Genetically engineered bacteria for producing D-pantothenic acid based on one-carbon unit supply, construction method thereof and application thereof

Abstract

The present invention provides a high-yield D-pantothenic acid genetic engineering bacterium based on one-carbon unit supply, and its construction method and application. The present invention mainly enhances cofactor supply by strengthening the glycine cleavage system and the folic acid synthesis pathway; further moderately strengthens the key genes of the serine pathway, reasonably regulates the serine synthesis rate, enhances the carbon flux flowing towards the synthesis of D-pantothenic acid, and finally strengthens the key genes of the D-pantothenic acid synthesis pathway, improves the expression efficiency of the genetic engineering bacterium, significantly increases the yield of D-pantothenic acid, and finally obtains a plasmid-free and antibiotic-free high-yield strain for high-yield D-pantothenic acid; the titer of the strain of the present invention in shake flasks reaches 7.96 g / L, which is 16.3% higher than that of the starting strain. Finally, using a 5 L fermenter for fermentation for 96 hours, the yield of D-pantothenic acid reaches 147.3 g / L, greatly improving the synthesis of D-pantothenic acid.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a genetically engineered bacterium with high yield of D-pantothenic acid based on one-carbon unit supply and a construction method thereof, as well as the application of the genetically engineered bacterium with high yield of D-pantothenic acid in the microbial fermentation preparation of D-pantothenic acid. Background Art

[0002] Pantothenic acid (PA), an important member of the vitamin B family, also known as vitamin B5 or pantothenic acid, is an essential vitamin for maintaining normal energy metabolism in life. It was first isolated from yeast in 1933 and widely exists in various foods in nature, especially in animal livers, vegetables and whole grain foods. As a component of coenzyme A (CoA) and acyl carrier protein (ACP), D-pantothenic acid participates in biochemical reactions such as fatty acid synthesis, protein metabolism and energy metabolism, has a variety of biological functions, is crucial for maintaining normal physiological functions, and is widely used in industries such as the pharmaceutical industry, food industry, feed processing and cosmetics. It is expected that its global market value will continue to grow in the next few years.

[0003] At present, the chemoenzymatic method is the mainstream production method of D-pantothenic acid, which has advantages such as substrate specificity and mild reaction conditions, but has low productivity, high cost, difficulty in industrialization and generation of toxic and harmful substances during the production process, which is contrary to the concept of green development. Compared with the traditional chemical production method, the products produced by microbial cell factories are more environmentally friendly, reducing environmental pollution and meeting the urgent need of modern society for green production. In addition, this production method can also achieve carbon neutrality, that is, the carbon emissions during the production process reach zero or negative values, thereby reducing the negative impact on the content of carbon dioxide in the atmosphere and being conducive to coping with the challenges of climate change, providing a more environmentally friendly and more economically beneficial production method of D-pantothenic acid.

[0004] However, the microbial fermentation method also faces challenges such as strain selection, fermentation scale-up, and difficulties in downstream separation and purification. The new generation of intelligent, energy-saving and efficient fermentation engineering technology is an important development direction in the future. Summary of the Invention

[0005] To solve the technical problem of low production of D-pantothenic acid in microbial fermentation in the prior art, the present invention uses the CRISPR-Cas9 mediated gene editing technology to strengthen the glycine cleavage system and folic acid synthesis pathway in the chassis bacterium genome, strengthen the cofactor supply; further moderately strengthen the key genes of the serine pathway, reasonably regulate the serine synthesis rate, enhance the carbon flux towards the synthesis of D-pantothenic acid, and finally strengthen the key genes of the D-pantothenic acid synthesis pathway to improve the expression efficiency of the genetically engineered bacterium, and finally obtain a genetically engineered bacterium with high yield of D-pantothenic acid, and apply this genetically engineered bacterium to the microbial fermentation preparation of D-pantothenic acid.

[0006] The technical solution adopted by the present invention is: a method for constructing a genetically engineered bacterium with high yield of D-pantothenic acid, including: using the CRISPR-Cas9 mediated gene editing technology, in the chassis bacterium genome: strengthening pabC gene expression; increasing gcvTHP gene copy number and strengthening expression; weakening nac gene expression; strengthening serA gene, glyA gene expression and dynamically regulating serA gene, glyA gene expression by using Apt2#82 riboswitch; increasing panB gene copy number and strengthening expression to obtain a genetically engineered bacterium with high yield of D-pantothenic acid.

[0007] Based on the chassis bacterium DPAH8 ( E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ), the present invention comprehensively applies the systematic metabolic engineering strategy, uses the CRISPR / Cas9 gene editing technology to strengthen the genes related to the THF synthesis pathway, replaces the in-situ promoter of the pabC gene with the Trc promoter, enhances the folic acid synthesis pABA pathway, promotes folic acid accumulation, provides a methyl carrier for one-carbon units, and inyeej Pseudogene locus increases Trc -gcvTHP gene copy number, cleaves intracellular glycine to produce 5,10-MTHF and NADH, eliminates glycine inhibition, strengthens cofactor supply; down-regulates nac the start codon, relieves the transcriptional inhibition of the glycine cleavage system by nac and purR regulatory factors, eliminates glycine accumulation, and continuously and effectively provides one-carbon units for the synthesis of D-pantothenic acid. On this basis, to further enhance the carbon flux towards the synthesis of D-pantothenic acid, by replacing the promoter to enhance the real-time control expression of Apt2#82 glycine riboswitch on serA, glyA genes, moderately strengthens the key genes of the serine pathway, and reasonably regulates the serine synthesis rate. Finally, at tfad the pseudogene locus, increases the copy number of the key genes in the D-pantothenic acid synthesis pathway panB to improve the expression efficiency of the genetically engineered bacterium, increase the yield of D-pantothenic acid, and finally obtain an engineered strain without plasmid and antibiotic addition for high-yield D-pantothenic acid production.

[0008] Table 1. Genes and corresponding pathways involved in gene editing

[0009] gene involved pathway folic acid synthesis glycine synthesis glycine synthesis serine synthesis serine synthesis pantoic acid synthesis

[0010] Preferably, the method for strengthening pabC gene expression includes: replacing the in-situ promoter of pabC gene with the Trc promoter. Enhancing the pABA pathway of folic acid synthesis through a strong promoter, promoting the combination of the pABA and GTP pathways, strengthening folic acid synthesis, and providing a methyl carrier for one-carbon units.

[0011] Preferably, the method for increasing gcvTHP gene copy number and strengthening expression includes: increasing the copy number of yeej gene regulated by the Trc promoter at the pseudogene locus. Enhancing the glycine cleavage system to cleave intracellular glycine to produce 5,10-MTHF and NADH, eliminating glycine inhibition, strengthening cofactor supply, and increasing the synthesis of D-pantothenic acid. gcvTHP gene copy number regulated by the Trc promoter at the pseudogene locus. Enhancing the glycine cleavage system to cleave intracellular glycine to produce 5,10-MTHF and NADH, eliminating glycine inhibition, strengthening cofactor supply, and increasing the synthesis of D-pantothenic acid.

[0012] Preferably, the method for weakening nac gene expression includes mutating the start codon of nac gene to TTG. Thus, relieving the transcriptional inhibition of the glycine cleavage system by nac and purR regulatory factors, eliminating glycine accumulation, and continuously and effectively providing one-carbon units for the synthesis of D-pantothenic acid.

[0013] Preferably, the method for strengthening serA gene, glyAExpression of genes and dynamic regulation using the Apt2#82 riboswitch serA gene glyA The method for gene expression includes: respectively replacing the in-situ promoters of serA gene and glyA gene with the Trc promoter, and inserting the Apt2#82 riboswitch behind the Trc promoter respectively. Thus, the key genes in the serine pathway are moderately enhanced. This strategy can reasonably regulate the serine synthesis rate, keep intracellular glycine at a low level, and effectively promote the synthesis of D-pantothenic acid.

[0014] Preferably, the method for increasing panB the gene copy number and enhancing the expression includes: increasing the copy number of tfad gene regulated by the PpanB promoter at the panB pseudogene locus. Thus, the expression efficiency of the genetically engineered bacterium is improved, it can better respond to methyl supply, and promote the synthesis of D-pantothenic acid.

[0015] Preferably, the chassis bacterium is: E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serA / Apt2#82 glyA- P panB -panB / gapC ::Trc- alsS* Among them, the construction method of the chassis bacterium preferably includes:

[0016] (1)Using the engineered bacterium E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkBUsing it as the starting strain and naming it DPAH2, the in-situ promoter of the gcvTHP gene in its genome was replaced with the Trc promoter, and the transcriptional regulatory region was deleted to obtain the engineered strain DPAH3 derivative, Trc- gcvTHP , denoted as the engineered strain DPAH3;

[0017] (2) Using the engineered strain DPAH3 as the starting strain, the CRISPR-Cas9-mediated gene editing technology was used to add one copy of the lafU gene at the pseudogene locus to obtain the engineered strain DPAH6 derivative, folP :: lafU :: folP , denoted as the engineered strain DPAH6;

[0018] (3) Using the engineered strain DPAH6 as the starting strain, the CRISPR / Cas9 gene editing technology was used to integrate the serA and glyA gene clusters on the genome, and then add one copy of the panB gene after the gene cluster to obtain the engineered strain DPAH7 derivative, yeeP::Trc-Apt2#82- serAglyA- P panB -panB , denoted as the engineered strain DPAH7;

[0019] (4) Using the engineered strain DPAH7 as the starting strain, the CRISPR / Cas9 gene editing technology was used to increase the copy number of the alsS gene of Bacillus subtilis regulated by the promoter pTrc in the genome and perform codon optimization to obtain the engineered strain DPAH8 derivative, gapC ::Trc- alsS* , denoted as the engineered strain DPAH8, which is the genetically engineered strain for high-yield D-pantothenic acid.

[0020] Preferably, the nucleotide sequences of the pabC gene, 、gcvTHP gene, serA gene, 、glyA gene, panB gene regulated by the Ptrc promoter are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ.ID.NO.5 respectively; nac The nucleotide sequence of the

[0021] More specifically, the method for constructing the genetically engineered bacterium with high D-pantothenic acid production comprises the following steps:

[0022] (1) Using the engineered bacterium E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serA / Apt2#82 glyA- P panB -panB / gapC ::Trc- alsS* as the starting strain and naming it DPAH8, applying the CRISPR-Cas9 mediated gene editing technology to replace the in-situ promoter of the pabC gene in its genome with the Trc promoter to obtain the engineered bacterium DPAH9 derivative, Trc- pabC , denoted as the engineered bacterium DPAH9;

[0023] (2) Using the engineered bacterium DPAH9 as the starting strain, applying the CRISPR-Cas9 mediated gene editing technology to increase the yeej gene copy number at the trc-gcvTHP pseudogene locus to obtain the engineered bacterium DPAH10 derivative, yeej :: trc- gcvTHP , denoted as the engineered bacterium DPAH10;

[0024] (3) Using the engineered bacterium DPAH10 as the starting strain, applying the CRISPR / Cas9 gene editing technology to mutate the nac start codon to TTG in the genome to obtain the engineered bacterium DPAH11 derivative, nac TTG , denoted as the engineered bacterium DPAH11;

[0025] (4) Using the engineered bacterium DPAH11 as the starting strain, applying the CRISPR / Cas9 gene editing technology to serAThe in-situ promoter was replaced with the Trc promoter, and the riboswitch Apt2#82 was inserted after the promoter to obtain the engineered strain DPAH12 derivative, Trc-Apt2#82 serA , denoted as the engineered strain DPAH12;

[0026] (5) Using the engineered strain DPAH12 as the starting strain and applying the CRISPR / Cas9 gene editing technology, in the genome glyA The in-situ promoter was replaced with the Trc promoter, and the riboswitch Apt2#82 was inserted after the promoter to obtain the engineered strain DPAH13 derivative, Trc-Apt2#82- glyA , denoted as the engineered strain DPAH13;

[0027] (6) Using the engineered strain DPAH13 as the starting strain and applying the CRISPR / Cas9 gene editing technology, at tfad the pseudogene locus, the panB gene copy number was increased to obtain the engineered strain DPAH14 derivative, tfad :: trc- panB , denoted as the engineered strain DPAH14, namely the genetically engineered strain for high-yield D-pantothenic acid.

[0028] The present invention also provides a genetically engineered strain for high-yield D-pantothenic acid constructed by the method described above. Through the above method, the present invention has constructed a genetically engineered strain without plasmids and without the addition of antibiotics during the fermentation process. Preferably, the genetically engineered strain for high-yield D-pantothenic acid is: E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* / Trc- pabC / yeej :: trc- gcvTHP / nac TTG / Trc-Apt2#82-serA / Trc-Apt2#82 glyA / tfad ::Trc- panB The titer of this strain in shake flask reached 7.96 g / L, which was 16.3% higher than that of the original strain. Finally, fed-batch fermentation was carried out in a 5 L fermenter for 96 hours, and the D-pantothenic acid yield could reach 147.3 g / L, greatly improving the synthesis of D-pantothenic acid and shortening the fermentation cycle.

[0029] The present invention also provides the application of the above-mentioned genetically engineered bacterium with high yield of D-pantothenic acid in the microbial fermentation for preparing D-pantothenic acid.

[0030] Preferably, the application includes: inoculating the genetically engineered bacterium with high yield of D-pantothenic acid into a fermentation medium, and carrying out fed-batch fermentation culture at 28-37 °C, 300-450 rpm, pH 6.7-6.9, and dissolved oxygen 10-30% for 72-96 h, and separating and purifying to obtain the D-pantothenic acid after the fermentation is completed.

[0031] Preferably, the composition of the fermentation medium is as follows: glucose 10-30 g / L, ammonium sulfate 10-25 g / L, anhydrous betaine 1-5 g / L, yeast powder 1-5 g / L, potassium dihydrogen phosphate 1-5 g / L, anhydrous magnesium sulfate 0.5-2 g / L, β-alanine 1-5 g / L, 1-5 ml / L trace element solution, the solvent is deionized water, and the pH value is natural; the composition of the trace element solution is: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0032] Preferably, the application includes: loading 1-3 L of the fermentation medium into a 5 L fermenter, sterilizing at 115 °C for 30 min, inoculating the genetically engineered bacterium strain into 1-3 L of the fermentation medium, and carrying out fermentation culture at 28-37 °C, initial aeration rate 3-6 L / min, and initial stirring speed 300-450 rpm, adjusting the pH with ammonia water, and adding IPTG with a final concentration of 0.1-0.4 mM, VB1 with a final concentration of 5 mg / L, VB 12, and 5 - 10 mL of isoleucine at 10 - 40 g / L; during the fermentation process, the dissolved oxygen is maintained at 10% - 30% by using the dissolved oxygen in series with the rotational speed, ammonia water is used as a neutralizing agent to maintain the pH at 6.7 - 6.9, the feeding medium is added into the tank through pH - linked feeding, the glucose concentration is controlled below 5 g / L, and it is cultured at 28 - 37 °C for 72 - 96 hours to obtain the fermentation broth. The supernatant of the fermentation broth is taken and separated and purified to obtain the D - pantothenic acid. Among them, the composition of the feeding medium is as follows: glucose 500 g / L, ammonium sulfate 5 - 25 g / L, anhydrous betaine 2 - 8 g / L, yeast powder 1 - 5 g / L, potassium dihydrogen phosphate 10 - 20 g / L, anhydrous magnesium sulfate 5 - 15 g / L, β - alanine 40 - 100 g / L, 1 - 5 ml / L of trace element solution, the solvent is deionized water, and the pH value is natural.

[0033] The beneficial effects of the present invention: The present invention uses the CRISPR / Cas9 gene editing technology to strengthen the glycine cleavage system and the folic acid synthesis pathway on the basis of the existing engineering strain DPAH8, strengthening the cofactor supply; further moderately strengthening the key genes of the serine pathway, reasonably regulating the serine synthesis rate, enhancing the carbon flux flowing towards the synthesis of D - pantothenic acid, and finally strengthening the key genes of the D - pantothenic acid synthesis pathway to improve the expression efficiency of the genetically engineered bacteria, significantly increasing the yield of D - pantothenic acid, and finally obtaining a high - yield strain without plasmid and without antibiotic addition for high - yield D - pantothenic acid; the titer of the strain of the present invention in the shake flask reaches 7.96 g / L, which is increased by 16.3% compared with the starting strain. Finally, using a 5 L fermenter for fermentation for 96 hours, the yield of D - pantothenic acid reaches 147.3 g / L, greatly improving the synthesis of D - pantothenic acid. Brief Description of the Drawings

[0034] Figure 1 It is the change of OD600 and D - pantothenic acid titer of DPAH9 in Example 1.

[0035] Figure 2 It is the change of OD600 and D - pantothenic acid titer of DPAH10 in Example 1.

[0036] Figure 3 It is the change of OD600 and D - pantothenic acid titer of DPAH11 in Example 1.

[0037] Figure 4 It is the change of OD600 and D - pantothenic acid titer of DPAH12 in Example 1.

[0038] Figure 5 It is the change of OD600 and D - pantothenic acid titer of DPAH13 in Example 1.

[0039] Figure 6 It is the change of OD600 and D - pantothenic acid titer of DPAH14 in Example 1.

[0040] Figure 7 It is the fermentation result diagram of DPAH14 in a 5 L bioreactor in Example 2. Detailed implementation manners

[0041] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, without conflict, the following embodiments and the features in the embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can all be obtained from commercial channels.

[0042] In the following embodiments, the final concentration of spectinomycin in the medium is 0.05 mg / L, and the final concentration of kanamycin in the medium is 0.05 mg / L.

[0043] The parental strain of the present invention E .coli W3110 is from the Coli Genetic Stock Center of Yale University. The preservation date is August 5, 1975, and the preservation number is CGSC#4474, which has been disclosed in patents US 2009 / 0298135A1 and US2010 / 0248311 A1.

[0044] The HPLC determination method for the content of D-pantothenic acid is as follows: Chromatographic conditions: C18 column (250 × 4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30°C; sample treatment: Dilute the sample with ultrapure water to keep the D-pantothenic acid content between 0.05 g / L and 0.40 g / L; mobile phase: acetonitrile / water / phosphoric acid: (50 / 949 / 1); data acquisition time: 25 min.

[0045] Example 1: Construction of a genetically engineered bacterium with high yield of D-pantothenic acid

[0046] Construction of DPAH9 and shake flask fermentation

[0047] Using ZJUTDPAH8 ( E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ), using the CRISPR-Cas9 mediated gene editing technology, replace the in-situ promoter of the pabC gene with the Trc promoter (the nucleotide sequence is shown in SEQ ID NO. 1), enhance the pABA pathway of folic acid synthesis through a strong promoter, promote the combination of the pABA and GTP pathways, strengthen folic acid synthesis, and provide a methyl carrier for one-carbon units, to obtain strain DPAH9 (DPAH8 derivative, Trc- pabC ).

[0048] (1) Construction of the pTarget-PAM- pabC plasmid: Using the pTarget plasmid (Addgene Plasmid #62226) as a template, perform PCR amplification with pT - pabC - PAM-F / R as primers. After verifying the PCR product by nucleic acid gel electrophoresis, use Dpn I digestion enzyme to incubate at 37 °C for 3 h. The PCR product of pTarget- pabC- PAM is amplified with the linearization primers pTarget-XF and pTarget-XR, and the pTarget- pabC linearized vector is recovered and purified by gel for subsequent ligation with Donor DNA.

[0049] (2) Construction of the pTD-donor- EcpabC plasmid: First, using the E. coli W3110 genome as a template, pabC-up -F / R as primers to amplify the upstream part (F1) of the donor DNA, pabC- down-F / R as primers to amplify the downstream part (F2) of the donor DNA. Then, using the E.coli W3110 genome as a template, use pTrc- EcpabC -18F / R as primers to amplify the pabC with the promoter pTrcGene fragment (F3), F1, F2, and F3 were obtained by gel extraction and purification of the PCR fragment; plasmid pTarget- pabC was incubated with Xba I and Pst I at 37 °C for 8 h, and the DNA fragment was recovered using a Clean up kit; according to the instructions of ClonExpress® (One step clone kit, Vazyme Biotech, Nanjing, China), the pTarget- pabC vector, fragments F1, F2, and F3 were ligated together, and pTD-donor -pabC plasmid was obtained by sequencing verification.

[0050] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into ZJUTDPAH8 ( E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ), and the monoclonal colony was transferred to an LB test tube containing 0.05 mg / L kanamycin and cultured overnight at 30 °C; then, it was inoculated into a 250 mL flask containing 50 mL of LB medium at an inoculation volume concentration of 1%, and 500 μl of 1 mol / L L-arabinose was added, and cultured at 150 rpm and 30 °C until OD 600 reached 0.4 - 0.6; the cells were collected by centrifugation at 4000 rpm and 4 °C for 10 min to prepare electrocompetent cells, and the detailed procedure is described in (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99 - 102).

[0051] (4) Use a pipette to aspirate an appropriate amount of pTD-donor -pabCThe plasmid (about 200 ng) was mixed with 100 μl of pre-prepared electrocompetent cells and transferred into a pre-cooled 2 mm electroporation cuvette. After ice-bathing for about 1 - 2 min, electroporation transformation was carried out using an electroporator (MicroPluser TM , BIO-RAD). Immediately after electroporation, 800 μl of LB medium was added and gently aspirated immediately, then transferred to a 2 mL Ep tube. After recovery at 30 °C for 3 - 4 h, it was spread on an LB solid plate containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin, and incubated upside down at 30 °C for 12 - 16 h. Using pabC -VF / R as primers for colony PCR verification. If a fragment of about 3000 bp can be successfully cloned, it proves to be a positive colony of DPAH9 (DPAH8 derivative, Trc- pabC ).

[0052] (5) Plasmid curing: Use an inoculation loop to pick a positive single colony and inoculate it into an LB liquid test tube containing 1 mM IPTG and 0.05 mg / L kanamycin, and culture it overnight at 30 °C. The next day, streak the bacterial solution on an LB solid plate containing 0.05 mg / L kanamycin and culture it at 30 °C for 24 h. When the bacteria grow to a certain size, pick some single colonies and streak them on an LB plate containing 0.05 mg / L spectinomycin. The single colonies that cannot grow on the LB plate containing 0.05 mg / L spectinomycin indicate that the pTarget- pabC plasmid has been successfully cured. Then pick the single colonies with successfully cured pTarget- pabC plasmid into an LB test tube and culture it overnight at 37 °C for curing the pCas plasmid. The next day, streak the bacterial solution on an LB plate and culture it at 37 °C for 12 h. Then pick some single colonies and streak them on an LB plate containing 0.05 mg / L kanamycin. The single colonies that cannot grow on the LB plate containing 0.05 mg / L kanamycin indicate that the pCas plasmid has been successfully cured. Finally, a plasmid-free strain was obtained. Using the starting strain H8 as a control, they were respectively inoculated into 10 mL of LB medium and cultured at 37 °C and 200 rpm as pre-cultures; after 8 - 12 h, 1 mL of the pre-culture was inoculated into a 500 mL shake flask containing 50 mL of MS medium at an inoculation amount of 2%, and then cultured in a constant temperature shaker at 30 °C and 180 rpm for 48 h for strain fermentation; after fermentation, when measuring the OD 600 value of 1 mL of the fermentation broth, use a pipette to aspirate 1 mL of the fermentation broth, centrifuge at 12000 rpm at room temperature for 3 min, dilute the fermentation supernatant by 5 times, and after removing impurities from the diluted sample using a water-based filter membrane, perform HPLC detection. The OD 600 and the content of D-pantothenic acid in the fermentation broth supernatant are as Figure 1 shown.

[0053] As can be seen from the figure, the in-situ promoter of the gene on the genome was replaced with the Trc promoter, and the D-pantothenic acid yield of DPAH9 was 7.13 g / L after 48 h of shake-flask fermentation. By enhancing the folic acid synthesis pABA pathway with a strong promoter, promoting the combination of the pABA and GTP pathways, and strengthening folic acid synthesis to provide a methyl carrier for one-carbon units, the D-pantothenic acid yield was successfully increased. pabC LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, with deionized water as the solvent and the pH value being natural.

[0054] MS medium: 20 g / L glucose, 16 g / L (NH4)2SO4, 2 g / L KH2PO4, 0.5 g / L MgSO4, 2 g / L yeast extract, 10 g / L CaCO3, 1 ml / L trace element solution, with deionized water as the solvent and the pH value being natural; 10 g / L calcium carbonate (sterilized separately); the trace element solution consists of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, 0.02 g / L NiCl2·7H2O, with deionized water as the solvent.

[0055] Construction and shake-flask fermentation

[0056] Using ZJUTDPA H19 as the starting strain, the CRISPR-Cas9-mediated gene editing technology was used to increase the copy number of the trc- gene (nucleotide sequence as shown in SEQ ID NO. 2) at the yeej pseudogene locus, enhancing the glycine cleavage system and promoting the synthesis of D-pantothenic acid. Strain DPAH10 (DPAH9 derivative, yeej::trc-gcvTHP) was obtained.

[0057] (1) Construction of the pTarget-X-yeej-trc- plasmid: Using the pTarget plasmid (Addgene Plasmid#62226) as a template and pT yeej-trc-X-F / R as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was digested with the I digestion enzyme at 37 °C for 3 h, and the pTarget-yeej-trc-linearized vector was recovered and purified by gel for subsequent ligation of the Donor DNA. gcvTHP

[0058] gcvTHP - plasmid: - gcvTHP - X-F / R as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was used Dpn gcvTHP I digestion enzyme to incubate and digest at 37 °C for 3 h, and the pTarget-yeej-trc-linearized vector was recovered and purified by gel for subsequent ligation of the Donor DNA. ​​​​

[0059] (2) Construction of pTD-donor-yeej-trc- gcvTHP plasmid: First, using the E. coli W3110 genome as a template, yeej-trc- gcvTHP -F / R as primers to amplify the donor DNA, and purify the PCR fragment by gel extraction to obtain F1; The plasmid pTarget-yeej-trc- gcvTHP is incubated at 37 °C for 8 h with Xba I and Pst I, and the DNA fragment is recovered using the Clean up kit; According to the instructions of ClonExpress® (One step clone kit, Vazyme Biotech, Nanjing, China), the linearized vector and fragment F1 are ligated together, and pTD-donor gcvTHP yeej-trc- - is obtained by sequencing verification. EcgcvTHP plasmid.

[0060] (3) Introduce the pCas plasmid (Addgene Plasmid #62225) into ZJUTDPAH9, transfer the monoclonal colony to an LB test tube containing 0.05 mg / L kanamycin, and culture overnight at 30 °C; Then inoculate at an inoculum volume concentration of 1% into a 250 mL shake flask containing 50 mL LB medium, and add 500 μl of 1 mol / L L-arabinose, and culture at 150 rpm and 30 °C until OD 600 reaches 0.4 - 0.6; Centrifuge at 4000 rpm and 4 °C for 10 min to collect the cells, and prepare electrocompetent cells. The detailed procedure is described in (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99 - 102).

[0061] (4) Use a pipette to aspirate an appropriate amount of pTD-donor - yeej-trc- EcgcvTHP (about 200 ng) plasmid and mix it with the pre-prepared 100 μl electrocompetent cells, and transfer them together into a pre-cooled 2 mm electroporation cuvette. After ice-bathing for about 1 - 2 min, use an electroporator (MicroPluser TM, BIO-RAD) for electroporation transformation. After the electroporation, 800 μl of LB medium was immediately added and gently aspirated, transferred to a 2 mL Eppendorf tube, and thawed at 30°C for 3-4 h before coating on a LB solid plate containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin. The plate was inverted and cultured at 30°C for 12-16 h. gcvTHP -VF / R as primers for colony PCR verification. If a fragment of about 3500 bp can be successfully cloned, it is proved to be DPAH10 (DPAH9 derivative, yeej-trc-- gcvTHP ) positive colonies.

[0062] (5) Plasmid elimination: The implementation method is the same as DPAH9 construction step (5) to obtain plasmid-free DPAH10 (DPAH9derivative, yeej-trc- gcvTHP ). The strain DPAH9 was used as the control group and cultured for 48 h for fermentation. After the fermentation, 1 mL of the fermentation liquid was taken to measure the OD 600 At the same time, 1 mL of fermentation liquid was drawn with a pipette and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 5 times and the diluted sample was treated with a water filter membrane to remove impurities. The OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 2 shown.

[0063] As can be seen from the figure, using CRISPR / Cas9 gene editing technology, yeej Increased pseudogene loci trc-gcvTHP The gene copy number, D-pantothenic acid production of DPAH10 after 48h of shake flask fermentation was 7.37 g / L. The glycine cleavage system was activated by a strong promoter to cleave intracellular glycine and produce 5,10-MTHF and NADH, eliminating glycine inhibition, strengthening cofactor supply, and successfully increasing the synthesis of D-pantothenic acid.

[0064] Construction and shake flask fermentation

[0065] Using DPAH10 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to downregulate the glycine cleavage system inhibitor nac ,Will nac The start codon was mutated to TTG (nucleotide sequence as shown in SEQ ID NO. 6), which relieved nac and purR The transcriptional inhibition of the glycine cleavage system by regulatory factors such as β-glycine can eliminate the accumulation of glycine and continuously and effectively provide one-carbon units for the synthesis of D-pantothenic acid to obtain DPAH11 (DPAH10 derivative, nacTTG )。

[0066] (1) Construction of pTarget-PAM- nac TTG plasmid: Using the pTarget F plasmid (Addgene Plasmid #62226) as a template, and pT- nac TTG - PAM-F / R as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was digested with Dpn I digestion enzyme at 37 °C for 3 h. The PCR product of pTarget-PAM- nac TTG was amplified with linearization primers pTarget-XF and pTarget-XR, and the pTarget-PAM- nac TTG linearized vector was recovered and purified by gel for subsequent ligation with DonorDNA.

[0067] (2) Construction of pTD-Donor- nac TTG plasmid: First, using E. coli the W3110 genome as a template, nac TTG -up-F / R as primers to amplify the upstream part (F1) of the donor DNA, nac TTG -down-F / R as primers to amplify the downstream part (F2) of the donor DNA. The PCR fragments F1 and F2 were obtained by gel recovery and purification; according to the ClonExpress® (One stepclone kit, Vazyme Biotech, Nanjing, China) instruction manual, the pTarget- nac TTG linearized vector, fragment F1, and F2 were ligated together, and pTD- nac TTG plasmid was obtained through sequencing verification.

[0068] (3) Introduce the pCas plasmid (Addgene Plasmid #62225) into the DPAH10 competent cells obtained in Example 2. The preparation method of DPAH10 electrotransformation competent cells is the same as that in step (3) of the DPAH9 construction.

[0069] (4) Construct DPAH11 positive colonies. The construction method is the same as that in step (4) of the DPAH9 construction.

[0070] (5) Plasmid elimination: The implementation method is the same as DPAH9 construction step (5) to obtain plasmid-free DPAH11 (DPAH10derivative, nac TTG ).

[0071] (6) The constructed DPAH11 production strain was used as a control group with the DPAH10 constructed in Example 2 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 3 shown.

[0072] As can be seen from the figure, we have nac The start codon was mutated to TTG, which reduced the transcriptional inhibition of the glycine cleavage system and increased the D-pantothenic acid production of DPAH11 to 7.44 g / L. nac The protein can reduce the transcriptional inhibition of the glycine cleavage system and regulate the ability of intracellular glycine synthesis, which is an effective strategy to continuously and effectively provide one-carbon units for the synthesis of D-pantothenic acid.

[0073] Construction and shake flask fermentation

[0074] Using DPAH11 as the starting strain, CRISPR / Cas9 gene editing technology was used to modify the genome of strain DPAH11. serA The original promoter was replaced with the Trc promoter and the ribosomal switch Apt2#82 (nucleotide sequence as shown in SEQ ID NO. 3) was inserted after the promoter to obtain the strain DPAH12 (DPAH11derivative, Trc-Apt2#82serA).

[0075] (1) Construction of pTarget-PAM- Trc-Apt2#82 serA Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template, pT-PAM-Trc-Apt2#82 serA -F / R is primer PCR amplification, and the PCR product is Dpn I'm at 37 o C incubation for 3 h; pTarget-PAM-Trc-Apt2#82 serA The PCR product was amplified with linearized primers pTarget-XF and pTarget-XR, and purified by gel recovery to pTarget-PAM-Trc-Apt2#82 serA Linearize the vector for subsequent ligation with Donor DNA.

[0076] (2) Construction of pTD-Donor-Trc-Apt2#82serA Plasmid: Using E. coli the W3110 genome as a template, Trc-Apt2#82 serA -up-F and Trc-Apt2#82 serA -up-R as primers to amplify the upstream part (F1) of the donor DNA. Trc-Apt2#82 serA -down-F and Trc-Apt2#82 serA -down-R as primers to amplify the downstream part (F2) of the donor DNA. Then, using E.coli the W3110 genome as a template, with pTrc-Apt2#82 serA -18F / R as primers to amplify the Apt2#82 gene fragment (F3) with the pTrc promoter. Gel extraction and purification of the PCR fragments were used to obtain F1, F2, and F3, and the DNA fragments were recovered using a Clean up kit; According to the ClonExpress serA (One step clone kit, Vazyme Biotech, Nanjing, China) instruction manual, the linearized vector pTarget-Trc-Apt2#82 ® was ligated with fragments F1 and F2, and pTD-Trc-Apt2#82 was obtained by sequencing verification serA plasmid. serA Plasmid.

[0077] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH11 competent cells obtained in Example 3. The preparation method of DPAH11 electrotransformation competent cells was the same as that in step (3) of the DPAH9 construction.

[0078] (4) DPAH12 positive colonies were constructed, and the construction method was the same as that in step (4) of the DPAH9 construction.

[0079] (5) Plasmid elimination: The implementation method was the same as that in step (5) of the DPAH9 construction to obtain plasmid-free DPAH12 (DPAH11 (derivative, Trc-Apt2#82serA)

[0080] (6) Using the constructed DPA12 production strain with the DPAH11 constructed in Example 3 as a control group, shake flask tests and detections were carried out. OD 600 and the content of D-pantothenic acid in the fermentation broth supernatant were as Figure 4 shown.

[0081] Serine catabolism can produce toxic intermediates, namely the highly reactive and toxic β-hydroxy pyruvate as the product of transamination reaction, and α-aminoacrylate formed as a by-product of serine deamination. Previously, when serine was additionally added to engineered bacteria to promote tetrahydrofolate synthesis, it was found that it had a certain toxic effect on the bacteria. In the DPA11 genome, Apt2#82 serA The in-situ promoter was replaced with the Trc promoter, and the D-pantothenic acid production of strain DPAH12 was successfully increased to 7.58 g / L. This strategy inhibited the serine synthesis pathway to a certain extent, reasonably regulated the serine synthesis rate, reduced its toxicity, and promoted D-pantothenic acid synthesis.

[0082] Construction and shake-flask fermentation

[0083] Using DPAH12 as the starting strain, the CRISPR / Cas9 gene editing technology was used to replace the glyA in-situ promoter with the Trc promoter in the DPAH12 genome and insert the riboswitch Apt2#82 (nucleotide sequence as shown in SEQ ID NO. 4) after the promoter to obtain the engineered bacterium DPAH13 (DPAH12 derivative, Trc-Apt2#82- glyA ).

[0084] (1) Construction of pTarget-PAM - Trc-Apt2#82- glyA Plasmid: Using the pTarget F plasmid (Addgene Plasmid #62226) as a template, and pT-PAM-Trc-Apt2#82- glyA -F / R as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was digested with Dpn I digestion enzyme at 37 °C for 3 h. The PCR product of pTarget-PAM-Trc-Apt2#82 glyA was amplified with the linearization primers pTarget-XF and pTarget-XR, and the pTarget-PAM-Trc-Apt2#82 glyA linearized vector was recovered and purified by gel for subsequent ligation with Donor DNA.

[0085] (2) Construction of pTD-Donor-Trc-Apt2#82 glyA Plasmid: Using the E. coli W3110 genome as a template, Trc-Apt2#82 glyA -up-F, Trc-Apt2#82 glyA-up-R is the upstream part (F1) of the donor DNA amplified by primers, Trc-Apt2#82 glyA -down-F and Trc-Apt2#82 glyA -down-R is the downstream part (F2) of the donor DNA amplified by primers. Then, using E.coli the W3110 genome as a template, pTrc-Apt2#82 glyA -18F / R are primers to amplify the Apt2#82 gene fragment (F3) with the pTrc promoter. The PCR fragments F1, F2, and F3 are obtained by gel extraction and purification of the PCR fragments, and the DNA fragments are recovered using a Clean up kit. According to the ClonExpress glyA (One step clone kit, Vazyme Biotech, Nanjing, China) instruction manual, the linearized vector pTarget-Trc-Apt2#82 ® is ligated with fragments F1 and F2, and pTD-Trc-Apt2#82 glyA is obtained through sequencing verification. glyA Plasmid.

[0086] (3) The pCas plasmid (Addgene Plasmid #62225) is introduced into the DPAH12 competent cells obtained in Example 4. The preparation method of the DPAH12 electrotransformation competent cells is the same as that in step (3) of the DPAH9 construction.

[0087] (4) The DPAH13 positive colonies are constructed, and the construction method is the same as that in step (4) of the DPAH9 construction.

[0088] (5) Plasmid curing: The implementation method is the same as that in step (5) of the DPAH9 construction to obtain plasmid-free DPAH13 (DPAH12 (derivative, Trc-Apt2#82 glyA ))

[0089] (6) Using the constructed DPA13 production strain and the DPAH12 constructed in Example 4 as a control group, shake flask tests and detections are carried out. The OD 600 and the content of D-pantothenic acid in the fermentation broth supernatant are as Figure 5 shown.

[0090] To further enhance the carbon flux towards the synthesis of D-pantothenic acid, the Apt2#82 glycine riboswitch on the genome is enhanced by promoter replacement for glyAReal-time controlled expression of genes was carried out to moderately enhance the key genes in the serine pathway, reasonably regulate the serine synthesis rate, and promote the improvement of the shake-flask production. As can be seen from the figure, the D-pantothenic acid production of strain DPAH13 increased to 7.84 g / L.

[0091] Construction and shake-flask fermentation

[0092] Using DPAH13 as the starting strain, the CRISPR / Cas9 gene editing technology was applied to increase the copy number of the trc gene (the nucleotide sequence is shown in SEQ ID NO. 5) at the pseudogene locus in the genome of strain DPAH13, and the engineered strain DPAH14 (DPAH13 derivative, tfad trc -panB trc) was obtained. tfad:: trc -panB) .

[0093] (1) Construction of pTarget - tfad : : trc - panB- X plasmid: Using the pTarget F plasmid (Addgene Plasmid#62226) as the template, PCR amplification was carried out with pT- tfad :: panB -XF / R as primers. After the PCR product was verified by nucleic acid gel electrophoresis, it was digested with Dpn I digestion enzyme at 37 °C for 3 h, and the pTarget-PAM- tfad :: panB linearized vector was recovered and purified by gel extraction for subsequent ligation with Donor DNA.

[0094] (2) Construction of pTD-Donor-trc - tfad :: panB plasmid: Using the E. coli W3110 genome as the template, tfad :: panB -F, tfad :: panB -R as primers to amplify the donor DNA (F1), and F1 was obtained by recovering and purifying the PCR fragment through gel extraction, and the DNA fragment was recovered using the Clean up kit; according to the ClonExpress ® (One step clone kit, VazymeBiotech, Nanjing, China) instruction manual, the pTarget- tfad :: panB linearized vector and fragment F1 were ligated together, and pTD-trc- tfad :: panB plasmid was obtained through sequencing verification.

[0095] (3) Introduce the pCas plasmid (Addgene Plasmid #62225) into the DPAH13 competent cells obtained in Example 5. The method for preparing the electrocompetent DPAH13 cells is the same as that in step (3) of the DPAH9 construction.

[0096] (4) Obtain the DPAH14 positive colonies. The construction method is the same as that in step (4) of the DPAH9 construction.

[0097] (5) Plasmid curing: The implementation method is the same as that in step (5) of the DPAH9 construction to obtain plasmid-free DPAH14 (DPAH13 (derivative, tfad :: panB ))

[0098] (6) Use the constructed DPA14 production strain with the DPAH13 constructed in Example 5 as the control group for shake flask testing and detection. The OD 600 and the content of D-pantothenic acid in the supernatant of the fermentation broth are as Figure 6 shown.

[0099] By using the pseudogene locus in the DPAH13 genome to increase the copy number of the key gene tfad in the D-pantothenic acid synthesis pathway, the titer of D-pantothenic acid in the DPAH14 shake flask is increased to 7.96 g / L. By moderately strengthening the key genes in the pantolactone pathway, the expression efficiency of the genetically engineered bacteria is improved, better responding to methyl supply and promoting the synthesis of D-pantothenic acid. panB

[0100] Example 2: Application of the D-pantothenic acid production strain DPAH14 in the microbial 5 L fermentation for the production of D-pantothenic acid

[0101] The fermentation is carried out in a 5 L fermenter (Shanghai Baoxing, BIOTECH-5BG) and includes the following steps:

[0102] (1) Seed culture: Inoculate DPAH8 on a plate into 10 mL of LB medium and culture it overnight on a shaker at 37 °C and 180 rpm. Then inoculate it into two bottles containing 100 mL of LB medium respectively with an inoculation amount of 1% by volume as the secondary seed liquid and culture for 7 - 12 h.

[0103] (2) Inoculation and fermentation: The volume of the fermentation medium in a 5 L fermenter was 2 L, and it was sterilized at 115 °C for 30 min. The temperature was 25 - 30 °C, the initial aeration rate was 3 - 6 L / min, and the initial stirring speed was 300 - 450 rpm. Ammonia water was used to adjust the pH. A total of 200 mL of two bottles of secondary seed liquid was transferred to a 5 L fermenter containing 2 L of fermentation medium without resistance, and IPTG with a final concentration of 0.2 mM, VB1 with a final concentration of 5 mg / L, VB 12 , and 5 - 10 mL of isoleucine at a concentration of 10 - 40 g / L were added to start the fermentation. During the fermentation process, the dissolved oxygen was maintained at 10% - 30% using dissolved oxygen in series with the rotation speed, ammonia water was used as a neutralizing agent to maintain the pH at 6.7 - 6.9, and the glucose concentration in the tank was controlled below 5 g / L by pH-linked feeding. It was cultured at 28 - 37 °C for 3 - 4 days to obtain the fermentation broth. The fermentation broth refers to all substances in the fermenter.

[0104] (3) After diluting the fermentation supernatant 80 - fold, the diluted sample was treated to remove impurities using a water-based filter membrane, and then HPLC detection was performed according to Example 1. OD 600 and the content of D-pantothenic acid in the fermentation broth supernatant were as Figure 7 shown.

[0105] By strengthening the genes related to the THF synthesis pathway, providing a methyl carrier for one-carbon units, relieving the transcriptional inhibition of the glycine cleavage system, eliminating glycine accumulation, and strengthening cofactor supply; further moderately strengthening the key genes of the serine pathway, reasonably regulating the serine synthesis rate to enhance the carbon flux towards the synthesis of D-pantothenic acid, and finally strengthening the key genes of the D-pantothenic acid synthesis pathway to improve the expression efficiency of the genetically engineered bacteria, the yield of D-pantothenic acid was significantly increased. Finally, an engineered strain DPAH14 without plasmid and without antibiotic addition for high-yield D-pantothenic acid was obtained. As can be seen from the figure, the D-pantothenic acid yield of the engineered strain DPAH14 increased to 147.3 g / L after 96 hours of fermentation in a 5 L fermenter, which was 29.9% higher than that of the starting strain, greatly improving the synthesis of D-pantothenic acid.

[0106] Among them, the composition of the fermentation medium was as follows: 20 g / L glucose, 16 g / L ammonium sulfate, 2 g / L anhydrous betaine, 2 g / L yeast powder, 2 g / L potassium dihydrogen phosphate, 0.5 g / L anhydrous magnesium sulfate, 1.5 g / L β-alanine, 1 ml / L trace element solution, and the solvent was deionized water with a natural pH value. The composition of the trace element solution was: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent was deionized water.

[0107] Among them, the composition of the feeding medium is as follows: glucose 500 g / L, ammonium sulfate 10 g / L, anhydrous betaine 4 g / L, yeast powder 2 g / L, potassium dihydrogen phosphate 14 g / L, anhydrous magnesium sulfate 8 g / L, β-alanine 60 g / L, 2 ml / L of trace element solution, the solvent is deionized water, and the pH value is natural.

[0108] The primer sequence information used in Example 1 is shown in Table 2.

[0109] Table 2: Primer sequences

[0110] Primer Name Sequence (5’-3’) pabC-pam-F TAATACTAGTTAAGAAAAAAGGCCCGCAAGGTTTTAGAGCTAGAAATAGC pabC-pam-R GCTCTAAAACCTTGCGGGCCTTTTTTCTTAACTAGTATTATACCTAGGAC pabC-UP-F ATTCTCTAGAGTCGACCTGCAAAAAACGCGGTGCGAAAATTTAC pabC -UP-R CACACATTATACGAGCCGGATGATTAATTGTCAATAGATCTTTTTAAAGATCAAAGAAC pabC-DOWN-F TCGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGTTCTTAATTAACGGTCATA pabC-DOWN-R GGGTAATAGATCTAAGCTTCCTGTCAAGGACCAGCGCCTC pabC-VF GCACGTGCATTATCTACCCGC pabC-VR CTGCCTGATCCAGTCGCGGCG yeej-trc-gcvTHP -XF CTCTAATTTTCCGTTATAATTTCTTAAAGAGTGTT yeej-trc-gcvTHP -X-F / R CATGGTCTGTTTCCTGTGTGAAATTCCACACATTATACGAGCCG yeej-trc-gcvTHP-F GAATTTCACACAGGAAACAGACCATGGCACAACAGACTCCTTTG yeej-trc-gcvTHP- R CTTTAAGAAATTATAACGGAAAATTACTGGTATTCGCTAATCGGTAC yeej-VF CCCCTCTTGCAACTCACACCC yeej-VR CGCGATTCTGGCGGTGCCGC <![CDATA[PAM-nac TTG -F]]> TAATACTAGTAGATATTGGTAGCCTGACCCGTTTTAGAGCTAGAAATAGC <![CDATA[PAM-nac TTG -R]]> GCTCTAAAACGGGTCAGGCTACCAATATCTACTAGTATTATACCTAGGAC <![CDATA[nac TTG -UP-F]]> CTTTTTTTGAATTCTCTAGAAACGGGCAAGAAGTTGATGTAAAT <![CDATA[nac TTG -UP-R]]> CTGAAGTTCAAGTTGCCTCCGGTTTTTAAGAAT <![CDATA[nac TTG -DOWN-F]]> TACTTTGTAAAAATTGTCGACATCGGATCCCTGACGCAGGCTGCTGAAGTAT <![CDATA[nac TTG -DOWN-R]]> ATAGATCTAAGCTTCTGCAGTTAGCTCACCAATTGCCACTG <![CDATA[nac TTG -VF]]> CGCAATCGTGCAGAATATGAG <![CDATA[nac TTG -VR]]> CCGCATCTTATTCCATCCCG PAM- Trc-Apt2#82serA-F TAATACTAGTCACACAACATTTCAAAAGACGTTTTAGAGCTAGAAATAGC PAM- Trc-Apt2#82serA-R GCTCTAAAACGTCTTTTGAAATGTTGTGTGACTAGTATTATACCTAGGAC Trc-Apt2#82serA-UP-F ATTCTCTAGAGTCGACCTGCCGTTGATGGCGCAGATGAAATC Trc-Apt2#82serA-UP-R CGAGCCGGATGATTAATTGTCAACTGGTTTAGAGGATTTATTTAG Trc-Apt2#82serA-DOWN-F CTAAATAAATCCTCTAAACCAGTTGACAATTAATCATCCGGCTCG Trc-Apt2#82serA-DOWN-R GGGTAATAGATCTAAGCTTCCCCAATTGCGTACCAATATGACC Apt2#82serA-VF GCCTCGGCATTCACGTTTTTG Apt2#82serA-VF GCAGGTCAGAAAGATGCTGTAC PAM-Trc-Apt2#82-glyA-F TAATACTAGTACTGTTCGCCGTTGTCCAACGTTTTAGAGCTAGAAATAGC PAM-Trc-Apt2#82-glyA-R GCTCTAAAACGTTGGACAACGGCGAACAGTACTAGTATTATACCTAGGAC Trc-Apt2#82glyA-UP-F ATTCTCTAGAGTCGACCTGCTTTCAATATTACTGGCGTAGGCG Trc-Apt2#82glyA-UP-R CCACACATTATACGAGCCGGATGATTAATTGTCAACAGGCTACGCAAGGCTTTGG Trc-Apt2#82glyA-DOWN-F CCGGCTCGTATAATGTGTGGAACCTTGGAGAGACTCTTGATGAG Trc-Apt2#82glyA-DOWN-R GGGTAATAGATCTAAGCTTCGGCTTGTGTTCTTTGGCTTG Trc-Apt2#82glyA-VF GAACATTTCGTCCAGCGTTGC Trc-Apt2#82glyA-VR GTAAGCACCGATGCTGTCAGC tfad::trc- panB-XF CGGCTTGTACGGGGGAAAATAATCATTGGGATTATGCCGCAG tfad::trc- panB-XR GAAAATCCAGTTTTGTTTTCATGGTCTGTTTCCTGTGTGAAA tfad:: panB -F CGGCTTGTACGGGGGAAAATAATTGACAATTAATCATCCGGCTCG tfad:: panB -R TTATTTTCCCCCGTACAAGC tfad:: panB -VF CCCGTTCTGCGAGGCGGTGG tfad:: panB -VR CGGCTTGCATGGGGATGTCC

[0111] The above-described embodiments are merely descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium producing D-pantothenic acid, characterized in that, Including: using CRISPR-Cas9 mediated gene editing technology in the chassis bacterium genome to enhance pabC gene expression; increasing gcvTHP the gene copy number and enhancing expression; weakening nac gene expression; enhancing serA gene, glyA the expression of gene and dynamically regulating serA gene, glyA the expression of gene; increasing panB the gene copy number and enhancing expression to obtain a genetically engineered bacterium with high-yield D-pantothenic acid; Among them, the chassis bacterium is: E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serA / Apt2#82 glyA- P panB -panB / gapC ::Trc- alsS* 。 2. The method according to claim 1, wherein The enhancement pabC The method for gene expression includes: replacing pabC the in-situ promoter of the gene with the Trc promoter.

3. The method according to claim 1, characterized in that, The said increase gcvTHP in the gene copy number and the method for enhancing the expression include: yeej increasing the gene copy number regulated by the Trc promoter at the gcvTHP pseudogene locus.

4. The method according to claim 1, wherein The method of weakening nac gene expression includes nac mutating the start codon of the gene to TTG.

5. The method according to claim 1, wherein The enhancement serA gene, glyA the expression of the gene and dynamically regulate using the Apt2#82 riboswitch serA gene, glyA The method for the expression of the gene includes: respectively replacing the in-situ promoters of serA gene and glyA gene with the Trc promoter, and inserting the Apt2#82 riboswitch behind the Trc promoter respectively.

6. The method according to claim 1, characterized in that, The said increase panB in the gene copy number and the method for enhancing the expression include: tfad increasing the gene copy number regulated by the PpanB promoter at the panB pseudogene locus.

7. The genetically engineered bacterium producing D-pantothenic acid constructed by the method according to any one of claims 1 to 6.

8. The genetically engineered bacterium for producing D-pantothenic acid according to claim 7, characterized in that, The genetically engineered bacterium with high D-pantothenic acid yield is: E.coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* / Trc- pabC / yeej :: trc-gcvTHP / nac TTG / Trc-Apt2#82- serA / Trc-Apt2#82 glyA / tfad ::Trc- panB 。 9. Use of the genetically engineered bacterium producing D-pantothenic acid according to claim 7 in the microbial fermentation for preparing D-pantothenic acid.

Images