Construction method and application of amino acid high-yield strain

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a construction method of corynebacterium glutamicum for producing L-amino acid. According to the method, a CgtR2-CgtS2 double-component system in the strain is weakened, so that the yield and the conversion rate of L-amino acid, especially L-glutamic acid, of the strain are improved. The invention also provides an engineering strain constructed by using the method, and a method for producing L-amino acid by using the strain and improving the yield and conversion rate of the L-amino acid. The production cost of the L-amino acid can be reduced, and a new strategy is provided for large-scale production.

Description

Technical Field

[0001] This invention relates to the field of microbiology and biotechnology, specifically to a method for constructing an L-amino acid-producing strain, the engineered strain obtained by the method, and a method for producing L-amino acids using the strain. Background Technology

[0002] L-amino acids are the basic building blocks of proteins, including L-lysine, L-threonine, and glutamic acid. They are essential substances for the nutrition, survival, and development of human and animal organisms, playing a crucial role in metabolic regulation and information transmission. They are widely used in the pharmaceutical, health, food, animal feed, and cosmetic industries, primarily produced through microbial fermentation. Currently, the main production strains include microorganisms such as Enterobacter and Corynebacterium. Due to its physiological advantages, Corynebacterium has become the most important production strain in industry. With the continuous development of biotechnology, reports on using genetic modification techniques to enhance the amino acid production of Corynebacterium glutamicum have emerged. Currently, the acid-producing capacity of industrial production strains has reached a high level. Under these circumstances, how to discover modifiable genetic targets to further improve the acid-producing capacity of strains has become a continuous pursuit for those skilled in the art.

[0003] Existing literature reports that highly conserved two-component regulatory systems (TCS) in prokaryotes help organisms cope with various physiological and environmental stresses, playing a key regulatory role in bacterial adaptation to environmental stress. TCS typically consists of a histidine kinase (HK) and a response regulator (RR). HK is a transmembrane protein that senses changes in the external environment and transmits signals through its own phosphorylation and dephosphorylation. RR is the main regulatory protein, activated by phosphorylation of HK, and regulates the expression of downstream genes. Existing literature reports that MprAB is an important TCS in mycobacteria, which mainly responds to and regulates cell membrane pressure and maintains persistent infection in the host. It can activate the transcription of more than 200 downstream genes (Hongjun He, Raymond Hovey, Jason Kane, Vineet Singh, Thomas C Zahrt. MprAB is a stress-responsive two-component system that directly regulates expression of sigmafactors SigB and SigE in Mycobacterium tuberculosis. Journal of Bacteriology, 2006. 188(6): 2134-2143; Daniel J Bretl, Tarin M Bigley, Scott S Terhune, Thomas C Zahrt. The MprBextracytoplasmic domain negatively regulates activation of the Mycobacterium tuberculosis MprAB two-component system. Journal of Bacteriology, 2014. 196(2): 391-406.).Among its target genes are genes encoding important stress-related Sigma factors such as sigE and sigB. Furthermore, the transcription of mprAB is regulated by both sigE and MprA, forming a complex feedback regulatory loop (Xue Li, Xi Lv, Yanping Lin, Junfeng Zhen, Cao Ruan, Wei Duan, Yue Li, Jianping Xie. Role of two-component regulatory systems in intracellular survival of Mycobacterium tuberculosis. Journal of Cellular Biochemistry, 2019, 120(8): 12197-12207.). Therefore, the MprAB system is crucial for the survival of mycobacteria under complex environmental stress conditions.

[0004] The *Corynebacterium glutamicum* genome contains the CgtR2-CgtS2 system, annotated as the MprA-MprB homology system, composed of RR encoded by the cgtR2 gene and HK encoded by the cgtS2 gene. However, research on the CgtR2-CgtS2 system is currently limited, and its involvement in regulating the stress response of *Corynebacterium glutamicum* and its impact on L-amino acid production remain unclear. Based on the potential important function of the CgtR2-CgtS2 system in regulating cell membrane stress response and the crucial role of extracellular membrane stress response in L-amino acid synthesis, it is hypothesized that modifications to CgtR2-CgtS2 may affect the synthesis and secretion of L-amino acids. Summary of the Invention

[0005] To further enhance the L-amino acid production capacity of Corynebacterium glutamicum and thus provide a more efficient method for producing L-amino acids, especially L-glutamic acid, the inventors of this invention discovered that knockout or specific point mutation of CgtR2 leads to the inactivation of the CgtR2-CgtS2 system, thereby increasing the L-glutamic acid yield and conversion rate of the strain and reducing production costs. Based on this, this invention was completed.

[0006] In a first aspect, the present invention provides a method for constructing a Corynebacterium glutamicum that produces L-amino acids, which is achieved by weakening the CgtR2-CgtS2 system in the strain.

[0007] The “CgtR2-CgtS2 system” described herein refers to the MprA-MprB homology system derived from Corynebacterium glutamicum, consisting of RR encoded by the cgtR2 gene (GeneID cgl0874, NCgl0839, or BBD29_04835) and HK encoded by the cgtS2 gene (GeneID cgl0875, NCgl0840, or BBD29_04840). As used herein, CgtR2 and CgtS2 can be wild-type sequences of the amino acid sequences of SEQ ID NO:1 and SEQ ID NO:5, or amino acid sequences having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the amino acid sequences of SEQ ID NO:1 and SEQ ID NO:5. Furthermore, it is obvious that if an amino acid sequence is homologous to the sequences described above and has substantially the same or corresponding biological activity as the proteins of SEQ ID NO:1 and SEQ ID NO:5, then amino acid sequences with deletions, modifications, substitutions, or additions should also fall within the scope of this invention. In this invention, any polynucleotide sequence encoding CgtR2 may fall within the scope of this invention. For example, a polynucleotide sequence may be a polynucleotide sequence having at least 75%, specifically at least 80%, more specifically 85%, and even more specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology to the polynucleotide sequences of SEQ ID NO:2 and SEQ ID NO:6. Additionally, based on codon degeneracy or considering the preferred codons for protein expression in an organism, the polynucleotide sequence encoding the protein may have various variations in the coding region without altering the amino acid sequence of the protein expressed from the coding region.

[0008] The term "weakening" refers to the reduction, weakening, or even complete disappearance of CgtR2-CgtS2 expression compared to the wild-type strain, or the production of a non-expressed gene, or the expression product having no activity or reduced activity despite expression.

[0009] In a specific embodiment, compared to the wild-type or endogenous polypeptide, the activity of the mutated gene's transcription, expression, or encoded protein is reduced by at least 30%, preferably at least 40%, more preferably at least 50%, such as at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or the gene encoding the wild-type or endogenous polypeptide is removed.

[0010] The "weakening" can be achieved through modification, including but not limited to deleting part or all of the coding gene, frameshift mutations in the gene reading frame, weakening transcription or translation intensity, or using a gene or allele encoding a corresponding enzyme or protein with lower activity, or inactivating the corresponding gene or enzyme, and optionally combining these methods. Reduction of gene expression can be achieved by employing appropriate culture methods or genetic modifications (mutations) to the signaling structures of gene expression, such as repressor genes, active genes, operator genes, promoters, attenuators, ribosome binding sites, start codons, and terminators. Based on the teachings of this disclosure, those skilled in the art will understand that L-glutamate production can be increased by inactivating the coding genes for CgtR2 and CgtS2, or by preventing CgtR2 and CgtS2 from functioning properly in the cell. Those skilled in the art can achieve the above objectives using techniques known in the art.

[0011] In one specific embodiment, the inactivation is achieved by introducing a mutation into the CgtR2-CgtS2 system. Preferably, the mutation is the introduction of a leucine mutation at position 4 corresponding to SEQ ID NO:1; or the introduction of an arginine mutation at position 198 corresponding to SEQ ID NO:5; and / or the introduction of a tryptophan mutation at position 380 corresponding to SEQ ID NO:5.

[0012] In some embodiments, wild-type CgtR2 and CgtS2 in this disclosure refer to wild-type CgtR2 and CgtS2 proteins, i.e., polypeptides with amino acid sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 5. Compared with wild-type CgtR2 and CgtS2, strains containing mutants have a more than 6% increase in L-glutamic acid production and a more than 5% increase in conversion rate.

[0013] The term "mutant" refers to a polynucleotide or polypeptide that, relative to the "wild type" or "comparative" type, contains alterations (i.e., substitutions, insertions, and / or deletions) at one or more (e.g., several) positions. Substitution refers to replacing a nucleotide occupying a position with a different nucleotide. Deletion refers to removing a nucleotide occupying a position. Insertion refers to adding a nucleotide adjacent to and immediately following the nucleotide occupying the position. In a specific embodiment, the "mutation" is a "substitution," a mutation caused by the substitution of one or more bases in a nucleotide by another different base, also known as a substitution mutation or point mutation.

[0014] The term "amino acid mutation" or "nucleotide mutation" includes "substitution, duplication, deletion, or addition of one or more amino acids or nucleotides." In this invention, the term "mutation" refers to an alteration of a nucleotide sequence or amino acid sequence. In one specific embodiment, the term "mutation" refers to "substitution."

[0015] The term "transformation" as used herein has the meaning commonly understood by those skilled in the art, namely, the process of introducing exogenous DNA into a host. The methods of transformation include any method of introducing nucleic acids into cells, including but not limited to electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0016] The Corynebacterium glutamicum described in this invention includes, but is not limited to, Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, as well as mutants or strains that produce L-amino acids prepared from the above strains.

[0017] In some embodiments, the L-glutamate-producing strain may be a strain modified from Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum ATCC13869, wherein such modifications include, but are not limited to, enhancement or overexpression of one or more genes selected from the following:

[0018] a. The yggB gene encoding a mechanosensitive channel protein (see CN108250278A for a specific example);

[0019] b. The fxpk gene encoding phosphotransketolase (see WO2006016705A1 for a specific example);

[0020] c. The pyc gene encoding pyruvate carboxylase (see WO2004069996A2 for specific examples);

[0021] d. The gdh gene encoding glutamate dehydrogenase (see CN103205390A for specific examples);

[0022] e. Genes encoding carbonic anhydrase (see WO2011024583A1 for specific examples).

[0023] In some embodiments, the L-glutamic acid producing strain may also have one or more genes selected from the following that are attenuated or have reduced expression:

[0024] a. The odhA gene encoding α-ketoglutarate dehydrogenase (see WO2006028298A2 for a specific example);

[0025] b. amtR genes encoding transcriptional regulatory genes (see EP2276845A1 for specific examples);

[0026] c. The acnR gene encoding a transcription repressor (see CN111334535A for specific examples).

[0027] In one specific embodiment of the present invention, the host cell is Corynebacterium glutamicum, which is further modified, specifically by introducing the A111V mutation into the NCgl1221 homologous gene (BBD29_06760 or yggB) in the bacteria and introducing C361Y into the GltA encoding gene to obtain the L-glutamic acid producing strain SCgGC7.

[0028] In some embodiments, the lysine-producing strain may also have one or more genes selected from the following that are attenuated or have reduced expression:

[0029] a. The adhE gene encoding alcohol dehydrogenase;

[0030] b. The ackA gene encoding acetate kinase;

[0031] c. The pta gene encoding phosphorylated acetyltransferase;

[0032] d. The ldhA gene encoding lactate dehydrogenase;

[0033] e. The focA gene encoding the formic acid transporter;

[0034] f. The pflB gene encoding pyruvate-formate lyase;

[0035] g. The poxB gene encoding pyruvate oxidase;

[0036] h. The thrA gene encoding the bifunctional enzyme aspartate kinase I / homoserine dehydrogenase I;

[0037] i. The thrB gene encoding homoserine kinase;

[0038] j. The ldcC gene encoding lysine decarboxylase; and

[0039] h. The cadA gene, which encodes lysine decarboxylase.

[0040] In some embodiments, the lysine-producing strain may also have one or more genes selected from the following enhanced or overexpressed:

[0041] a. The dapA gene, which encodes dihydropyridine synthase that relieves lysine feedback inhibition;

[0042] b. The dapB gene encoding dihydropyridine dicarboxylic acid reductase;

[0043] c. The ddh gene encoding diaminopimelic acid dehydrogenase;

[0044] d. dapD, which encodes tetrahydropyridine dicarboxylic acid succinylase, and dapE, which encodes succinyl diamino pimerate deacylase;

[0045] e. The asd gene encoding aspartate semialdehyde dehydrogenase;

[0046] f. The ppc gene encoding phosphoenolpyruvate carboxylase;

[0047] g. pntAB gene encoding nicotinamide adenine dinucleotide transhydrogenase;

[0048] i. The lysE gene, which encodes the lysine transport protein.

[0049] For example, the host cell is a proline-producing host cell. In some embodiments, the proline-producing host cell may be *Escherichia coli* or *Corynebacterium glutamicum*, or a derivative strain thereof. In some embodiments, the proline-producing host cell may have one or more genes selected from, but not limited to, those included in the following:

[0050] a) Encodes the proB gene, a glutamate kinase that relieves feedback inhibition;

[0051] b) Gene encoding proA, an enzyme in the glutamate-5-hemialdehyde dehydrogenase group;

[0052] c) Gene encoding pyrrole-5-carboxylic acid dehydrogenase proC;

[0053] d) Gene encoding glutamate dehydrogenase GDH;

[0054] e) Gene encoding pyruvate carboxylase (pyc);

[0055] f) Gene encoding gapN, an enzyme containing glyceraldehyde-3-phosphate dehydrogenase;

[0056] g) Encodes the l-proline efflux protein thrE or serE gene.

[0057] In some embodiments, the host cell producing proline may also have one or more genes selected from the following that are attenuated or have reduced expression:

[0058] a) Gene encoding proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase putA;

[0059] b) Gene encoding L-glutamate efflux protein mscCG;

[0060] c) Genes encoding the transport proteins proP / proY / proU.

[0061] For example, the host cell is a host cell that produces hydroxyproline. In some embodiments, the host cell for producing hydroxyproline may be *Escherichia coli* or *Corynebacterium glutamicum*, or a derivative strain thereof. In some embodiments, the host cell for producing hydroxyproline may have one or more genes selected from, but not limited to, those included in the following:

[0062] a) The gene encoding proline hydroxylase;

[0063] b) Encodes the proB gene, a glutamate kinase that relieves feedback inhibition;

[0064] c) Gene encoding proA, an enzyme in the glutamate-5-hemialdehyde dehydrogenase group;

[0065] d) Gene encoding pyrrole-5-carboxylic acid dehydrogenase proC;

[0066] e) Gene encoding glutamate dehydrogenase GDH;

[0067] f) Gene encoding pyruvate carboxylase pyc;

[0068] g) Encodes the gapN gene for glyceraldehyde-3-phosphate dehydrogenase;

[0069] h) Gene encoding the amtB ammonium transporter protein;

[0070] i) Genes encoding the transport proteins proP / proY / proU.

[0071] In some embodiments, the host cell producing hydroxyproline may also have one or more genes selected from the following that are attenuated or have reduced expression:

[0072] a) Gene encoding proline dehydrogenase / pyrrole-5-carboxylic acid dehydrogenase putA;

[0073] b) Gene encoding L-glutamate efflux protein mscCG;

[0074] c) Genes encoding L-proline efflux proteins thrE or serE.

[0075] For example, the host cell is a host cell that produces threonine. In some embodiments, the host cell that produces threonine may be *Escherichia coli* or *Corynebacterium glutamicum*, or a derivative strain thereof. In some embodiments, the host cell that produces threonine may have one or more genes selected from, but not limited to, those included in the following:

[0076] a) Gene encoding aspartate kinase III lysC;

[0077] b) Gene encoding aspartate semialdehyde dehydrogenase asd;

[0078] c) Gene encoding aspartate kinase I thrA;

[0079] d) Gene encoding homoserine kinase thrB;

[0080] e) Gene encoding threonine synthase thrC;

[0081] f) Gene encoding aspartate aminotransferase aspC;

[0082] g) encodes the gnd gene for 6-phosphoglucate dehydrogenase.

[0083] In some embodiments, the host cell for threonine production may be *Escherichia coli* or *Corynebacterium glutamicum*, or a derivative strain thereof. In some embodiments, the host cell for threonine production may also have one or more genes selected from the following weakened or eliminated:

[0084] a) The dapA gene encoding dihydropyridine synthase;

[0085] b) The dapB gene encoding dihydropyridine dicarboxylic acid reductase;

[0086] c) The ackA gene encoding acetate kinase;

[0087] d) The pta gene encoding phosphorylated acetyltransferase;

[0088] e) Encodes the transcriptional regulatory factor tyrR gene.

[0089] For example, the host cell is a host cell that produces 5-aminolevulinic acid. In some embodiments, the host cell for producing 5-aminolevulinic acid may be *Escherichia coli* or *Corynebacterium glutamicum*, or a derivative strain thereof. In some embodiments, the host cell for producing 5-aminolevulinic acid may have one or more genes selected from, but not limited to, those included in the following:

[0090] a) The hemA gene encoding 5-amino acid propionate synthase;

[0091] b) Gene encoding pyruvate carboxylase pyc;

[0092] c) Gene encoding pantothenic acid kinase coaA;

[0093] d) Gene encoding the threonine / homoserine transporter rhtA;

[0094] e) Gene encoding the eamA gene, which encodes the cysteine / O-acetylserine transporter;

[0095] f) Gene encoding alanine: glyoxylate transaminase agt.

[0096] g) Genes that encode antioxidant-related proteins.

[0097] In some embodiments, the host cell for producing 5-amino acid propionic acid may be *Escherichia coli* or *Corynebacterium glutamicum*, or a derivative thereof. In some embodiments, the host cell for producing 5-amino acid propionic acid may also have one or more genes selected from the following weakened or eliminated:

[0098] a) Gene encoding sucCD, a succinyl-CoA synthase;

[0099] b) Gene encoding succinate dehydrogenase sdhAB;

[0100] c) Gene encoding hemB, an enzyme for 5-aminolevulinic acid dehydratase;

[0101] d) Gene encoding isocitrate lyase aceA;

[0102] The gene encoding malate synthase aceB is described. The term "polynucleotide" refers to a polymer composed of nucleotides. A polynucleotide can be a single fragment or a component of a larger nucleotide sequence structure derived from a nucleotide sequence isolated at least once in number or concentration, capable of being recognized, manipulated, and recovered using standard molecular biology methods (e.g., using cloning vectors). This also includes an RNA sequence (i.e., A, U, G, C) when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), where "U" replaces "T". In other words, a "polynucleotide" refers to a polymer of nucleotides removed from other nucleotides (single fragments or entire fragments), or it can be a component or part of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0103] The term "homology" in this invention refers to the percentage of identity between two polynucleotide or polypeptide moieties. Homology between the sequences of one moiety and another can be determined using techniques known in the art. For example, homology can be determined by directly arranging the sequence information of two polynucleotide or polypeptide molecules using readily available computer programs. Examples of such computer programs include BLAST (NCBI), CLC Main Workbench (CLCbio), MegAlign™ (DNASTAR Inc.), etc. Alternatively, homology between polynucleotides can be determined by hybridizing the polynucleotides under conditions of stable double strand formation between homologous regions, digesting them using a single-strand-specific nuclease, and then determining the size of the resulting fragments.

[0104] Secondly, the present invention provides the application of the CgtR2-CgtS2 system mutant or its encoded nucleotide in improving the yield and conversion rate of L-amino acids.

[0105] Thirdly, the present invention provides a method for producing L-amino acids, the method comprising culturing a host cell of the first aspect to produce L-amino acids, and further comprising the step of separating, extracting or recovering L-amino acids from the culture medium.

[0106] In this invention, the culture of the host cells can be carried out according to conventional methods in the art, including but not limited to plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, and various culture conditions such as temperature, time and pH of the culture medium can be appropriately adjusted according to actual conditions.

[0107] The beneficial effects of the present invention are as follows: The weakening of the CgtR2-CgtS2 system provided by the present invention can improve the yield and conversion rate of L-amino acids in the strain, reduce the production cost of amino acids, and provide a new strategy for large-scale production. Attached Figure Description

[0108] Figure 1 The effect of CgtR2-CgtS2 system deficiency on strain cell membrane pressure tolerance.

[0109] Figure 2 The effect of the absence of the CgtR2-CgtS2 system on the activity of the sigE promoter.

[0110] Figure 3 The effect of CgtS2 mutation on the cell membrane pressure tolerance of the strain.

[0111] Figure 4 The effect of CgtS2 mutation on sigE promoter activity. Detailed Implementation

[0112] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While the invention may be practiced or tested using any methods and materials similar to or equivalent to those described herein, the methods and materials provided herein are preferred.

[0113] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental techniques and methods used in the embodiments are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0114] The culture medium used in the examples is as follows:

[0115] The TSB plate medium consists of the following components (g / L): glucose, 5 g / L; yeast extract, 5 g / L; soybean peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K₂HPO₄·3H₂O, 1 g / L; MgSO₄·7H₂O, 0.1 g / L; biotin, 0.01 mg / L; vitamin B1, 0.1 mg / L; MOPS, 20 g / L; and agar powder, 15 g / L.

[0116] The composition of TSB liquid culture medium (g / L) is as follows: glucose, 5 g / L; yeast extract, 5 g / L; soybean peptone, 9 g / L; urea, 3 g / L; succinic acid, 0.5 g / L; K2HPO4·3H2O, 1 g / L; MgSO4·7H2O, 0.1 g / L; biotin, 0.01 mg / L; vitamin B1, 0.1 mg / L; MOPS, 20 g / L.

[0117] The seed culture medium used in the L-glutamic acid fermentation experiment consisted of: glucose, 25 g / L; KH2PO4·3H2O, 2.2 g / L; urea, 3 g / L; corn steep liquor, 33 mL; MgSO4·7H2O, 0.9 g / L; soybean meal hydrolysate, 22 mL; MOPS, 20 g / L; and an initial pH of 7.2.

[0118] The fermentation medium used in the L-glutamic acid fermentation experiment consisted of the following components: glucose, 80 g / L; KH2PO4, 1 g / L; urea, 10 g / L; corn steep liquor powder, 5 g / L; MgSO4·7H2O, 0.4 g / L; FeSO4·7H2O, 10 mg / L; MnSO4·4H2O, 10 mg / L; VB1, 200 μg / L; MOPS, 40 g / L; and an initial pH of 7.5.

[0119] Example 1: Construction of Corynebacterium glutamicum CgtR2-deficient strain

[0120] To verify the effect of the CgtR2-CgtS2 two-component system on L-amino acid synthesis, we took L-glutamic acid as an example. Based on a strain with L-glutamic acid synthesis ability—SCgGC7 (strain information and construction process refer to CN115927325A), we knocked out CgtR2 to inactivate the CgtR2-CgtS2 system and verified its function and its effect on L-glutamic acid synthesis.

[0121] Based on the reported wild-type CgtR2 sequence in Corynebacterium glutamicum ATCC 13869 (amino acid sequence as shown in SEQ ID NO: 1, nucleotide sequence as shown in SEQ ID NO: 2), primers ΔCgtR2-UH-F / ΔCgtR2-UH-R and ΔCgtR2-DH-F / ΔCgtR2-DH-R were designed. Using the ATCC 13869 genome as a template, upstream and downstream homologous arms for CgtR2 deletion were obtained by PCR amplification. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB. Using plasmid pK18mobsacB as a template, linearized vector fragments were obtained by reverse PCR amplification. The upstream and downstream homologous arm fragments were purified and recombined with the linearized vector fragment to obtain the cgtR2 gene deletion vector pK18-ΔCgtR2.

[0122] SCgGC7 competent cells were prepared according to the method reported in the literature (Biotechnology Letters, 2015, 37:2445-52.). 1 μg of pK18-ΔCgtR2 plasmid was electroporated into each of the prepared competent cells. 1 mL of preheated (46℃) TSB medium was added, and the cells were incubated at 46℃ for 6 min, then at 30℃ for 3 h. The transformed cells were then spread onto TSB solid medium containing 25 μg / mL kanamycin and cultured at 30℃ for 1 day to obtain the first recombinant transformants. The correct transformants were transferred to TSB medium containing 5 g / L glucose and cultured overnight, then transferred to TSB medium containing 100 g / L sucrose and cultured at 30℃ for 6 h. After culturing, the transformed cells were spread onto TSB medium supplemented with 100 g / L sucrose for screening to obtain the L-glutamate-producing strain SCgGC7-ΔCgtR2. The primers used in this example are shown in Table 1.

[0123] Table 1 Primers used in this embodiment

[0124] Primers nucleotide sequence ΔCgtR2-UH-F tgacatgattacgaattcAAGAAAGAAGGCATAGGAGGGAAAAC ΔCgtR2-UH-R tgcgagaacaacgttgtatccgt ΔCgtR2-DH-F tacaacgttgttctcgcacttcgacgcaagactgaattgg ΔCgtR2-DH-R cgacggccagtgccaagcttGATCGGTATCCACCATATCTTTAGC pK-F AAGCTTGGCACTGGCCGTCG pK-R GAATTCGTAATCATGTCATAGCTGT

[0125] Example 2: Construction of cgtR2 promoter strength characterization vector

[0126] In mycobacteria, the MprA-MprB system can be activated and upregulated in the addition of sodium dodecyl sulfate (SDS) to induce transcription of itself and SigE. To verify the function of the CgtR2-CgtS2 system in Corynebacterium glutamicum, the inventors constructed a sigE promoter characterization vector and tested its response under cell membrane pressure conditions.

[0127] Based on the sequence of plasmid pEC-XK99E, amplification primers pEC-F and pEC-R were designed to amplify the pEC-XK99E plasmid backbone. Primers GFP-1 / 2 were designed to amplify a green fluorescent protein (gfp) gene DNA fragment containing the DNA sequence GGAGAAAATCGCACCGGAAATCCTGTTTTAGAGCTAGAAAGGAGTTGAGA, using the ATCC 13032::rfp::gfp genome as a template. After purification, the fragment was cloned and ligated using a one-step recombination kit from Novizan to obtain the pEC-RBS-gfp characterization vector.

[0128] Based on the publicly available genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1), amplification primers PsigE-1 / 2 were designed. Using the ATCC 13869 genome as a template, amplification was performed on the P gene containing the sigE gene promoter. sigE(Sequence shown in SEQ ID NO: 13) and a fragment of the N-terminal 60bp sequence. Using pEC-RBS-gfp as a template, the plasmid backbone was amplified using PEC-1 / 2 primers. After purification, the fragments were cloned and ligated using Novizan's one-step recombination kit to obtain pEC-P. sigE -gfp characterization vector. Primers used in this embodiment are shown in Table 2.

[0129] Table 2 Primers used in this embodiment

[0130]

[0131] Example 3: Functional Study of CgtR2-CgtS2 System

[0132] SCgGC7 and SCgGC7-ΔCgtR2 competent cells were prepared using methods reported in the literature (Biotechnology Letters, 2015, 37: 2445-2452). 1 μg of pEC-RBS-gfp and pEC-P were then electroporated into the prepared competent cells, respectively. sigE The GFP characterization vector was added to 1 mL of preheated (46℃) TSB medium, incubated at 46℃ for 6 min, then at 30℃ for 2 h. The mixture was then spread onto TSB solid medium containing 25 μg / mL kanamycin and cultured at 30℃ for 1 day to obtain recombinant strains SCgGC7 / pEC-RBS-gfp, SCgGC7-ΔCgtR2 / pEC-RBS-gfp, and SCgGC7 / pEC-P. sigE -gfp、SCgGC7-ΔCgtR2 / pEC-P sigE -gfp.

[0133] The above-mentioned bacterial strains were inoculated into 24-well plates containing 800 μL of TSB liquid medium with or without 0.01% SDS per well, with three replicates for each strain. The plates were shaken at 800 rpm and incubated at 30°C for 24 h. The fluorescence intensity of the strains was then measured using a microplate reader. The excitation wavelength for fluorescence measurement was 488 nm, and the emission wavelength was 520 nm. Simultaneously, the OD of the bacterial culture was measured. 600 Calculate the fluorescence intensity RFU / OD of the strain. 600 .

[0134] OD values ​​of SCgGC7 / pEC-RBS-gfp and SCgGC7-ΔCgtR2 / pEC-RBS-gfp in different culture media 600 like Figure 1As shown, the CgtR2 knockout strain showed little difference in growth compared to the control strain under normal culture conditions, but its growth was significantly inhibited in the medium supplemented with 0.01% SDS, indicating that the CgtR2-CgtS2 system is very important for maintaining the growth of the strain under cell membrane pressure conditions.

[0135] The fluorescence detection results of the sigE promoter under different strains and culture conditions are shown in the figure. Figure 2 The results showed that under normal culture conditions, the transcriptional intensity of the sigE promoter in the CgtR2 knockout strain was significantly reduced, indicating that sigE transcription depends on the CgtR2-CgtS2 system. Under the stress condition of adding 0.01% SDS, the transcriptional level of the sigE promoter in the control strain increased by 2.97-fold, while the transcriptional level of the sigE promoter in the CgtR2 knockout strain remained low, indicating that the sigE promoter is activated by the CgtR2-CgtS2 system under cell membrane pressure. These results indicate that the CgtR2-CgtS2 system in Corynebacterium glutamicum also participates in the response and regulation of cell membrane pressure, and its modification may be beneficial to the synthesis and secretion of L amino acids.

[0136] Example 4: Effect of CgtR2-CgtS2 system inactivation on L-glutamic acid production

[0137] Since cell membrane pressure and permeability are crucial for L-glutamate secretion in Corynebacterium glutamicum, changes in cell membrane structure can activate glutamate efflux through changes in membrane pressure. Therefore, the inventors hypothesized that the absence of the CgtR2-CgtS2 system might affect L-glutamate secretion. To verify the effect of CgtR2 knockout on L-glutamate production, fermentation tests were conducted on the constructed SCgGC7-ΔCgtR2 strain, with strain SCgGC7 serving as a control.

[0138] Strains SCgGC7 and SCgGC7-ΔCgtR2 were inoculated into seed culture medium and cultured for 8 h. The cultures were then used as seed culture in 24-well plates containing 800 μL of fermentation medium per well. Initial OD 600 The control value was approximately 0.5, the shaker speed was 800 rpm, and each strain was cultured in triplicate at 30°C. Urea was added at 5 g / L after 23 h, and fermentation ended after 25 h. L-glutamic acid production and glucose consumption were measured, and the glucose-to-acid conversion rate was calculated. The results are shown in Table 3.

[0139] Table 3. L-Glutamic Acid Production and Sugar-Acid Conversion Rate

[0140] strain L-Glutamate (g / L) Sugar-acid conversion rate (g / g, %) SCgGC7 8.95±0.13 13.12±0.20 SCgGC7-ΔCgtR2 9.47±0.23 14.68±0.59

[0141] As shown in the table, knocking out CgtR2 can increase L-glutamate production and sugar-acid conversion rate, indicating that the loss of function of the CgtR2-CgtS2 binary system contributes to the synthesis or secretion of L-glutamate.

[0142] Example 5: Construction of CgtR2-CgtS2 system mutant strain

[0143] Furthermore, we found that in a high-L-glutamic acid-producing strain SL4 (Liu Jiao, et al., Mutations in Peptidoglycan Synthesis Gene ponimprove Electrotransformation Efficiency of Corynebacterium glutamicum ATCC13869. Appl. Environ. Microbiol., 2018, 84, e02225-02218.) screened by the inventors in the early stage, the 4th arginine of CgtR2 was replaced by leucine, the 198th glycine of CgtS2 was replaced by arginine, and the 380th glycine was replaced by leucine. Given that Example 2 has demonstrated that the deletion of CgtR2 can enhance the L-glutamic acid production of the strain, it is speculated that these mutants may also affect L-glutamic acid production.

[0144] (1) Construction of CgtR2 unit point mutant strain

[0145] Based on the publicly available genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1) and the sequence of wild-type CgtR2 (its amino acid sequence is shown in SEQ ID NO: 1, and its nucleotide sequence is shown in SEQ ID NO: 2), amplification primers CgtR2-F1 / R1 and CgtR2-F2 / R2 were designed. Using the ATCC 13869 genome as a template, amplification of the structure containing CgtR2 was performed. R4L Upstream and downstream recombination fragments of the mutant. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB. Using plasmid pK18mobsacB as a template, linearized vector fragments were obtained by reverse PCR amplification. The above three fragments were recovered and recombinated to obtain a vector containing CgtR2. R4L The mutant's editing plasmid pK18-CgtR2 R4L .

[0146] Electroporation of 1 μg of pK18-CgtR2 into SCgGC7 competent cells R4LThe plasmid was added to 1 mL of preheated (46°C) TSB medium and incubated at 46°C for 6 min, then at 30°C for 3 h. The resulting transformants were then spread onto TSB solid medium containing 25 μg / mL kanamycin and cultured at 30°C for 24 h to obtain the first recombinant transformants. The correct transformants were then transferred to TSB medium containing 5 g / L glucose and cultured overnight, followed by transfer to TSB medium containing 100 g / L sucrose and cultured at 30°C for 4 h. After culturing, the transformants were spread onto TSB medium supplemented with 100 g / L sucrose for screening, yielding the L-glutamic acid producing strain SCgGC7-CgtR2 carrying the mutant CgtR2. R4L That is, the strain contains the mutated CgtR2 (its amino acid sequence is shown in SEQ ID NO: 3, and its nucleotide sequence is shown in SEQ ID NO: 4).

[0147] (2) Construction of CgtS2 unit point mutant strain

[0148] Based on the publicly available genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1) and the sequence of wild-type CgtS2 (its amino acid sequence is shown in SEQ ID NO: 5, and its nucleotide sequence is shown in SEQ ID NO: 6), amplification primers were designed. Primers CgtS2-F1 / R1, CgtS2-F2 / R3 and CgtS2-F1 / R2, CgtS2-F3 / R3 were used, respectively, to amplify sequences containing CgtS2, using the ATCC 13869 genome as a template. G198R and CgtS2 G380W Upstream and downstream recombination fragments of the mutant. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB. Using plasmid pK18mobsacB as a template, linearized vector fragments were obtained by reverse PCR amplification. The above three fragments were recovered and recombinated to obtain the CgtS2-containing vector fragment. G198R and CgtS2 G380W The mutant's edit plasmid pK18-CgtS2 G198R and pK18-CgtS2 G380W .

[0149] Electroporation of 1 μg of pK18-CgtS2 into SCgGC7 competent cells G198R and pK18-CgtS2 G380WThe plasmid was added to 1 mL of preheated (46°C) TSB medium and incubated at 46°C for 6 min, then at 30°C for 3 h. The resulting transformants were then spread onto TSB solid medium containing 25 μg / mL kanamycin and cultured at 30°C for 24 h to obtain the first recombinant transformants. The correct transformants were then transferred to TSB medium containing 5 g / L glucose and cultured overnight, followed by transfer to TSB medium containing 100 g / L sucrose and cultured at 30°C for 4 h. After culturing, the transformants were spread onto TSB medium supplemented with 100 g / L sucrose for screening, yielding the L-glutamic acid producing strain SCgGC7-CgtS2 carrying the mutant CgtS2. G198R and SCgGC7-CgtS2 G380W This means that the strain contains the mutated CgtR2 (its amino acid sequence is shown in SEQ ID NO: 7 and SEQ ID NO: 9, and its nucleotide sequence is shown in SEQ ID NO: 8 and SEQ ID NO: 10).

[0150] (3) Construction of CgtS2 two-site mutant strain

[0151] Based on the publicly available genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1) and the sequence of wild-type CgtS2, amplification primers CgtS2-F1 / R1, CgtS2-F2 / R2, and CgtS2-F3 / R3 were designed. Using the ATCC 13869 genome as a template, amplification of sequences containing CgtS2 was performed. G198R,G380W Recombinant fragments of the mutant. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB. Using plasmid pK18mobsacB as a template, linearized vector fragments were obtained by reverse PCR amplification. The above four fragments were recovered and recombined to obtain the CgtS2-containing vector fragment. G198R,G380W The mutant's edit plasmid pK18-CgtS2 G198R ,G380W This means that the strain contains CgtS2. G198R,G380W The mutant (its amino acid sequence is shown in SEQ ID NO: 11, and its nucleotide sequence is shown in SEQ ID NO: 12).

[0152] Electroporation of 1 μg of pK18-CgtS2 into SCgGC7 competent cells G198R,G380WThe plasmid was added to 1 mL of preheated (46°C) TSB medium and incubated at 46°C for 6 min, then at 30°C for 3 h. The resulting transformants were then spread onto TSB solid medium containing 25 μg / mL kanamycin and cultured at 30°C for 24 h to obtain the first recombinant transformants. The correct transformants were then transferred to TSB medium containing 5 g / L glucose and cultured overnight, followed by transfer to TSB medium containing 100 g / L sucrose and cultured at 30°C for 4 h. After culturing, the transformants were spread onto TSB medium supplemented with 100 g / L sucrose for screening, yielding the L-glutamic acid producing strain SCgGC7-CgtS2 carrying the mutant CgtS2. G198R,G380W This means that the strain contains the mutated CgtS2 (its amino acid sequence is shown in SEQ ID NO: 11, and its nucleotide sequence is shown in SEQ ID NO: 12). The primers used in this example are shown in Table 4.

[0153] Table 4. Primers used in this embodiment

[0154]

[0155]

[0156] Example 6: Effects of CgtR2 and CgtS2 mutants on L-glutamate production

[0157] To verify CgtR2 R4L ,CgtS2 G198R ,CgtS2 G380W ,CgtS2 G198R,G380W The effect of mutants on the L-glutamic acid yield and conversion rate of the strain was compared with that of SCgGC7-CgtR2 constructed in Example 5. R4L SCgGC7-CgtS2 G198R SCgGC7-CgtS2 G380W SCgGC7-CgtS2 G198R,G380W The strain was tested for fermentation, with strain SCgGC7 used as a control.

[0158] The fermentation process was the same as in Example 4, and the fermentation results are shown in Table 5. As can be seen from the table, CgtR2... R4L ,CgtS2 G198R ,CgtS2 G380W ,CgtS2 G198R,G380W The mutant can significantly increase the yield of L-glutamic acid and the sugar-acid conversion rate, and has good application prospects in the production of L-glutamic acid and its derivatives.

[0159] Table 5. L-Glutamic Acid Production and Sugar-Acid Conversion Rate

[0160] strain L-Glutamate (g / L) Sugar-acid conversion rate (g / g, %) SCgGC7 8.95±0.13 13.12±0.20 <![CDATA[SCgGC7-CgtR2 R4L ]]> 10.67±0.42 15.22±0.42 <![CDATA[SCgGC7-CgtS2 G198R ]]> 9.60±0.15 14.09±0.20 <![CDATA[SCgGC7-CgtS2 G380W ]]> 9.54±0.09 13.79±0.22 <![CDATA[SCgGC7-CgtS2 G198R,G380W ]]> 10.29±0.53 15.18±0.94

[0161] Example 7: The effect of CgtS2 mutation on the CgtR2-CgtS2 system

[0162] To test the impact of mutants related to the CgtR2-CgtS2 system on its function, the inventors chose to target SCgGC7-CgtS2. G198R,G380W The growth of the strain under cell membrane stress conditions and the response of downstream regulatory promoters were tested.

[0163] SCgGC7-CgtS2 was prepared using methods reported in the literature. G198R,G380W Competent cells (Biotechnology Letters, 2015, 37: 2445-52.) were electroporated with 1 μg of pEC-RBS-gfp and pEC-P to the competent cells prepared above. sigE The -gfp characterization vector was added to 1 mL of preheated (46℃) TSB medium, incubated at 46℃ for 6 min, then at 30℃ for 2 h. The mixture was then spread onto TSB solid medium containing 25 μg / mL kanamycin and incubated at 30℃ for 1 day to obtain the characterization strain SCgGC7-CgtS2. G198R,G380W / pEC-RBS-gfp and SCgGC7-CgtS2 G198R,G380W / pEC-P sigE -gfp.

[0164] strains SCgGC7 / pEC-RBS-gfp and SCgGC7-CgtS2 were used. G198R,G380W / pEC-RBS-gfp, SCgGC7 / pEC-P sigE -gfp,SCgGC7-CgtS2 G198R,G380W / pEC-P sigE -gfp determined the bacterial culture OD according to the method in Example 3. 600 Fluorescence intensity RFU / OD of strains 600 The results of the CgtS2 mutant strain's tolerance to cell membrane pressure are as follows: Figure 3 As shown, the results indicate that the growth trend of the mutant strain is consistent with that of the CgtR2-CgtS2 system deletion strain. Under culture conditions with 0.01% SDS, the strain growth was significantly inhibited, indicating that the mutation weakens or inactivates the CgtR2-CgtS2 system. Fluorescence detection results of the sigE promoter in the CgtS2 mutant strain are shown in [Figure number missing]. Figure 4Compared with data from strains inactivated by the CgtR2-CgtS2 system, the CgtS2 mutation did not significantly affect the transcriptional activity of the sigE promoter; the transcriptional level decreased by only 4.65% under culture conditions with 0.01% SDS. In summary, this indicates that mutations in CgtR2 and CgtS2 may weaken the function of the CgtR2-CgtS2 system within the bacteria, leading to enhanced L-glutamate synthesis or secretion.

Claims

1. A method for producing L-amino acids from Corynebacterium glutamicum or Escherichia coli, characterized in that: It is obtained by weakening the CgtR2-CgtS2 system in Corynebacterium glutamicum or Escherichia coli. Specifically, the weakening means that compared with the wild-type CgtR2-CgtS2, cgtR2 Genes and / or cgtS2 Gene expression is reduced, weakened or even completely eliminated, or a gene is produced that is not expressed, or although expressed, the expression product has no activity or has reduced activity.

2. The method according to claim 1, characterized in that The CgtR2-CgtS2 system cgtR2 The gene is selected from cgl0874 or BBD29_04835, cgtS2 Gene selected from cgl0875 or BBD29_04840; Preferably, the wild-type CgtR2 and CgtS2 in the CgtR2-CgtS2 system are polypeptides having amino acid sequences as shown in SEQ ID NO: 1 and SEQ ID NO:

5.

3. The method according to claim 2, characterized in that The weakening is achieved by knocking out cgtR2 Genes and / or cgtS2 The invention relates to a method for preparing the nucleotide sequence of the present invention and / or a method for preparing the nucleotide sequence of the present invention. The method comprises: introducing a leucine mutation at position 4 corresponding to SEQ ID NO: 1, introducing an arginine mutation at position 198 corresponding to SEQ ID NO: 5, and / or introducing a tryptophan mutation at position 380 corresponding to SEQ ID NO:

5.

4. The method according to any one of claims 1 to 3, characterized in that The starting Corynebacterium glutamicum is a glutamate-producing strain, specifically selected from Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, or mutants or strains prepared from the above strains that produce L-amino acids; Preferably, the starting Corynebacterium glutamicum is selected from strains modified on the basis of Corynebacterium glutamicum ATCC 13032 and Corynebacterium glutamicum ATCC13869, wherein the modifications include but are not limited to one or more genes selected from the following being enhanced or overexpressed: a. Encoding mechanosensitive channel proteins ygB Gene; b. Encoding phosphoketolase fxpk Gene; c. Encoding pyruvate carboxylase pyc Gene; d. Encoding glutamate dehydrogenase gd Gene; e. Gene encoding carbonic anhydrase.

5. The method according to claim 1, characterized in that The starting Corynebacterium glutamicum may also include, but is not limited to, one or more genes selected from the following being weakened or having reduced expression: a. Encoding α-ketoglutarate dehydrogenase odhA Gene; b. Encoding transcriptional regulatory genes ikB Gene; c. Encoding transcriptional repressors acn Gene; Preferably, further, the NCgl1221 homologous gene (BBD29_06760 or ygB ) and C361Y were introduced into the GltA encoding gene to obtain the L-glutamate producing strain SCgGC7.

6. The method according to claim 5, characterized in that The starting Corynebacterium glutamicum is a lysine producing strain, and further may include but is not limited to one or more genes selected from the following being weakened or having reduced expression: a. Encoding alcohol dehydrogenase adhE Gene; b. Encoding acetate kinase ackA Gene; c. Encoding phosphate acetyltransferase pta Gene; d. Encoding lactate dehydrogenase oeLh Gene; e. Encoding formate transporter foc Gene; f. Encoding pyruvate formate lyase pB Gene; g. Encoding pyruvate oxidase poxB Gene; h. Encoding bifunctional aspartate kinase I / homoserine dehydrogenase I thrA Gene; i. Encoding homoserine kinase tB Gene; j. Encoding lysine decarboxylase LqCy Gene; and h. Encoding lysine decarboxylase cadA Gene; Furthermore, the lysine-producing strain further includes, but is not limited to, one or more genes selected from the following being enhanced or overexpressed: a. Encoding a dihydrodipyridine synthase that relieves lysine feedback inhibition dapA Gene; b. Encoding dihydrodipicolinate reductase dapB Gene; c. Encoding diaminopimelate dehydrogenase dhdh Gene; d. Encoding tetrahydropicolinate succinylase dapD and encoding succinyldiamidinopimelate deacylase dapE ; e. Encoding aspartate semialdehyde dehydrogenase asd Gene; f. p encoding phosphoenolpyruvate carboxylase pc Gene; g. Encoding nicotinamide adenine dinucleotide transhydrogenase pntAB Gene; i. Lysine transport protein lysE Gene; Alternatively, the starting strain is a proline-producing strain, such as Escherichia coli or Corynebacterium glutamicum or a derivative thereof, and one or more genes selected from the following may be enhanced or overexpressed in the proline-producing host cell, including but not limited to: a) Encodes a glutamate kinase that relieves feedback inhibition proB Gene; b) Encodes glutamate 5-semialdehyde dehydrogenase proA Gene; c) Encoding pyrrole-5-carboxylate dehydrogenase proC Gene; d) Encodes glutamate dehydrogenase gd Gene; e) Encodes pyruvate carboxylase pyc Gene; f) Encodes glyceraldehyde-3-phosphate dehydrogenase gapN Gene; g) Encodes an L-proline efflux protein oeLh or sE Gene; Further, the proline-producing strain may include, but is not limited to, one or more genes selected from the following being weakened or having reduced expression: a) Encoding proline dehydrogenase / pyrrole-5-carboxylate dehydrogenase putA Gene; b) Encodes L-glutamate efflux protein mscCG Gene; c) Encoding transporter proP / proY / proU Gene; Alternatively, the starting Escherichia coli or Corynebacterium glutamicum is a hydroxyproline producing strain; preferably, one or more genes selected from the group consisting of but not limited to the following may be enhanced or overexpressed in the host cell producing hydroxyproline: a) Gene encoding proline hydroxylase; b) Encodes a glutamate kinase that relieves feedback inhibition proB Gene; c) Encodes glutamate 5-semialdehyde dehydrogenase proA Gene; d) Encoding pyrrole-5-carboxylate dehydrogenase proC Gene; e) Encodes glutamate dehydrogenase gd Gene; f) Encodes pyruvate carboxylase pyc Gene; g) Encodes glyceraldehyde-3-phosphate dehydrogenase gapN Gene; h) Encodes an ammonium transporter B Gene; i) Encoding transporter proP / proY / proU Gene; Furthermore, the hydroxyproline producing strain also includes, but is not limited to, one or more genes selected from the following being weakened or having reduced expression: a) Encoding proline dehydrogenase / pyrrole-5-carboxylate dehydrogenase putA Gene; b) Encodes L-glutamate efflux protein mscCG Gene; c) Encodes L-proline efflux protein oeLh or sE Gene; Alternatively, the starting Escherichia coli or Corynebacterium glutamicum is a threonine producing strain; preferably, one or more genes selected from the group consisting of but not limited to the following are enhanced or overexpressed in the threonine producing strain: a) Encodes aspartate kinase III lysC Gene strains; b) Encodes aspartate semialdehyde dehydrogenase asd Gene; c) Encodes aspartate kinase I thrA Gene; d) Encodes homoserine kinase tB Gene; e) Encodes threonine synthase Tc Gene; f) Encodes aspartate aminotransferase aspC Gene; g) Encodes 6-phosphogluconate dehydrogenase gnd Gene; Alternatively, the starting Escherichia coli or Corynebacterium glutamicum is a hydroxyproline producing strain; preferably, one or more genes selected from the group consisting of, but not limited to, the following genes may be weakened or eliminated in the host cell producing threonine: a) Encoding dihydrodipyridine synthase dapA Gene; b) Encoding dihydrodipicolinate reductase dapB Gene; c) Encoding acetate kinase ackA Gene; d) Encoding phosphate acetyltransferase pta Gene; e) Encodes transcriptional regulatory factors tyR Gene; Alternatively, the starting Escherichia coli or Corynebacterium glutamicum is a 5-aminolevulinic acid producing strain; preferably, one or more genes selected from the group consisting of but not limited to the following are enhanced or overexpressed in the 5-aminolevulinic acid producing strain: a) Encodes 5-amino acid propionate synthase hemA Gene; b) Encodes pyruvate carboxylase pyc Gene; c) Encodes pantothenate kinase aa Gene; d) Encoding threonine / homoserine transporter oeLh Gene; e) Encodes a cysteine / O-acetylserine transporter eamA Gene; f) Encoding alanine:glyoxylate aminotransferase agt Gene; g) genes encoding antioxidant-related proteins; Alternatively, the starting Escherichia coli or Corynebacterium glutamicum is a 5-amino acid propionic acid producing strain; preferably, one or more genes selected from the group consisting of but not limited to the following may be weakened or eliminated in the host cell producing 5-amino acid propionic acid: a) sucCD gene encoding succinyl-CoA synthetase; b) a gene encoding succinate dehydrogenase sdhAB; c) hemB gene encoding 5-aminolevulinic acid dehydratase; d) Encodes isocitrate lyase aceA Gene; e) Encoding malate synthase aceB Gene.

7. The L-amino acid-producing Corynebacterium glutamicum, Escherichia coli or Corynebacterium glutamicum obtained by the method according to any one of claims 1 to 6.

8. Use of the L-amino acid-producing Corynebacterium glutamicum or Escherichia coli as claimed in claim 7 in improving the yield and conversion rate of L-amino acids.

9. A method for producing L-amino acids, comprising culturing the L-amino acid-producing Corynebacterium glutamicum or Escherichia coli according to any one of claims 1 to 6 to produce L-amino acids, and further comprising the step of separating, extracting or recovering the L-amino acids from the culture medium; specifically, the culturing is selected from well plate culture, shake flask culture, batch culture, continuous culture or fed-batch culture; preferably, the L-amino acid is any one of L-glutamic acid, L-lysine, L-threonine, L-proline, L-hydroxyproline, L-isoleucine, L-leucine, L-valine, L-ornithine, L-arginine, and 5-aminolevulinic acid.

Images