa26 gene site) of the recipient mouse.

[0012] Furthermore, in the method, the integration site of the protein is located in the first intron (Intron 1) of the mouse Rosa26 gene.

[0013] Furthermore, the method comprises S1) and S2)

[0014] S1), injecting Cas9 protein, sgRNA targeting Rosa26 gene and the recombinant vector containing the DNA molecule described in claims 1-3 into the pronuclear stage fertilized egg of mice to obtain gene-recombined fertilized egg cells;

[0015] S2), transplanting the genetically recombinant fertilized egg cells obtained in S1) into the oviduct of a female recipient mouse, allowing the genetically recombinant fertilized egg cells to develop in the uterus of the recipient mouse, and screening the offspring to obtain transgenic target mice.

[0016] Furthermore, in the method described above, the method further comprises S3) or / and S4)

[0017] S3), hybridizing the transgenic target mice obtained in S2) with wild-type mice, and screening to obtain transgenic heterozygous offspring mice;

[0018] S4), mating the male and female offspring mice of the heterozygous mice obtained in S3), and screening to obtain transgenic heterozygous or transgenic homozygous offspring mice;

[0019] S5), mating the transgenic heterozygous or homozygous offspring mice obtained in S4) with mice carrying the Cre restriction endonuclease to screen and obtain spontaneous conditional synovial sarcoma transgenic mice, or

[0020] Spontaneous conditional synovial sarcoma transgenic mice were obtained by injecting Cre recombinase (such as adenovirus vector Cre, Adeno-Cre, etc.) into the fibrous connective and muscle tissues of the transgenic heterozygous or homozygous offspring mice obtained in S4).

[0021] Furthermore, in the above method, S2) the method for screening transgenic target mice comprises the following steps:

[0022] C1), using primers R26 GTF and R26 GTR to perform PCR reaction with the cDNA of the sample to be tested as a template;

[0023] C2), using primers R26 GTF and t-PA SR-Y to carry out PCR reaction experiment with cDNA of the sample to be tested as template;

[0024] C3) Result judgment: If a target band of 215 bp is amplified in step C1) and a target band of 307 bp is amplified in step C2), the sample to be tested is a transgenic target mouse (transgenic heterozygous mouse);

[0025] The nucleotide sequences of the above primers are as follows:

[0026] R26 GTF: 5'-gagttctctgctgcctcctg-3' (SEQ ID No. 5);

[0027] R26GTR: 5'-ccgaaaatctgtgggaagtc-3' (SEQ ID No. 6);

[0028] t-PA SR-Y: 5'-tgcaagcttctgatggaatt-3' (SEQ ID No. 7).

[0029] Furthermore, in the above method, the screening method of the transgenic heterozygous offspring mice described in S3) and the transgenic homozygous offspring mice described in S4) comprises the following steps:

[0030] D1) PCR1 experiment: Use primers R26 GTF and R26 GTR to perform PCR reaction with cDNA of the mouse to be tested as template;

[0031] D2) PCR2 experiment: Use primers R26 GTF and t-PA SR-Y to carry out PCR reaction experiment with cDNA of the mouse to be tested as template;

[0032] D3) Result judgment: ① If no band is amplified in step D1) and a target band of 307 bp is amplified in step D2), the sample to be tested is the transgenic homozygous offspring mouse described in S4); ② If a target band of 215 bp is amplified in step D1) and a target band of 307 bp is amplified in step D2), the sample to be tested is a transgenic heterozygous mouse.

[0033] The nucleotide sequences of the above primers are as follows:

[0034] R26 GTF: 5'-gagttctctgctgcctcctg-3' (SEQ ID No. 5);

[0035] R26GTR: 5'-ccgaaaatctgtgggaagtc-3' (SEQ ID No. 6);

[0036] t-PA SR-Y: 5'-tgcaagcttctgatggaatt-3' (SEQ ID No. 7).

[0037] Furthermore, in the method described above, the target sequence of the sgRNA described in S1) is positions 1-20 of SEQ ID No. 4 (5'-actggagttgcagatcacga-3').

[0038] Furthermore, in the above method, the nucleotide sequence of the sgRNA gene in S1) may be SEQ ID No.4.

[0039] Furthermore, in the above method, the Cas9 protein described in S1) was purchased from PNB with a product number of CP01-50.

[0040] Furthermore, in the above method, the pronuclear fertilized egg cell in S1) can be derived from C57BL / 6 mice.

[0041] Furthermore, in the above method, the recipient mouse in S2) may be a pseudo-pregnant CD1 female mouse.

[0042] Furthermore, in the above method, the wild-type mouse in S3) may be a C57BL / 6J mouse.

[0043] Furthermore, in the above method, the mouse carrying the Cre restriction endonuclease in S5) can be B6.129S4-Myf5 tm3(cre)Sor / J mice.

[0044] Furthermore, in the above method, the fibrous connective and muscle tissues described in S5) generally refer to mouse tissues derived from mesenchymal stem cells, such as muscle tissues in the upper and lower limbs of mice.

[0045] Furthermore, in the above method, the method of screening and obtaining spontaneous conditional synovial sarcoma transgenic mice described in S5) may include the following steps:

[0046] E1) PCR experiment: Use primers Common, WTR and MR as primers, cut the tails of offspring mice about 10-14 days old, digest them with sodium hydroxide, and use them as templates for PCR experiments.

[0047] The primer sequences are as follows:

[0048] Primer Common: 5'-AAC CAG AGA CTC CCC AAG GT-3' (SEQ ID No. 8);

[0049] Primer WTR: 5'-CGG CTC TTA AAG CAA TGG TC-3' (SEQ ID No. 9);

[0050] Primer MR: 5'-ACG AAG TTA TTA GGT CCC TCG AC-3' (SEQ ID No. 10).

[0051] E2) Expected results and analysis

[0052] Examples and analysis of typical PCR products for genotyping:

[0053] ① Wild-type homozygous offspring mice (WT / WT): PCR results showed a single band of 240 bp;

[0054] ② Heterozygous transgenic offspring mice (Myf5 cre / WT): The experimental results showed two bands of 120 bp and 240 bp;

[0055] ③ Homozygous transgenic offspring mice (Myf5 cre / Myf5 cre ): The PCR experiment result was a single band of 120 bp.

[0056] In order to solve the above technical problems, the second aspect of the present invention provides the above DNA molecules and / or biological materials related to the DNA molecules, wherein the biological materials include:

[0057] B1), an expression cassette containing the DNA molecule;

[0058] B2), a recombinant vector containing the DNA molecule, or a recombinant vector containing the expression cassette described in B1);

[0059] B3) a recombinant microorganism containing the DNA molecule, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2);

[0060] B5) a cell line containing the DNA molecule, or a cell line containing the expression cassette of B1), or a cell line containing the recombinant vector of B2).

[0061] Furthermore, in the above-mentioned biological material, the expression cassette described in B1) refers to a DNA capable of expressing the above-mentioned protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the above-mentioned protein encoding gene, but also a terminator for terminating transcription of the above-mentioned protein encoding gene.

[0062] Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters and inducible promoters.

[0063] In the above biological materials, the recombinant vector B2) may contain the DNA molecule encoding the above protein as shown in positions 2268-5728 of SEQ ID No.3.

[0064] In one embodiment of the present invention, the recombinant vector is named Rosa26-LSL-SYT-SSX2-IRES-tdTomato HRD, and its nucleotide sequence is SEQ ID No.3. Among them, SEQ ID No.3 is Rosa265'arm at positions 133-1188, AD SA at positions 1204-1307, loxP at positions 1370-1403, polyA signal genes at positions 1564-1698, 1818-1952, and 2072-2206, respectively, and loxP at positions 2225-2258. SYT-SSX2 encoding gene at positions 2268-3734, IRES at positions 3735-4286, and tdTomato encoding gene at positions 4301-5728. Among the above-mentioned biological materials, the recombinant microorganism described in B3) can specifically be a virus, a bacterium, and a fungus.

[0065] Among the above-mentioned biological materials, the animal cell line described in B4) may or may not include propagation materials.

[0066] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmids, bacteriophages (such as lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), viral vectors (such as baculovirus vectors, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses or herpes viruses (such as herpes simplex virus), etc.).

[0067] The cell line (host cell) refers to a cell that can be used to introduce a vector, including but not limited to: eukaryotic cells (such as yeast cells, Aspergillus), animal cells (such as mammalian cells, insect cells) or prokaryotic cells. In one embodiment of the present invention, the cell line can specifically be a fertilized egg cell of a mouse.

[0068] The terms "cell" and "cell line" are used interchangeably and all such designations include progeny.

[0069] The present invention provides a spontaneous conditional synovial sarcoma transgenic mouse animal model. By applying CRISPR / Cas9 technology, a gRNA sequence that can efficiently identify Rosa26 is designed. Using the SliCE homologous recombination connection method, the homologous directed repair donor plasmid (HRD) that causes the occurrence and development of synovial sarcoma was invented and constructed for the first time at home and abroad, and it was named "Rosa26-LSL-SYT-SSX2-IRES-tdTomato HRD". All the above CRISPR components are mixed and injected into the fertilized eggs of C57BL6 mice, and then the injected fertilized eggs are transferred to pseudo-pregnant CD1 female mice for littering. The obtained offspring are screened by Sanger DNA sequencing to determine the correct F0 generation transgenic mice. At the same time, a genotype identification PCR experimental model and reaction system for transgenic mice are established, genotype identification is performed, and then mating with wild-type (WT) C57BL / 6J mice is performed for germline transmission. In its offspring (F1 and F2 generations), the genotype identification experimental model and system are used for genotype identification. Stably passaged transgenic mouse models of spontaneous conditionally visualized synovial sarcoma were obtained by mating with mice carrying the restriction endonuclease Cre or by topical application of biological agents containing Cre.

[0070] The beneficial technical effects achieved by the present invention are as follows:

[0071] 1) This model is spontaneous, that is, without the need for external stimulation such as physical and chemical factors, mice will spontaneously develop synovial sarcoma within a fixed age range. The Rosa26 site-specific integration site is located on mouse chromosome 6 and is a non-coding gene. It has been shown to be expressed in most tissues and cells. Because the gene regions with more active expression require the entry of transcription factors into the genomic structure and will not be heterochromatinized, the possibility of expression in various tissues by inserting exogenous DNA into this region is very high. Therefore, Rosa26 is used as a safe site for exogenous gene expression. This design connects the SYT-SSX2 oncogene sequence to the Rosa26 site-specific integration site to ensure the expression of the SYT-SSX2 gene.

[0072] 2) The model is conditional. This model is designed based on the Cre-lox recombination system, which has the advantages of simple operation and high recombination rate, and is a powerful tool for in vivo genetic manipulation. Using the Cre-lox system, a gene can be knocked out or expressed in specific cells, tissues or the entire organism, or even at a specific time point, to achieve spatiotemporal specific manipulation of specific genes, which has a profound impact on the study of gene function and the establishment of animal models of human diseases. The palindromic DNA site recognized by the Cre recombinase, namely the loxP (locus of X-over P1) site, is 34bp long, and its characteristic structure is ATAACTTCGTATA-NNNTANNN-TATACGAAGTTAT. The 13 bases on both sides of the reverse complement are the recognition sequences of the Cre recombinase, and the 8 bases in the middle are the location where the recombination occurs, which also determines the direction of loxP. N represents a variable base, and these mutant Lox sites can also be recognized by the Cre recombinase, DNA cutting occurs, and the recombination mode is determined according to LoxP. In the present invention, a "Loxp-Stop-Loxp" sequence is designed downstream of Rosa26, and the "Stop" sequence is "3×polyA". In this way, when there is no Cre recombinase, the downstream "Stop" sequence is expressed to terminate transcription. When the Cre recombinase is present, it specifically recognizes the "Loxp-Stop-Loxp" sequence, achieves specific excision of the "Stop" sequence, and thus expresses the downstream SYT-SSX2 sequence. Finally, the conditional expression and regulation of the SYT-SSX2 oncogene is achieved.

[0073] 3) The model has visualization characteristics. That is, whether in vivo or in vitro, under the excitation of fluorescent equipment, the tumor tissue and cells show red fluorescence. Tumor localization and tracing have always been major topics in the field of tumor research, among which fluorescent protein is one of the best choices. tdTomato is a red fluorescent protein with good photostability and brighter than mCherry, making it an ideal choice for tracking expression levels. Excitation light with a wavelength of about 554nm (such as green light: 520nm) can be used for excitation, and its maximum emission wavelength is 581nm. In the present invention, an internal ribosome entry site (Internal Ribosome Entry Site, IRES) is designed in front of tdTomato to ensure the expression of tdTomato. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 Schematic diagram for establishing the F0 generation mouse model based on CRISPR technology.

[0075] Figure 2 Schematic diagram of the design for genotyping of the F0 generation mouse model.

[0076] Figure 3 This is the agarose gel electrophoresis result of the reaction products of PCR experiment 1 of the F0 generation mouse model.

[0077] Figure 4 The agarose gel electrophoresis results of the reaction products of PCR experiment 2 of the F0 generation mouse model.

[0078] Figure 5 Schematic diagram of the design for genotyping of the F1 mouse model.

[0079] Figure 6 Agarose gel electrophoresis results of the reaction products of PCR experiment 1 for genotyping of the F1 generation mouse model.

[0080] Figure 7 Agarose gel electrophoresis results of the reaction products of PCR experiment 2 for genotyping of the F1 generation mouse model.

[0081] Figure 8 B6.129S4-Myf5 tm3(cre)Sor Agarose gel electrophoresis results of PCR reaction products for genotyping of transgenic mice.

[0082] Fig. 9 B6.129S4-Myf5 tm3(cre)Sor KM survival curve of / J-Rosa26-LSL-SYT-SSX2-IRES-tdTomato transgenic mice.

[0083] Fig.10 B6.129S4-Myf5 tm3(cre)Sor General diagram of / J-Rosa26-LSL-SYT-SSX2-IRES-tdTomato transgenic mice.

[0084] Fig.11 B6.129S4-Myf5 tm3(cre)Sor Histopathological analysis of synovial sarcoma-bearing in J-Rosa26-LSL-SYT-SSX2-IRES-tdTomato transgenic mice. Fig.11 The scale bar is 200 μm Fig.11 A in the middle is HE staining of tumor tissue. Fig.11 BF in the figure are immunohistochemical staining analysis of tumor tissues, showing that commonly used immunohistochemical markers of human synovial sarcoma such as (B) Vimentin, (C) PCNA, (D) CD99, (E) Cytokeratin, and (F) Bcl-2 are also highly expressed in the transgenic model.

[0085] Fig.12 Primary culture analysis of tumor cells from synovial sarcoma transgenic mice. Fig.12 A in the middle shows the tumor tissue under light microscopy. Fig.12 Figures BD and B are fluorescent images for tumor cell visualization. DETAILED DESCRIPTION

[0086] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0087] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0088] In the following examples, C57BL6J mice were purchased from Jackson Laboratory (Strain#: 000664).

[0089] CD1 female mice were purchased from Charles River Company (Crl:CD1(ICR)) and were raised autonomously in a sterile environment for experimental use.

[0090] The present invention provides a spontaneous conditional synovial sarcoma transgenic mouse animal model. By applying CRISPR / Cas9 technology, a gRNA sequence that can efficiently identify Rosa26 is designed. Using the SliCE homologous recombination connection method, the homologous directed repair donor plasmid (HRD) that causes the occurrence and development of synovial sarcoma was invented and constructed for the first time at home and abroad, and it was named "Rosa26-LSL-SYT-SSX2-IRES-tdTomato HRD". All the above CRISPR components are mixed and injected into the fertilized eggs of C57BL6 mice, and then the injected fertilized eggs are transferred to pseudo-pregnant CD1 female mice for littering. The obtained offspring are screened by Sanger DNA sequencing to determine the correct F0 generation of transgenic mice. At the same time, a genotype identification PCR experimental model and reaction system for transgenic mice are established, genotype identification is performed, and then mating with wild-type (WT) C57BL / 6J mice is performed for germline transmission. In its offspring (F1), the genotype identification experimental model and system are used for genotype identification. Thus, a transgenic mouse model of spontaneous conditionally visualized synovial sarcoma with stable passage was obtained.

[0091] Example 1. Establishment of F0 generation mouse model

[0092] Based on CRISPR technology, a Rosa26-LSL-SYT-SSX2-IRES-tdTomato synovial sarcoma transgenic mouse model (hereinafter referred to as the mouse model) was designed and invented.

[0093] 1.1. The online software Benchling (www.benchline.com) was used to design and establish the targeting sequence of the guide RNA (gRNA) targeting intron 1 of Rosa 26 (GenBank ACCESSION VERSION is AC155722.9 (linear ROD 30-APR-2005)) (target sequence is: 5'-actggagttgcagatcacgaggg-3'), and the guide RNA was named R26 gRNA 85. R26 gRNA 85 was generated by in vitro transcription technology. R26 gRNA 85 is an RNA molecule with a nucleotide sequence of SEQ ID No. 4. Wherein, positions 1-20 of SEQ ID No. 4 are spacer sequences (target sequences), and positions 21-106 are the backbone sequence of gRNA.

[0094] SEQ ID No.4:

[0095] ACTGGAGTTGCAGATCACGAGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.

[0096] 1.2. Use SliCE (Seamless Ligation Cloning Extract) homologous recombination ligation method to establish the homology directed repair donor HRD plasmid required for the experiment, which is named "Rosa26-LSL-SYT-SSX2-IRES-tdTomato HRD". This HRD contains a DNA sequence, including Ad SA-Loxp-3×polyA signal-Loxp-SYT-SSX2-IRES-tdTomato-polyA, which is inserted at about 1kb from the 5' end and about 4kb from the 3' end of the homologous chromosome arm.

[0097] The nucleotide sequence of Rosa26-LSL-SYT-SSX2-IRES-tdTomato HRD is SEQ ID No. 3. Among them, SEQ ID No. 3 is Rosa 26 5'arm at positions 133-1188, AD SA at positions 1204-1307, loxP at positions 1370-1403, polyA signal genes at positions 1564-1698, 1818-1952, and 2072-2206, respectively, and loxP at positions 2225-2258. SYT-SSX2 encoding gene at positions 2268-3734, IRES at positions 3735-4286, and tdTomato encoding gene at positions 4301-5728.

[0098] Rosa26-LSL-SYT-SSX2-IRES-tdTomato HRD can encode a fusion protein, which contains a SYT-SSX2 protein with an amino acid sequence of SEQ ID No.1 and a tdTomato protein with an amino acid sequence of SEQ ID No.2.

[0099] 1.3. Cas9 protein was purchased from PNB with the product number CP01-50.

[0100] 1.4. Mix and dilute all the components required for the above CRISPR experiments (R26 gRNA 85, Rosa26-LSL-SYT-SSX2-IRES-tdTomato HRD, Cas9 protein), and inject them into the pronuclear fertilized eggs of C57BL / 6 mice with full morphology and clear zona pellucida using microinjection technology. The injected fertilized eggs are cultured in vitro to 2-cell embryos, and 2-cell embryos with normal morphological development are selected and transferred to pseudo-pregnant CD1 female mice for littering. About 30-60 cases are injected in each experiment, and genotype screening is performed in the subsequent experiments until the appropriate genotype is produced. Each round of experiments lasts about 2-4 months. In this experimental example 1, the desired genotype was obtained after 14 months of screening of 169 cases.

[0101] Example 2: Genotyping scheme and results of F0 generation mouse model

[0102] The offspring obtained by DNA sequencing screening are the F0 generation mouse models with the correct sequencing. The genotype of the F0 generation mouse model is Rosa26-LSL-SYT-SSX2-IRES-tdTomato KI. The specific operation steps are as follows:

[0103] 2.1 Genotyping scheme for F0 generation mouse model

[0104] Schematic diagram of the experimental method for genotyping Figure 2As shown, polymerase chain reaction technology is used to identify potential transgene-carrying mice, and the correctness of the sequence is then verified by cloning and gene sequencing. Figure 2 Here, WT indicates wild type, indel indicates insertion or deletion, and HA indicates the homology arm of the donor DNA “Ad SA-Loxp-3XpolyA signal-Loxp-SYT-SSX2-IRES-tdTomato-polyA”.

[0105] 2.2 Pre-screening of F0 mice that may carry transgenes

[0106] Two PCR experiments were designed to determine the genotype of the mice to be tested based on the sizes of the two PCR amplification products.

[0107] 2.2.1 PCR experiment 1

[0108] Purpose: To detect WT or indel alleles;

[0109] (1) The tails of F0 mice at about 10-14 days old were cut and digested with sodium hydroxide. The tails were used as templates and the primers R26GTF and R26 GTR were used for PCR reaction. The obtained amplified products were sent for sequencing analysis.

[0110] R26 GTF: 5'-gagttctctgctgcctcctg-3' (SEQ ID No. 5);

[0111] R26GTR: 5'-ccgaaaatctgtgggaagtc-3' (SEQ ID No. 6);

[0112] Expected results and analysis:

[0113] Insertion mutation (KI) or random integration: The PCR product fragment size is 4804 bp (too large to be amplified);

[0114] Wild type (WT): 215 bp;

[0115] Indel: The fragment size is similar or different from the wild type.

[0116] 2.2.2 PCR experiment 2

[0117] Purpose: To detect the presence of Rosa26-LSL-SYT-SSX2-IRES-tdTomato fragment;

[0118] Methods: PCR reaction experiments were performed using primers R26 GTF and t-PASR-Y, the same template as in PCR experiment 1.

[0119] R26 GTF: 5'-gagttctctgctgcctcctg-3' (SEQ ID No. 5);

[0120] t-PA SR-Y: 5'-tgcaagcttctgatggaatt-3' (SEQ ID No. 7).

[0121] Expected results and analysis:

[0122] Insertion mutation (KI) or random integration: The fragment size of the PCR reaction product is 307 bp;

[0123] Wild type or deletion (Indel): cannot be amplified.

[0124] 2.3 PCR reaction system and reaction conditions

[0125] Table 1. PCR reaction system

[0126]

[0127] Table 2. PCR reaction experimental conditions

[0128]

[0129] 2.4 Genotyping results of F0 generation mice

[0130] The agarose gel electrophoresis results of PCR reaction products are as follows Figure 3 and Figure 4 As shown. Figure 3 The agarose gel electrophoresis results of PCR reaction products of PCR experiment 1 are shown in Figure 1. Figure 4 The agarose gel electrophoresis results of the PCR reaction products of PCR experiment 2. Samples 1-16 in the figure are the samples to be tested, "WT" is the wild-type control sample, and "B" is the blank control sample. Figure 3 The results were as follows: samples 1-16 all showed 1 band of 215 bp, the same as the wild-type control, and the results of PCR experiment 1 for samples 1-16 were all wild-type. Figure 4 The results are as follows: Samples 1-15 all showed 0 bands, indicating that the genotype was wild type or deleted. Sample 16 had 1 band with a size of 307 bp, indicating that the genotype was transgenic knock-in or random integration. Figure 3 and Figure 4 The results showed that sample #16 was positive and was a mouse model of the F0 generation carrying Rosa26-LSL-SYT-SSX2-IRES-tdTomato KI. The gene sequencing of sample #16 was verified to be correct.

[0131] 2.5. Confirmation of homologous recombination events

[0132] The transgenic region was cloned and amplified, and Sanger gene sequencing was performed. The transgenic region fragments included the upstream 5'HA region, 5'HA, ad SA-LSL-SYT-SSX2-IRES-tdTomato KI fragment, and the downstream 3'HA region, 3'HARosa26 Rosa26-LSL-SYT-SSX2-IRES-tdTomato KI fragment. The randomly inserted donor sequence could not be cloned and amplified.

[0133] By analyzing the samples after PCR experiment 1 and PCR experiment 2, sample #16 was identified as a transgenic knock-in mouse by Sanger sequencing. Its genotype was Rosa26-LSL-SYT-SSX2-IRES-tdTomato KI / 2bp CG deletion.

[0134] Example 3: Genotyping scheme and results of F1 generation mouse model

[0135] The F0 generation mouse model obtained in Example 2 was mated with wild-type C57BL / 6J mice, and the obtained offspring mice were genotyped and sequenced to identify the transgenic transgene transmission. F1 heterozygous mice with the genotype of Rosa26-LSL-SYT-SSX2-IRES-tdTomato KI / WT were produced in the offspring for germline transmission. The specific method is: if male F0 generation mice are successfully obtained, they are mated with 1-3 wild-type C57BL / 6J mice in the same cage after they are 8-10 weeks of sexual maturity. If female F0 generation mice are successfully obtained, they are mated with 1 wild-type C57BL / 6J mice in the same cage after they are 8-10 weeks of sexual maturity, which takes about 6-12 months.

[0136] 3.1 Experimental Design

[0137] Schematic diagram of the experimental design for genotyping Figure 5 As shown, PCR technology was used to identify mice that might carry the transgene, and then the correctness of the sequence was verified by cloning and gene sequencing ( Figure 5 ). Figure 5 Here, WT indicates wild type, indel indicates deletion, and HA indicates the homology arm of the donor DNA “Ad SA-Loxp-3XpolyA signal-Loxp-SYT-SSX2-IRES-tdTomato-polyA”.

[0138] 3.2 Pre-screening of F1 mice that may carry transgenes

[0139] The tail of the mouse to be tested was cut off at about 10-14 days old according to the method of Example 2, digested with sodium hydroxide and used as a template for PCR amplification. The primer sequences and operation steps used were the same as those in Example 2.

[0140] 3.3 Genotyping results of F1 mice

[0141] The agarose gel electrophoresis results of PCR reaction products are as follows Figure 6 and Figure 7 As shown, Figure 6 Agarose gel electrophoresis results of the reaction products of PCR experiment 1 for genotyping of the F1 generation mouse model. Figure 7 The agarose gel electrophoresis results of the reaction products of PCR experiment 2 for genotype identification of the F1 generation mouse model. Samples 1-10 are samples to be tested, lane 11 is the wild type, and lane 12 is the blank control sample. Figure 6 The results were as follows: samples 1-10 all showed a 215 bp band, indicating that the genotype was wild type or deleted. Figure 7 The results are: Samples #2, #3, and #7 amplified a single band of 307 bp, which was positive and was an F1 generation mouse model. That is, samples #2, #3, and #7 were Rosa26-LSL-SYT-SSX2-IRES-tdTomato KI / WT heterozygous mice. Figure 7 Samples #1, #4, #5, #6, #8, #9, and #10 had no bands, and their genotypes were wild type or deleted.

[0142] Example 4: Genotype identification and screening method for subsequent offspring of F1 generation mice

[0143] The F1 generation mice have obtained a transgene that can be stably propagated and are heterozygous. Studies have found that they can stably express the synovial sarcoma phenotype with high penetrance. Therefore, for the expansion of the F1 generation mouse population, the passaging method can be used. The specific method is to mate male and female F1 generation mice, and then perform genotype identification and screening in the obtained offspring. The probability of obtaining homozygous transgenic mice is 1 / 4, the probability of obtaining heterozygous transgenic mice is 1 / 2, and the probability of obtaining wild-type mice is 1 / 4. In addition, female or male F1 generation mice can also be mated with wild-type C57BL6J mice, and genotype identification and screening are performed in the obtained offspring. The probability of obtaining homozygous transgenic mice is 0, the probability of obtaining heterozygous transgenic mice is 1 / 2, and the probability of obtaining wild-type mice is 1 / 2.

[0144] Purpose: To detect the genotype of subsequent offspring of F1 generation mice

[0145] Method: According to the method of Example 2, the tail of the mouse to be tested was cut off at about 10-14 days old, digested with sodium hydroxide and used as a template for PCR amplification. The primer sequences and operation steps used were the same as those in Example 2.

[0146] Examples and analysis of typical PCR products for genotyping:

[0147] ① Wild-type homozygous offspring mice (WT / WT): PCR1 experimental result is a single band of 215 bp; PCR2 experimental result is no band;

[0148] ② Heterozygous transgenic offspring mice (KI / WT): PCR1 experimental result was a single band of 215 bp; PCR2 experimental result was a single band of 307 bp;

[0149] ③Homozygous transgenic offspring mice (KI / KI): The result of PCR1 experiment was no band; the result of PCR2 experiment was a single band of 307 bp.

[0150] Example 5. Phenotypic Expression of Rosa26-LSL-SYT-SSX2-IRES-tdTomato Transgenic Mice

[0151] This model is designed based on the Cre-lox recombination system, which has the advantages of simple operation and high recombination rate, and is a powerful tool for in vivo genetic manipulation. After mating with mice carrying Cre recombinase, or injecting Cre recombinase (such as Adeno-Cre, etc.) into fibrous connective tissue, the palindromic DNA site recognized by Cre recombinase, i.e., loxP (locus of X-over P1) site, in its offspring mice, achieves specific excision of the "Stop" sequence, thereby expressing the downstream SYT-SSX2 sequence. Ultimately, the conditional expression and regulation of the SYT-SSX2 oncogene is achieved.

[0152] The following is based on B6.129S4-Myf5 tm3(cre)Sor The implementation process is introduced as an example of B6.129S4-Myf5 / J mice: tm3(cre)Sor / J mice were purchased from The Jackson laboratory (Cat. No. 007893). Rosa26-LSL-SYT-SSX2-IRES-tdTomato transgenic homozygous or heterozygous mice (F1 mice and their offspring prepared in Example 4) were selected and cross-bred with B6.129S4-Myf5 tm3(cre)Sor / J mice were paired in the same cage to breed offspring, and the genotype of the offspring mice was identified by PCR experiment. B6.129S4-Myf5 tm3(cre)Sor / J heterozygous mice have synovial sarcoma phenotype.

[0153] 5.1. Methods: The following PCR experiments were used for genotyping

[0154] PCR experiment: Use primers Common, WTR and MR as primers, cut the tails of offspring mice about 10-14 days old, digest them with sodium hydroxide, and use them as templates for PCR experiments.

[0155] The primer sequences are as follows:

[0156] Primer Common: 5'-AAC CAG AGA CTC CCC AAG GT-3' (SEQ ID No. 8);

[0157] Primer WTR: 5'-CGG CTC TTA AAG CAA TGG TC-3' (SEQ ID No. 9);

[0158] Primer MR: 5'-ACG AAG TTA TTA GGT CCC TCG AC-3' (SEQ ID No. 10).

[0159] Table 3. PCR reaction system

[0160] Element Addition amount Distilled water To be determined Template DNA 30-100ng Primer Common (5pmol / μL) 1μL Primer WTR (5 pmol / μL) 1μL Primer MR (5pmol / μL) 1μL 2×PCR Master Solution[i-starTaq](iNtRon) 5μL Total reaction volume 10μL

[0161] Table 4. PCR reaction experimental conditions

[0162]

[0163]

[0164] 5.2 Expected Results and Analysis

[0165] Examples and analysis of typical PCR products for genotyping:

[0166] ① Wild-type homozygous offspring mice (WT / WT): PCR results showed a single band of 240 bp;

[0167] ② Heterozygous transgenic offspring mice (Myf5 cre / WT): The experimental results showed two bands of 120 bp and 240 bp;

[0168] ③ Homozygous transgenic offspring mice (Myf5 cre / Myf5 cre ): The PCR experiment result was a single band of 120 bp.

[0169] The agarose gel electrophoresis results of the reaction products in the PCR experiment are as follows Figure 8 As shown, samples 1-7 are samples to be tested, lane 8 is a blank control, and lanes 9 and 10 are wild-type control samples. The results show that samples 1, 2, 4, and 7 all show two bands of 120 bp and 240 bp, indicating that the genotype is a heterozygous transgenic offspring mouse. Samples 3, 5, and 6 all show a single band of 240 bp, indicating that the genotype is a wild-type homozygous offspring mouse.

[0170] 5.3 Phenotypic analysis of transgenic mice

[0171] The mice samples No. 1, 2, 4, and 7 obtained in the previous step were kept and their genotypes were B6.129S4-Myf5 tm3 (cre)Sor / J-Rosa26-LSL-SYT-SSX2-IRES-tdTomato, it can be seen that the mice have no significant abnormal phenotypes, can all develop normally to sexual maturity, and have the ability to pass on. In this example, a total of 13 mice of this genotype were counted, with an average tumor latency of 25.3±6.2 weeks, a penetrance of 100%, and all of them showed synovial sarcoma phenotypes. The average survival time was 31.7±6.1 weeks, which was significantly shorter than that of the control group. The KM survival curve is shown in Fig. 9 shown.

[0172] 1) Examples of gross tumor manifestations. Fig.10 The results showed that a dark red oval-shaped, tough tumor with a diameter of about 1.8 cm was visible around the right hip joint of the affected mouse (35 weeks old).

[0173] 2) Histopathological analysis: Tumor tissue was removed and fixed in formalin for histopathological analysis. Fig.11 HE staining showed spindle cell malignant tumor manifestations, which were consistent with the typical synovial sarcoma manifestations. Immunohistochemical staining analysis showed that common markers of mesenchymal malignant tumors such as were highly expressed. The antibody proteins used in immunohistochemical staining were (B) Vimentin (#ab92547, Abcam.), (C) PCNA (#2586, Cell Signaling Technology), (D) CD99 (#MA5-47656, Invitrogen), (E) Cytokeratin (#53-9003-82, Invitrogen), and (F) Bcl-2 (#ab53280, Abcam).

[0174] 3) Primary culture and analysis of tumor cells: Tumor tissue was digested by collagenase and then cultured. The microscopic morphology of tumor cells was as follows: Fig.12, spindle-shaped tumor cells can be seen to grow actively and can be passaged normally. Under fluorescence excitation, tumor cells can be seen to homogeneously express strong and stable red fluorescence signals, indicating that the tumor is visualized ( Fig.12 ).

[0175] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for constructing a transgenic mouse animal experimental model of synovial sarcoma, the method comprising introducing a DNA molecule into a mouse to obtain a transgenic target mouse containing the DNA molecule, and passaging the transgenic target mouse to obtain a transgenic mouse animal experimental model of synovial sarcoma; The DNA molecule contains a gene encoding a SYT-SSX2 protein, and the SYT-SSX2 protein is a protein whose amino acid sequence is SEQID No.

1.

2. The method according to claim 1, characterized in that: The DNA molecule also includes a gene encoding a fluorescent protein.

3. The method according to claim 2, characterized in that: The fluorescent protein is a protein whose amino acid sequence is SEQ ID No.

2.

4. The method according to any one of claims 1 to 3, characterized in that: The nucleotide sequence of the DNA molecule is SEQ ID No. 3, positions 2268-5728.

5. The method according to any one of claims 1 to 4, characterized in that: In the synovial sarcoma transgenic mouse animal experimental model, the integration site of the encoding gene is located in the Rosa26 gene of the recipient mouse.

6. The method according to any one of claims 1 to 5, characterized in that: The method comprises S1) and S2), S1), injecting Cas9 protein, sgRNA targeting Rosa26 gene and the recombinant vector containing the DNA molecule described in claims 1-3 into the pronuclear stage fertilized egg of mice to obtain gene-recombined fertilized egg cells; S2), transplanting the genetically recombinant fertilized egg cells obtained in S1) into the oviduct of a female recipient mouse, allowing the genetically recombinant fertilized egg cells to develop in the uterus of the recipient mouse, and screening the offspring to obtain transgenic target mice.

7. The method according to any one of claims 1 to 6, characterized in that: The method further comprises S3) or / and S4) S3), hybridizing the transgenic target mice obtained in S2) with wild-type mice, and screening to obtain transgenic heterozygous offspring mice; S4), mating the male and female offspring mice of the heterozygous mice obtained in S3), and screening to obtain transgenic heterozygous or transgenic homozygous offspring mice; S5), mating the transgenic heterozygous or homozygous offspring mice obtained in S4) with mice carrying the Cre restriction endonuclease to screen and obtain spontaneous conditional synovial sarcoma transgenic mice, or Spontaneous conditional synovial sarcoma transgenic mice were obtained by injecting Cre recombinase into the fibrous connective tissue and muscle tissue of the transgenic heterozygous or homozygous offspring mice obtained in S4).

8. The method according to claim 6 or 7, characterized in that: The screening method described in S2) or S4) comprises: C1), using primers R26 GTF and R26 GTR to perform PCR amplification with the cDNA of the mouse to be tested as a template; C2), using primers R26 GTF and t-PA SR-Y to perform PCR amplification with the cDNA of the mouse to be tested as a template; C3) Result judgment: if a target band of 215 bp is amplified in step C1) and a target band of 307 bp is amplified in step C2), the sample to be tested is a transgenic target mouse; The nucleotide sequence of primer R26 GTF is SEQ ID No.5, the nucleotide sequence of primer R26GTR is SEQ ID No.6, and the nucleotide sequence of primer t-PA SR-Y is SEQ ID No.

7.

9. The method according to any one of claims 6 to 8, characterized in that: S1) The target sequence of the sgRNA is SEQ ID No. 4, positions 1-20.

10. The DNA molecule according to any one of claims 1 to 9 or / and a biological material related to the DNA molecule, wherein the biological material comprises: B1), an expression cassette containing the DNA molecule; B2), a recombinant vector containing the DNA molecule, or a recombinant vector containing the expression cassette described in B1); B3) a recombinant microorganism containing the DNA molecule, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2); B5) a cell line containing the DNA molecule, or a cell line containing the expression cassette of B1), or a cell line containing the recombinant vector of B2).

Images