Microorganism having increased activity of glycine cleavage system, and use thereof
By enhancing the glycine cleavage system and weakening L-serine deaminase activity in microorganisms, the production of pantothenic acid, pantoic acid, and tryptophan is optimized, addressing the inefficiencies in existing biotechnological production methods.
Patent Information
- Application Number
- PCT/KR2025/007005
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-24
- Filing Date
- 2025-05-23
- Publication Date
- 2025-11-27
AI Technical Summary
There is a need for microorganisms with enhanced glycine cleavage system activity and weakened L-serine deaminase activity to efficiently produce pantothenic acid, pantoic acid, and tryptophan through biotechnological methods.
The introduction of an exogenous glycine cleavage system, comprising GcvP, GcvT, and GcvH polypeptides or polynucleotides from Mycobacterium smegmatis, and the weakening of L-serine deaminase activity in a suitable microorganism, enhances the production of pantothenic acid, pantoic acid, and tryptophan.
This approach increases the production efficiency of pantothenic acid, pantoic acid, and tryptophan by optimizing the metabolic pathways in the microorganism, thereby improving yield and productivity.
Abstract
Description
Microorganisms with enhanced activity of glycine cleavage system and uses thereof
[0001] Provided are a microorganism having an enhanced activity of a glycine cleavage system and / or a weakened activity of an L-serine deaminase, a production composition comprising the microorganism and at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, and a production method comprising a step of culturing the microorganism and at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.
[0002] Cross-citation with related application(s)
[0003] This disclosure claims the benefit of priority to Republic of Korea Patent Application No. 10-2024-0067861, filed May 24, 2024, the entire contents of which are incorporated herein by reference.
[0004]
[0005] Pantothenic acid, also known as vitamin B5, is a member of the vitamin B complex and is a commercially important substance with diverse applications in cosmetics, medicine, human nutrition, and animal nutrition. Pantothenic acid is composed of pantoic acid and beta-alanine linked by an amide bond.
[0006] Furthermore, tryptophan, an essential amino acid, has been widely used as a feed additive, a raw material for pharmaceuticals such as fluids, and a health food ingredient. Currently, direct fermentation using microorganisms is primarily used for tryptophan production.
[0007] One or more selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan can be produced chemically synthetically or biotechnologically by fermenting a suitable microorganism in a suitable medium. The advantage of biotechnological production methods using microorganisms is that one or more selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan in the desired stereoisomeric D-form is formed.
[0008] Accordingly, there is a need for the development of a microorganism having an advantageous effect in bioengineeringly producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, and a technology for producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan with high efficiency using the same.
[0009]
[0010] [Prior Art Literature]
[0011] [Patent Document]
[0012] (Patent Document 1) U.S. Patent No. 7718205
[0013]
[0014] One example of the present disclosure provides a microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of the glycine cleavage system is enhanced.
[0015] Another example of the present disclosure provides a microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of L-serine deaminase is weakened.
[0016] Another example of the present disclosure provides a composition for production of at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, comprising the microorganism.
[0017] Another example of the present disclosure provides a use of the microorganism for producing one or more selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.
[0018] Another example of the present disclosure provides the use of the microorganism for the preparation of a composition for producing one or more selected from the group consisting of pantothenic acid, pantoic acid and tryptophan.
[0019] Another example of the present disclosure provides a method for producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, comprising the step of culturing the microorganism in a medium.
[0020]
[0021] One aspect provides a microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of the glycine cleavage system is enhanced.
[0022] In one example, the microorganism may be a microorganism that produces pantothenic acid or pantoic acid.
[0023] In one example, the microorganism may be a microorganism that produces tryptophan.
[0024] The above glycine cleavage system may comprise a complex of glycine cleavage enzymes, or one or more glycine cleavage enzymes.
[0025] The above glycine decomposition enzyme may be any one enzyme selected from the group consisting of glycine dehydrogenase, aminomethyltransferase, glycine decarboxylase, and dihydrolipoyl dehydrogenase.
[0026] The above glycine cleavage system may comprise one or more subunits selected from the group consisting of GcvP, GcvT, and GcvH polypeptides. The above glycine cleavage system may catalyze a process of converting glycine into carbon dioxide and ammonia, in which THF (tetrahydrofolate) may be converted into mTHF (5,10-methylenetetrahydrofolate), and NAD+ (oxidized nicotine amide dinucleotide) may be converted into NADH (reduced nicotine amide dinucleotide) and hydrogen ions (H+).
[0027] The microorganism that produces at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, with enhanced activity of the above glycine cleavage system, may be a microorganism into which an exogenous glycine cleavage system or a polynucleotide encoding the same has been introduced.
[0028] In the present specification, introduction of a foreign protein and / or polynucleotide (gene) may mean introduction of a protein and / or polynucleotide derived from a cell belonging to a different genus, a cell belonging to a different species, or a different cell of the same species as the microorganism (host cell) into which the protein and / or polynucleotide is introduced.
[0029] The above foreign glycine cleavage system may comprise at least one subunit selected from the group consisting of GcvP, GcvT and GcvH polypeptides, each of which may be derived from a different foreign microorganism, or may be derived from the same foreign microorganism.
[0030] The above-mentioned foreign glycine cleavage system and / or polynucleotide encoding the same may be derived from a microorganism of the genus Mycobacterium, but is not limited thereto.
[0031] The above foreign glycine cleavage system and / or the polynucleotide encoding it is selected from the group consisting of Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium africanum, Mycobacterium asiaticum, Mycobacterium bovis, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium gordonae, Mycobacterium haemophilum, Mycobacterium intracellulare, Mycobacterium kansasii, and Mycobacterium lentiflavum. It may be derived from one or more Mycobacterium genus microorganisms selected from the group consisting of, but not limited to, Mycobacterium lentiflavum, Mycobacterium malmoense, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium triplex, Mycobacterium uvium, and Mycobacterium xenopi.In one example, the exogenous glycine cleavage system and / or the gene encoding it may be derived from Mycobacterium smegmatis.
[0032]
[0033] The above glycine cleavage system may comprise one or more subunits selected from the group consisting of a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide. In one example, the glycine cleavage system may comprise a GcvP polypeptide, a GcvT polypeptide, and a GcvH polypeptide.
[0034] The above GcvP polypeptide may refer to a protein having glycine dehydrogenase activity, a glycine-cleavage system P-protein, or a glycine dehydrogenase activity. The above GcvP polypeptide may be derived from Mycobacterium smegmatis. The sequence of the GcvP polypeptide derived from Mycobacterium smegmatis can be obtained from NCBI, a known database (NCBI Reference Sequence: WP_011729226.1).
[0035] In one example, the GcvP polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 1.
[0036] In one example, the GcvP polypeptide has an amino acid sequence of SEQ ID NO: 1 that is at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, It may comprise or consist of an amino acid sequence having a homology or identity of 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more. In addition, if it is a protein having such homology or identity and exhibiting glycine dehydrogenase activity, a variant of the GcvP polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvP polypeptide. For example, it may have a sequence addition or deletion that does not alter glycine dehydrogenase activity, a naturally occurring mutation, a silent mutation, or a conservative substitution at the N-terminus, C-terminus, and / or within the amino acid sequence.
[0037] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.
[0038] The above GcvT polypeptide may refer to an aminomethyltransferase, or a protein having aminomethyltransferase activity. The above GcvT polypeptide may be derived from Mycobacterium smegmatis. The sequence of the GcvT polypeptide derived from Mycobacterium smegmatis can be obtained from NCBI, a known database (NCBI Reference Sequence: WP_011729697.1).
[0039] In one example, the GcvT polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 2. In one example, the GcvT polypeptide has at least 60%, 65%, 70%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, or more of the amino acid sequence of SEQ ID NO: 2. The GcvT polypeptide may comprise or consist of an amino acid sequence having a homology or identity of at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9%. In addition, a variant of the GcvT polypeptide having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvT polypeptide, as long as it is a protein having such homology or identity and exhibiting aminomethyltransferase activity.
[0040] The above GcvH polypeptide may refer to Glycine cleavage system protein H. The GcvH polypeptide may have an activity of transferring a methylamine group of glycine, an activity of transferring a methylamine group of glycine from a GcvP polypeptide to a GcvT polypeptide. The GcvH polypeptide may be derived from Mycobacterium smegmatis. The sequence of the GcvH polypeptide derived from Mycobacterium smegmatis can be obtained from NCBI, a known database (NCBI Reference Sequence: WP_003895104.1).
[0041] In one example, the GcvH polypeptide derived from Mycobacterium smegmatis can have, comprise, consist of, or consist essentially of the amino acid sequence of SEQ ID NO: 3.
[0042] In one example, the GcvH polypeptide has an amino acid sequence of SEQ ID NO: 3 that is at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, It may comprise or consist of an amino acid sequence having a homology or identity of 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more. In addition, as long as it is a protein having such homology or identity and exhibiting methylamination transfer activity, a variant of the GcvH polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added may also be included in the GcvH polypeptide.
[0043]
[0044] In the present specification, the glycine cleavage system gene may refer to a polynucleotide encoding the glycine cleavage system, and may include one or more polynucleotides selected from the group consisting of a polynucleotide encoding a GcvP polypeptide (hereinafter, may be used interchangeably with the "gcpP gene"), a polynucleotide encoding a GcvT polypeptide (hereinafter, may be used interchangeably with the "gcpT gene"), and a polynucleotide encoding a GcvH polypeptide (hereinafter, may be used interchangeably with the "gcpH gene").
[0045] The above glycine cleavage system may be encoded by a gene comprising at least one selected from the group consisting of glycine cleavage genes, i.e., a gcvP gene, a gcvT gene, and a gcvH gene.
[0046] In one example, the glycine cleavage system gene may include a polynucleotide encoding a GcvP polypeptide, a polynucleotide encoding a GcvT polypeptide, and a polynucleotide encoding a GcvH polypeptide.
[0047] The above glycine cleavage system gene may include one or more polynucleotides selected from the group consisting of a polynucleotide encoding a GcvP polypeptide, a polynucleotide encoding a GcvT polypeptide, and a polynucleotide encoding a GcvH polypeptide, regardless of the order. In one example, the glycine cleavage system gene may include a polynucleotide encoding a GcvP polypeptide, a polynucleotide encoding a GcvT polypeptide, and a polynucleotide encoding a GcvH polypeptide in that order from the 5' end to the 3' end.
[0048] The polynucleotide encoding the above GcvP polypeptide may be derived from Mycobacterium smegmatis, but is not limited thereto, and may be prepared based on the amino acid sequence of the GcvP polypeptide with reference to a known codon table.
[0049] In one example, the polynucleotide encoding the GcvP polypeptide derived from Mycobacterium smegmatis may have, comprise, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 4 or SEQ ID NO: 28, and various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell to which the GcvP polypeptide is to be expressed.
[0050] In one example, the polynucleotide encoding the GcvP polypeptide has a nucleic acid sequence of SEQ ID NO: 4 or SEQ ID NO: 28 that is at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, It may comprise or consist of a nucleic acid sequence having a homology or identity of 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more.
[0051] The polynucleotide encoding the above GcvT polypeptide may be derived from, but is not limited to, Mycobacterium smegmatis, and may be prepared by referring to a known codon table based on the amino acid sequence of the GcvT polypeptide.
[0052] In one example, the polynucleotide encoding the GcvT polypeptide derived from Mycobacterium smegmatis may have, comprise, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 5 or SEQ ID NO: 29, and various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell to which the GcvT polypeptide is to be expressed.
[0053] In one example, the polynucleotide encoding the GcvT polypeptide has at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, It may comprise or consist of a nucleic acid sequence having a homology or identity of 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more.
[0054] The polynucleotide encoding the above GcvH polypeptide may be derived from Mycobacterium smegmatis, but is not limited thereto, and may be prepared based on the amino acid sequence of the GcvH polypeptide with reference to a known codon table.
[0055] In one example, the polynucleotide encoding the GcvH polypeptide derived from Mycobacterium smegmatis may have, include, consist of, or consist essentially of the nucleic acid sequence of SEQ ID NO: 6 or SEQ ID NO: 30, and various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide, taking into account codons preferred in a cell in which the GcvH polypeptide is to be expressed.
[0056] In one example, the polynucleotide encoding the GcvH polypeptide has at least 60%, at least 65%, at least 70%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 90.5%, at least 91%, at least 91.5%, at least 92%, at least 92.5%, at least 93%, at least 93.5%, at least 94%, at least 94.5%, at least 95%, at least 95.5%, at least 96%, at least 96.5%, at least 97%, It may comprise or consist of a nucleic acid sequence having a homology or identity of 97.5% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, or 99.9% or more.
[0057] In the present disclosure, the phrase “a polynucleotide or polypeptide has, includes, consists of, or consists essentially of a specific nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence (base sequence) or amino acid sequence, and may be interpreted as including (or not excluding) a “substantially equivalent sequence” in which a mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence (base sequence) or amino acid sequence to the extent that the original function and / or desired function of the polynucleotide or polypeptide is maintained. In one example, a polynucleotide or polypeptide “has, includes, consists of, or consists essentially of a particular nucleic acid sequence (base sequence) or amino acid sequence” may mean that the polynucleotide or polypeptide (i) essentially includes the particular nucleic acid sequence (base sequence) or amino acid sequence, or (ii) consists of or essentially includes a nucleic acid sequence or amino acid sequence that has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% homology or identity with the particular nucleic acid sequence (base sequence) or amino acid sequence, and maintains its original function and / or desired function. In one example, the desired function may mean a function of increasing (improving) or imparting pantothenic acid and / or pantoic acid production ability of a microorganism.
[0058] In this disclosure, 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.
[0059] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.
[0060] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.
[0061] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0062] Expression of the above glycine cleavage system in a microorganism can be performed by culturing a recombinant cell (e.g., a microorganism) containing the above glycine cleavage system gene or a recombinant vector containing the same.
[0063] The introduction of the above glycine cleavage system gene or recombinant vector into a microorganism can be performed by a person skilled in the art by appropriately selecting a known transformation method. As used herein, the term "transformation" refers to changing the genetic characteristics of a host cell by introducing a target polynucleotide or a vector containing the same into the host cell. The transformed polynucleotide may be inserted and located within the chromosome of the host cell or may be located extrachromosomally. As long as the polynucleotide can be introduced into the host cell and expressed, there is no limitation on the form in which it is introduced. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include expression control elements such as a promoter, a transcription termination signal, a ribosome binding site, and / or a translation termination signal that are operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of autonomous replication. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell. The term "operably linked" as used herein may mean that the polynucleotide is functionally linked to an expression control element (e.g., a promoter) so that transcriptional regulation (e.g., transcription initiation) of the polynucleotide can be performed. Operable linkage can be performed using genetic recombination techniques known in the art.
[0064] The method of transforming the above polynucleotide into a host cell can be performed by any method of introducing a nucleic acid into a cell (microorganism), and can be performed by appropriately selecting a transformation technique known in the art depending on the host cell. Examples of the known transformation methods include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation, DEAE-dextran, cationic liposome, lipofection, and lithium acetate-DMSO.
[0065] As used herein, the term "vector" refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, the vector may comprise a base sequence of a polynucleotide operably linked to a suitable regulatory sequence so as to enable expression of the target polynucleotide in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence for regulating the termination of transcription and / or translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the genome of the host cell, or may be replicated or function by integrating into the genome itself.
[0066]
[0067] The vector usable in this specification is not particularly limited as long as it is replicable in a host cell, and may be selected from all commonly used vectors. Examples of commonly used vectors include plasmids, cosmids, viruses, bacteriophages, etc. in a natural or recombinant state. For example, as the vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc. can be used as a phage vector or a cosmid vector, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series, etc. can be used as a plasmid vector. Specifically, examples include, but are not limited to, pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors.
[0068] The above vector may further include a selection marker to determine whether the vector has been transformed into a host cell or further, whether the vector has been integrated into the host cell chromosome. The selection marker is used to select cells transformed with the vector or to determine whether the target polynucleotide has been integrated into the chromosome. Markers that confer selectable phenotypes such as drug resistance, nutritional requirements, cytotoxic agent resistance, or expression of surface proteins may be used. In an environment treated with a selective agent, only cells expressing the selection marker will survive or exhibit other phenotypic characteristics, thereby enabling selection of transformed cells.
[0069] The microorganism with enhanced activity of the above glycine cleavage system may be a microorganism with additionally weakened activity of L-serine deaminase. The weakening of the activity of L-serine deaminase is as described below.
[0070]
[0071] Another aspect of the present disclosure provides a microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of L-serine deaminase is weakened.
[0072] The weakened L-serine deaminase protein activity can be measured by, but is not limited to, measuring the activity or amount of the L-serine deaminase protein, measuring the amount of a polynucleotide encoding the L-serine deaminase protein, or measuring the productivity (or yield) of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan. For example, when the productivity of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan of the microorganism of the present disclosure is increased compared to the productivity of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan of a natural wild-type microorganism or an unmodified microorganism, the weakened L-serine deaminase protein activity can be measured by, but is not limited to, measuring the increased productivity of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan.
[0073] In the present disclosure, the term L-serine deaminase refers to an enzyme that catalyzes the process of removing ammonia from L-serine and converting it into pyruvate. Specifically, the L-serine deaminase of the present disclosure may be used interchangeably with L-serine hydrolyase. The L-serine deaminase is known in the art, and may be, but is not limited to, the SdaA protein encoded by the sdaA gene. The amino acid and polynucleotide sequences of the L-serine deaminase can be obtained from a known database (e.g., NCBI's GenBank, WP_011014507.1), but are not limited thereto.
[0074] For example, the L-serine deaminase may include the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has L-serine deaminase activity. Specifically, even if some sequences are deleted, modified, or substituted in the amino acid sequence of SEQ ID NO: 25, or another sequence is added to the amino acid sequence of SEQ ID NO: 25, as long as it exhibits an effect corresponding to the L-serine deaminase, it may be included in the L-serine deaminase. In addition, at least 60%, 65%, 70%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, Any protein that has, comprises, consists of, or essentially consists of an amino acid sequence having a homology or identity of 99% or more, 99.5% or more, or 99.9% or more and exhibits an effect corresponding to the L-serine deaminase may be included in the L-serine deaminase. Specifically, the L-serine deaminase may be an L-serine deaminase consisting of an amino acid sequence of SEQ ID NO: 25 present in a microorganism of the genus Corynebacterium or Corynebacterium glutamicum, but is not limited thereto.
[0075] In addition, the sequence of the polynucleotide encoding the L-serine deaminase is a nucleic acid sequence of SEQ ID NO: 26 or SEQ ID NO: 27, or a homology or identity thereof of 60% or more, 65% or more, 70% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 90.5% or more, 91% or more, 91.5% or more, 92% or more, 92.5% or more, 93% or more, 93.5% or more, 94% or more, 94.5% or more, 95% or more, 95.5% or more, 96% or more, 96.5% or more, It may have, comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, or at least 99.9% nucleic acid sequence, but is not limited thereto.
[0076]
[0077] The microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of the above L-serine deaminase is weakened, may include a microorganism whose L-serine deaminase activity is weakened compared to the activity of the parent microorganism by any one of various known methods.
[0078] For example, a microorganism with weakened L-serine deaminase activity of the present disclosure may be a microorganism in which an expression regulatory region sequence is modified to reduce expression of the sdaA gene, a part or all of the sdaA gene sequence is deleted, an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the sdaA gene is introduced, a sequence complementary to the Shine-Dalgarno sequence is added in front of the Shine-Dalgarno sequence of the sdaA gene, or a promoter that is transcribed in the opposite direction is added to the 3' end of the ORF (open reading frame) of the sdaA gene sequence. Specifically, the microorganism may be a microorganism in which all or part of the nucleic acid sequence of SEQ ID NO: 26 or SEQ ID NO: 27 is substituted or deleted, so that the L-serine deaminase protein is inactivated or its activity is weakened, but is not limited thereto.
[0079]
[0080] In the present disclosure, the term "microorganism (or strain)" may include both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification. The microorganism may be a microorganism whose specific mechanism has been strengthened or weakened due to reasons such as the insertion of an external gene or the strengthening or weakening of the activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product (e.g., at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan).
[0081] In the present disclosure, the term “enhancement” of polypeptide (protein) activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.
[0082] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or increasing the concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the degree of activity of the polypeptide, the expression level, or the amount of a product resulting from the activity of the polypeptide.
[0083] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0084] Specifically, the activity enhancement of the polypeptide (protein) of the present disclosure is
[0085] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;
[0086] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;
[0087] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0088] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;
[0089] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);
[0090] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;
[0091] 7) Codon optimization of polynucleotides encoding polypeptides;
[0092] 8) Analyze the tertiary structure of the polypeptide to select the exposed portion and modify or chemically modify it;
[0093] 9) Control of cellular localization of proteins (polypeptides); or
[0094] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0095] More specifically,
[0096] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.
[0097] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.
[0098] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.
[0099] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0100] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.
[0101] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.
[0102] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.
[0103] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.
[0104] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.
[0105] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.
[0106]
[0107] In this disclosure, the term "attenuation" of a polypeptide (protein) encompasses a reduction in activity or absence of activity compared to its intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
[0108] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The term “inactivation, deficiency, reduction, downregulation, deterioration, attenuation” of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had before the transformation.
[0109] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
[0110] Specifically, the weakening of the activity of the polypeptide
[0111] 1) Deletion of all or part of a gene encoding a polypeptide;
[0112] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;
[0113] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;
[0114] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleic acid bases in the nucleic acid base sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);
[0115] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0116] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;
[0117] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;
[0118] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE);
[0119] 9) Controlling the cellular localization of polypeptides; or
[0120] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.
[0121] for example,
[0122] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.
[0123] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0124] In addition, the above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0125] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto. For example, by introducing a mutation in a polynucleotide sequence to form a stop codon, the expression of a gene may be inhibited or weakened, but is not limited thereto. The "stop codon" is a codon that does not specify an amino acid among the codons on mRNA and serves as a signal to indicate the end of the protein synthesis process, and generally, three types of UAA, UAG, and UGA can be used as stop codons.
[0126] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0127] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.
[0128] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0129] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.
[0130] Such attenuation of polypeptide activity may be, but is not limited to, attenuation of the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.
[0131] The microorganism (or strain, recombinant cell) of the present disclosure may be a microorganism having the ability to produce (or the production amount) of one or more selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan (hereinafter, simply referred to as “pantothenic acid, pantoic acid, and / or tryptophan”), or having an improved (or increased) ability to produce pantothenic acid, pantoic acid, and / or tryptophan.
[0132] The microorganism of the present disclosure may be, but is not limited to, a microorganism that naturally lacks the ability to produce pantothenic acid, pantoic acid, and / or tryptophan, or a microorganism that has the ability to produce pantothenic acid, pantoic acid, and / or tryptophan but has a strengthened glycine cleavage system and / or a weakened L-serine deaminase, thereby imparting or improving the ability to produce pantothenic acid, pantoic acid, and / or tryptophan. In one example, the microorganism that has the ability to produce pantothenic acid, pantoic acid, and / or tryptophan imparted or improved may be a microorganism into which a glycine cleavage system derived from Mycobacterium smegmatis or a polynucleotide encoding the same has been introduced, and / or a part or all of the sdaA gene encoding L-serine deaminase has been deleted.
[0133] The fact that the above microorganism has improved pantothenic acid, pantoic acid and / or tryptophan production ability or has pantothenic acid, pantoic acid and / or tryptophan production ability may mean that the microorganism has improved pantothenic acid, pantoic acid and / or tryptophan production ability compared to a non-modified microorganism, a cell before recombination, a parent strain or a wild-type microorganism, or that the microorganism is endowed with pantothenic acid, pantoic acid and / or tryptophan production ability, unlike a non-modified microorganism, a cell before recombination, a parent strain or a wild-type microorganism that does not have pantothenic acid, pantoic acid and / or tryptophan production ability.
[0134] According to an example, a microorganism having an enhanced glycine cleavage system and / or a microorganism having a weakened L-serine deaminase may have an enhanced ability to produce pantothenic acid, pantoic acid, and / or tryptophan compared to a non-modified microorganism. In the present disclosure, the term "non-modified microorganism" does not exclude a strain containing a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the non-modified microorganism may refer to a strain into which a glycine cleavage system or a gene encoding the same has not been introduced, or whose activity has not been enhanced, or before its activity has been enhanced. For example, the non-modified microorganism may refer to a strain into which the activity of L-serine deaminase has not been weakened, or before L-serine deaminase has been inactivated. The above "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmodified strain", "unmodified strain", "unmodified microorganism" or "reference microorganism". The enhancement of the glycine cleavage system and / or the weakening of the activity of L-serine deaminase are as described above.
[0135] In one example, the non-modified microorganism, which is a target strain for comparing whether the pantothenic acid, pantoic acid and / or tryptophan production ability increases, may be a wild-type Corynebacterium glutamicum ATCC13032 strain or a Corynebacterium glutamicum strain in which the sdaA gene is deleted from the Corynebacterium glutamicum ATCC13032 strain.
[0136] A microorganism with enhanced activity of a glycine cleavage system according to an example may be a microorganism into which a glycine cleavage system derived from Mycobacterium smegmatis or a gene encoding the same has been introduced.
[0137] The above microorganism may include additional mutations that increase the production of pantothenic acid, pantoic acid, and / or tryptophan, and the location of the mutation and / or the type of gene and / or protein that is the target of the mutation may be included without limitation as long as it increases the production of pantothenic acid, pantoic acid, and / or tryptophan. The above recombinant cell may be used without limitation as long as it is a cell capable of transformation.
[0138] The above microorganism may be a microorganism of the genus Corynebacterium (Corynebacterium sp.). The above-mentioned Corynebacterium genus microorganisms are Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, and Corynebacterium imitans. The microorganism may be selected from the group consisting of, but is not limited to, Corynebacterium imitans, Corynebacterium testudinoris, and Corynebacterium flavescens.
[0139] The above microorganism may be a microorganism of the genus Bacillus. The above Bacillus microorganism may be a microorganism selected from the group consisting of Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus methylotrophicus, Bacillus licheniformis, Bacillus velezensis, Bacillus sonorensis, and Bacillus valismortis, but is not limited thereto.
[0140] The above microorganism may be a microorganism of the genus Escherichia. The above Escherichia microorganism may be, but is not limited to, Escherichia coli.
[0141] For example, the microorganism having improved pantothenic acid, pantoic acid and / or tryptophan production ability is newly granted, or about 10% or more, about 15% or more, about 16% or more, about 20% or more, about 25% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 150% or more, about 160% or more, about 165% or more, about 170% or more, about 200% or more, about 250% or more, about 300% or more, or about It may be increased by, but is not limited to, 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, about 1,000% or more, about 1,500% or more, about 2,000% or more, about 2,500% or more, or about 3,000% or more.
[0142] As another example, the microorganism having improved pantothenic acid, pantoic acid and / or tryptophan production ability has, compared to the parent strain before mutation (e.g., the parent strain or wild type in which the activity of the glycine cleavage system is not enhanced or the activity of L-serine deaminase is not weakened), the pantothenic acid and / or pantoic acid production ability is about 1.1 times or more, about 1.15 times or more, about 1.16 times or more, about 1.2 times or more, about 1.25 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.6 times or more, about 1.65 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, about 2 times or more, about 2.5 times or more, about 3 times or more, about 4 times or more, about 5 times or more, about 6 times or more, about 7 times or more, or about 8 times It can be, but is not limited to, about 9 times or more, about 10 times or more, about 15 times or more, about 20 times or more, about 25 times or more, or about 30 times or more (the upper limit is not particularly limited, and can be, for example, about 1,000 times or less).
[0143] As another example, the microorganism having improved pantothenic acid, pantoic acid and / or tryptophan production ability has, compared to the parent strain before mutation (a parent strain or wild type in which the activity of the glycine cleavage system is not enhanced or the activity of L-serine deaminase is not weakened), the non-mutated microorganism, a pantothenic acid and / or pantoic acid production ability of about 0.1 g / L or more, about 0.2 g / L or more, about 0.3 g / L or more, about 0.4 g / L or more, about 0.5 g / L or more, about 0.6 g / L or more, about 0.7 g / L or more, about 0.8 g / L or more, about 0.9 g / L or more, about 1 g / L or more, about 1.1 g / L or more, about 1.2 g / L or more, about 1.3 g / L or more, about 1.4 g / L or more, about 1.5 g / L or more, about 1.6 g / L or more, about It may be 1.7 g / L or more, about 1.8 g / L or more, about 1.9 g / L or more, about 2.0 g / L or more, about 2.5 g / L or more, about 3 g / L or more, about 3.5 g / L or more, about 4 g / L or more, about 4.5 g / L or more, about 5 g / L or more, about 5.5 g / L or more, about 6 g / L or more, about 7 g / L or more, about 8 g / L or more, about 9 g / L or more, about 10 g / L or more, about 15 g / L or more, about 20 g / L or more, about 25 g / L or more, about 30 g / L or more (the upper limit is not particularly limited, and may be, for example, about 100 g / L or less), but is not limited thereto.
[0144] For example, the microorganism having improved pantothenic acid, pantoic acid and / or tryptophan production ability is newly granted tryptophan production ability, or about 5% or more, about 10% or more, about 15% or more, about 16% or more, about 17% or more, about 18% or more, about 19% or more, about 20% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 150% or more, about 200% or more, about 250% or more, about 300% or more, It may be increased by, but is not limited to, about 400% or more, about 500% or more, about 600% or more, about 700% or more, about 800% or more, about 900% or more, about 1,000% or more, about 1,500% or more, about 2,000% or more, about 2,500% or more, or about 3,000% or more.
[0145] As another example, the microorganism having improved pantothenic acid, pantoic acid and / or tryptophan production ability has, compared to the parent strain before mutation (e.g., the parent strain or wild type in which the activity of the glycine cleavage system is not enhanced or the activity of L-serine deaminase is not weakened), the unmodified microorganism, the tryptophan production ability is about 1.1 times or more, about 1.11 times or more, about 1.12 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, about 2 times or more, about 2.5 times or more, about 3 times or more, about 4 times or more, about 5 times or more, about 6 times or more, about 7 times or more, about 8 times or more, about 9 times or more, about 10 times or more, about 15 times or more, about It may be, but is not limited to, 20 times or more, about 25 times or more, or about 30 times or more (the upper limit is not particularly limited, and may be, for example, about 1,000 times or less).
[0146] As another example, the microorganism having improved pantothenic acid, pantoic acid and / or tryptophan production ability has, compared to the parent strain before mutation (e.g., the parent strain or wild type in which the activity of the glycine cleavage system is not enhanced or the activity of L-serine deaminase is not weakened), the unmodified microorganism, the tryptophan production ability is about 0.1 g / L or more, about 0.2 g / L or more, about 0.3 g / L or more, about 0.4 g / L or more, about 0.5 g / L or more, about 0.6 g / L or more, about 0.7 g / L or more, about 0.8 g / L or more, about 0.9 g / L or more, about 1 g / L or more, about 1.1 g / L or more, about 1.2 g / L or more, about 1.3 g / L or more, about 1.4 g / L or more, about 1.5 g / L or more, about 1.6 g / L or more, about It may be 1.7 g / L or more, about 1.8 g / L or more, about 1.9 g / L or more, about 2.0 g / L or more, about 2.5 g / L or more, about 3 g / L or more, about 3.5 g / L or more, about 4 g / L or more, about 4.5 g / L or more, about 5 g / L or more, about 5.5 g / L or more, about 6 g / L or more, about 7 g / L or more, about 8 g / L or more, about 9 g / L or more, about 10 g / L or more, about 15 g / L or more, about 20 g / L or more, about 25 g / L or more, about 30 g / L or more (the upper limit is not particularly limited, and may be, for example, about 100 g / L or less), but is not limited thereto.
[0147] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values equal to or similar to the value following the term “about,” but is not limited thereto.
[0148]
[0149] Another aspect provides a composition for producing pantothenic acid, pantoic acid and / or tryptophan, comprising a microorganism producing pantothenic acid, pantoic acid and / or tryptophan, wherein the activity of the glycine cleavage system is enhanced and / or the activity of L-serine deaminase is weakened, a medium in which the microorganism is cultured, or a combination thereof.
[0150] The composition may further comprise any suitable excipient commonly used in compositions for producing pantothenic acid, pantoic acid and / or tryptophan, including but not limited to preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers or isotonic agents.
[0151] Another aspect provides the use of the microorganism for producing pantothenic acid, pantoic acid and / or tryptophan.
[0152] Another aspect provides the use of the microorganism for the preparation of a composition for producing pantothenic acid, pantoic acid and / or tryptophan.
[0153] Another aspect provides a method for producing (or preparing) pantothenic acid, pantoic acid and / or tryptophan, comprising the step of culturing in a medium a microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of the glycine cleavage system is enhanced and / or the activity of the L-serine deaminase is weakened. The microorganism producing at least one selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the activity of the glycine cleavage system is enhanced and / or the activity of the L-serine deaminase is weakened, is as described above.
[0154] The method for producing pantothenic acid, pantoic acid and / or tryptophan may include a step of culturing the microorganism in a medium.
[0155] In this disclosure, "cultivation" refers to growing the microorganism under appropriately controlled environmental conditions. The culturing process of this disclosure can be performed using appropriate media and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0156] In the present disclosure, "medium" refers to a material containing nutrients necessary for culturing the microorganism as a main component, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.
[0157] Specifically, culture media for microorganisms of the present disclosure, such as strains of the genus Corynebacterium, can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.Corynebacterium, USA, 1981)].
[0158] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses (e.g., blackstrap molasses), rice bran, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
[0159] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
[0160] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.
[0161] Additionally, during the cultivation of the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. Furthermore, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Furthermore, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or to maintain anaerobic and microaerobic states, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.
[0162] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.
[0163] Pantothenic acid, pantoic acid and / or tryptophan produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.
[0164] The method for producing pantothenic acid, pantoic acid and / or tryptophan of the present disclosure may further include a step of preparing a microorganism of the present disclosure, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.
[0165] The method for producing pantothenic acid, pantoic acid, and / or tryptophan of the present disclosure may further include a step of recovering pantothenic acid, pantoic acid, and / or tryptophan from a culture medium (a culture medium in which culture is performed) or a microorganism (e.g., a strain of the genus Corynebacterium). The recovering step may be additionally included after the culturing step.
[0166] The above recovery may be performed by collecting the desired pantothenic acid, pantoic acid and / or tryptophan using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, for example, a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired pantothenic acid, pantoic acid and / or tryptophan may be recovered from the medium or microorganism using a suitable method known in the art.
[0167] In addition, the method for producing pantothenic acid, pantoic acid, and / or tryptophan of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing pantothenic acid, pantoic acid, and / or tryptophan of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.
[0168]
[0169] When culturing a microorganism with enhanced activity of the glycine cleavage system of the present disclosure and / or weakened activity of L-serine deaminase, high yields of pantothenic acid, pantoic acid, and / or tryptophan can be produced. Therefore, industrial benefits such as increased production convenience and reduced manufacturing costs are expected.
[0170]
[0171] The present disclosure is described in more detail below with examples. However, these examples are intended to exemplify the present disclosure, and the scope of the present disclosure is not limited by these examples, as will be apparent to those skilled in the art to which the present disclosure pertains.
[0172]
[0173] Example 1. Production of a pantothenic acid-producing strain of Corynebacterium spp. with a glycine cleavage system and evaluation of pantothenic acid production capacity.
[0174] (1) Manufacturing of pantothenic acid-producing microorganisms
[0175] A Corynebacterium glutamicum strain with increased pantothenic acid production was created by introducing a 3-methyl-2-oxobutanoate hydroxymethyltransferase G116A mutant (PanB(G116A), U.S. Publication No. US 2024-0167065 A1) derived from Escherichia coli.
[0176] First, a vector was constructed to delete panB present in the parent strain. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NOs: 77 and 78 and 79 and 80. PCR was performed under the following conditions: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, repeated 25 times. As a result, 1,000 bp of gene fragments upstream of the panB gene and 1,000 bp of gene fragments downstream of the panB gene were obtained, and each amplification product was purified using a QIAGEN PCR Purification kit and used as an insert DNA fragment for vector construction. The vector pDC24_ΔpanB for deleting the panB gene on the chromosome was constructed by cloning the pDC24 (SEQ ID NO: 81) vector and DNA fragments (1000 bp gene fragment upstream of the panB gene and 1000 bp gene fragment downstream of the panB gene) treated with restriction enzyme SmaI and heat-treated at 65°C for 20 minutes at a molar concentration (M) of 2:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual.
[0177] Next, PCR was performed using the genomic DNA of E. coli ATCC47076 strain as a template and primers of SEQ ID NOs: 82 and 83 and 84 and 85. PCR was performed under the following conditions: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, repeated 25 times. As a result, 388 bp of gene fragments upstream of the panB gene and 490 bp of gene fragments downstream of the panB gene were obtained, and each amplification product was purified using a QIAGEN PCR Purification kit and used as an insert DNA fragment for vector construction. After treating with the restriction enzyme SmaI and heat-treating at 65℃ for 20 minutes, the pDC24_ΔpanB vector and the obtained DNA fragment were cloned at a molar concentration (M) of 1:1:1 using the Infusion Cloning Kit from TaKaRa according to the provided manual, thereby constructing the vector pDC24_ΔpanB::panB(EC, G116A) for introducing the panB (G116A) gene from Escherichia coli onto the chromosome. The constructed vector pDC24_ΔpanB::panB(EC, G116A) was transformed into Corynebacterium glutamicum ATCC 13032 via electroporation, and through a secondary crossing-over process, strain ATCC13032 ΔpanB::panB(EC, G116A) in which the endogenous panB on the chromosome was replaced with panB(G116A) from E. coli was obtained. The appropriate substitution of panB (G116A) from E. coli was confirmed using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)) using the following primer combination.That is, the strains that were amplified were first determined by selecting the primer combinations (SEQ ID NOs: 86 and 87 and 88 and 89) that match E. coli panB, and the panB sequences of the selected strains were secondarily confirmed by analyzing them using the primer combinations of SEQ ID NOs: 86 and 90.
[0178] The primer sequences used in the above examples are as shown in Table 1 below.
[0179] SEQ ID NO: 77TGAATTCGAGCTCGGTACCCGAAATAGCGCTTGATGAATC78GGTTGCTACCTGCACCCGGGGGGCATGAGTATAGATGTGA79CTATACTCATGCCCCCCGGGTGCAGGTAGCAACCACAAAG80GTCGACTCTAGAGGATCCCCTATGTGGCGTTGGGTGCAGC82CATCTATACTCATGCCCCCCATGAAACCGACCACCATCTC83ACGGTTTCTACC AGCCACTCggcGCCTTCAATTTTGACCATGT84ACATGGTCAAAATTGAAGGCgccGAGTGGCTGGTAGAAACCGT85TGTGGTTGCTACCTGCACCCTTAATGGAAACTGTGTT CTT86ACTCAACTCGTCGGGATATT87TTCATCAGCAAAGAGTTTGG88TCCGCGCGGCTGTGCGGCAG89TGTGGTTCCAGAACCCGCTGAA90TTAATGGAAACTGTGTTCTT
[0180] (2) Production of microorganisms with sdaA gene deletion and glycine cleavage system introduced
[0181] To introduce a glycine cleavage system gene derived from an exogenous microorganism into the ATCC13032 ΔpanB::panB(EC, G116A) strain constructed in Example 1(1), a vector was first constructed to delete the sdaA gene (SEQ ID NO: 26) present in the parent strain. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and the primer combinations of SEQ ID NOs: 7 and 8 and 9 and 10. The PCR conditions were 25 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. As a result, 866 bp of the upper region of the sdaA gene and 927 bp of the lower region of the sdaA gene were obtained, and each amplified product was purified using QIAGEN's PCR Purification kit and used as an insert DNA fragment for vector construction. After treating with restriction enzymes SalI and BamHI and heat-treating at 65℃ for 20 minutes, the pDZ (US Patent Publication No. US 9109242 B2) vector and each DNA fragment of the upper and lower regions of the sdaA gene were cloned at a molar concentration (M) of 2:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual, thereby constructing a vector pDZ_ΔsdaA (ATCC13032) for deleting the sdaA gene on the chromosome.
[0182] To introduce the glycine cleavage system genes derived from foreign microorganisms into pDZ_ΔsdaA (ATCC13032), the gcvP gene, gcvT gene, and gcvH genes derived from each microorganism were amplified using Mycobacterium smegmatis ATCC19420 (KCTC9108), Escherichia coli K 12 substr MG1655, and Corynebacterium stationis ATCC6872 genomic DNA as templates.
[0183] Specifically, using Mycobacterium smegmatis ATCC19420 (KCTC 9108) genomic DNA as a template and primer combinations of SEQ ID NOs: 39 and 40, 41 and 42, and 43 and 44, the gcvP gene (protein sequence: SEQ ID NO: 1, gene sequence: SEQ ID NO: 4 or 28), gcvT gene (protein sequence: SEQ ID NO: 2, gene sequence: SEQ ID NO: 5 or 29), and gcvH gene (protein sequence: SEQ ID NO: 3, gene sequence: SEQ ID NO: 6 or 30) derived from Mycobacterium smegmatis were amplified.
[0184] Using Escherichia coli K 12 substr MG1655 genomic DNA as a template and primer combinations of SEQ ID NOs: 51 and 52, 53 and 54, and 55 and 56, the gcvP gene (protein sequence: SEQ ID NO: 45, gene sequence: SEQ ID NO: 48), gcvT gene (protein sequence: SEQ ID NO: 46, gene sequence: SEQ ID NO: 49), and gcvH gene (protein sequence: SEQ ID NO: 47, gene sequence: SEQ ID NO: 50) derived from E. coli were amplified.
[0185] Using Corynebacterium stationis ATCC6872 genomic DNA as a template and primer combinations of SEQ ID NOs: 63 and 64, 65 and 66, and 67 and 68, the gcvP gene (protein sequence: SEQ ID NO: 57, gene sequence: SEQ ID NO: 60), gcvT gene (protein sequence: SEQ ID NO: 58, gene sequence: SEQ ID NO: 61), and gcvH gene (protein sequence: SEQ ID NO: 59, gene sequence: SEQ ID NO: 62) from Corynebacterium stationis were amplified.
[0186] The promoter sequence (PlysC) of the lysC gene was amplified using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template. Specifically, the PlysC sequence was amplified using primer combinations of SEQ ID NOs: 69 and 70 for gcvPTH expression from Mycobacterium smegmatis, SEQ ID NOs: 69 and 71 for gcvPTH expression from Escherichia coli, and SEQ ID NOs: 69 and 72 for gcvPTH expression from Corynebacterium stationanis. PCR was performed 25 cycles of denaturation at 95°C for 30 s; annealing at 55°C for 30 s; and polymerization at 72°C for 3 min. As a result, each PlysC (353 bp) fragment and DNA fragments of the gcvP gene, gcvT gene, and gcvH gene from each microorganism were obtained. The vector pDZ_ΔsdaA (ATCC13032) was treated with restriction enzyme NotI and heat-treated at 65°C for 20 minutes, and the PlysC fragment, gcvP gene fragment, gcvT gene fragment, and gcvH gene fragment amplified above were cloned using TaKaRa's Infusion Cloning Kit according to the provided manual to introduce the gcvP gene, gcvT gene, and gcvH gene derived from Mycobacterium smegmatis, Escherichia coli, and Corynebacterium stationis into the sdaA gene position on the chromosome, pDZ_ΔsdaA::PlysC-gcvPTH(M. sm) pDZ_ΔsdaA::PlysC-gcvPTH (E. coli) and pDZ_ΔsdaA::PlysC-gcvPTH (C. st) were constructed, respectively.
[0187] The constructed vectors were transformed into the ATCC13032_ΔpanB::panB(EC, G116A) strain constructed in Example 1(1), which is a pantothenic acid producing strain, through electroporation, and through a second crossing process, a strain with the sdaA gene deleted on the chromosome (ATCC13032_ΔpanB::panB(EC, G116A) ΔsdaA) and a strain with the sdaA gene deleted and the gcvPTH gene derived from each microorganism were introduced, respectively. Appropriate substitution of the glycine cleavage system genes from Mycobacterium smegmatis, Escherichia coli, and Corynebacterium stationaris was initially confirmed by amplification of each glycine cleavage system gene using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)) using primer combinations of SEQ ID NOs: 11 and 12 and 13 and 14, and was finally confirmed by analyzing the gcvPTH sequence using primer combinations of SEQ ID NOs: 15 and 16. The final selected strains were named ATCC13032_ΔpanB::panB(EC, G116A) ΔsdaA::PlysC-gcvPTH (M. sm), ATCC13032_ΔpanB::panB(EC, G116A) ΔsdaA::PlysC-gcvPTH (E. coli), and ATCC13032_ΔpanB::panB(EC, G116A) ΔsdaA::PlysC-gcvPTH (C. st), respectively.
[0188]
[0189] (3) Preparation of gcvPTH overexpressing strain derived from Mycobacterium smegmatis
[0190] The PlysC fragment derived from Corynebacterium glutamicum and the gcvP, gcvT, and gcvH gene fragments derived from Mycobacterium smegmatis were obtained by the method described in Example 1(2) using primer combinations of SEQ ID NOs: 31, 32, 33, 34, 35, 36, and 37, 38. The vector was obtained by cloning the pECCG117 (Korean Patent No. 10-0057684) vector and the above DNA fragments (PlysC, gcvP, gcvT, gcvH) at a molar concentration (M) of 2:1:1:1:1 using TaKaRa's Infusion Cloning Kit according to the provided manual after treating with restriction enzyme BamHI and heat-treating at 65°C for 20 minutes, and naming it pECCG117_PlysC-gcvPTH(M. sm). The above vector was transformed into ATCC13032_ΔpanB::panB(EC, G116A) strain by electroporation to obtain a strain overexpressing GcvP, GcvT and GcvH derived from Mycobacterium smegmatis, which was named ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH (M. sm).
[0191]
[0192] The primer sequences used in the above examples are as shown in Table 2 below.
[0193]
[0194] (4) Evaluation of pantothenic acid production capacity
[0195] The pantothenic acid productivity of the mutant strains obtained in the above examples was measured by the following method. Specifically, the parent strain and the mutant strain were inoculated into a 250 ml corner-buffered flask containing 25 ml of production medium, and then cultured with shaking at 200 rpm at 32°C for 48 hours. The culture solution was centrifuged at 20,000 rcf for 10 minutes, and the collected supernatant was diluted 1 / 10 with TDW (triple distilled water) and analyzed by HPLC to measure the pantothenic acid concentration.
[0196] <Production medium>
[0197] Glucose 10%, beta-alanine 0.5%, yeast extract 0.4%, ammonium sulfate 1.5%, monobasic potassium phosphate 0.1%, magnesium sulfate heptahydrate 0.05%, iron sulfate heptahydrate 10 mg / l, manganese sulfate monohydrate 6.7 mg / l, biotin 50 μg / l, thiamine HCl 100 μg / l, pH 7.2
[0198]
[0199] The pantothenic acid production ability of the mutant strains obtained in the above example is shown in Table 3 below.
[0200] StrainPantothenic acid concentration (g / L)L-gly concentration (g / L)Increase in pantothenic acid concentration compared to the control Parent strain (ATCC13032_ΔpanB::panB(EC, G116A))1.20.4-ATCC13032_ΔpanB::panB(EC, G116A ΔsdaA1.40.416.67%ATCC13032_ΔpanB::panB(EC, G116A ΔsdaA::PlysC-gcvPTH (M. sm)2.60.1116.67%ATCC13032_ΔpanB::panB(EC, G116A ΔsdaA::PlysC-gcvPTH (E. coli)1.40.416.67%ATCC13032_ΔpanB::panB(EC, G116A ΔsdaA::PlysC-gcvPTH (C. st)1.50.416.67%ATCC13032_ΔpanB::panB(EC, G116A pECCG117_PlysC-gcvPTH (M. sm)3.20.0166.67%
[0201] As shown in Table 3 above, the ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA strain, in which the sdaA gene was deleted, showed an increase in pantothenic acid production by approximately 17% compared to the control group. In addition, a Corynebacterium glutamicum strain (ATCC13032_ΔpanB::panB(EC, G116A) pECCG117_PlysC-gcvPTH (M. sm)) overexpressing a glycine cleavage system gene derived from Mycobacterium smegmatis showed a significantly superior effect, with pantothenic acid production increasing by approximately 167% compared to the control group. A Corynebacterium glutamicum strain (ATCC13032_ΔpanB::panB(EC, G116A)ΔsdaA::PlysC-gcvPTH (M. sm)) in which the sdaA gene was deleted and a glycine cleavage system gene derived from Mycobacterium smegmatis was introduced also showed a significantly superior effect, with pantothenic acid production increasing by approximately 117% compared to the control group.
[0202]
[0203] Example 2. Production of a tryptophan-producing strain of Corynebacterium spp. with a glycine cleavage system.
[0204] (1) Production of microorganisms with sdaA gene deletion and foreign glycine cleavage system introduced
[0205] To introduce a glycine cleavage system gene derived from an alien microorganism into CA04-8405 (KCCM12099P, U.S. Patent Publication No. US 10995378 B2), a tryptophan-producing strain derived from Corynebacterium glutamicum ATCC13869, a vector was first constructed to delete the sdaA (L-serine deaminase) gene (SEQ ID NO: 27) present in the parent strain. PCR was performed using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template and primer combinations of SEQ ID NOs: 17 and 18 and 19 and 20. The PCR conditions were 25 cycles of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. As a result, 966 bp of the upper region of the sdaA gene and 948 bp of the lower region of the sdaA gene were obtained, and each amplified product was purified using a PCR Purification kit from QIAGEN and used as an insert DNA fragment for vector construction. After treating with the restriction enzyme BamHI and heat-treating at 65°C for 20 minutes, the pDZ (US Patent Publication No. US 9109242 B2) vector and the vector and each DNA fragment of the upper and lower regions of the sdaA gene were cloned at a molar concentration (M) of 2:1:1 using the Infusion Cloning Kit from TaKaRa according to the provided manual, thereby constructing a vector pDZ_ΔsdaA (ATCC13869) for deleting the sdaA gene on the chromosome.
[0206] To introduce a glycine cleavage system derived from a foreign microorganism into pDZ_ΔsdaA (ATCC13869), the gcvP gene, gcvT gene, and gcvH gene derived from each microorganism were amplified using the genomic DNA of Mycobacterium smegmatis ATCC19420 (KCTC9108), Escherichia coli K 12 substr MG1655, and Corynebacterium stationis ATCC6872 as templates.
[0207] Specifically, using Mycobacterium smegmatis ATCC19420 (KCTC 9108) genomic DNA as a template and primer combinations of SEQ ID NOs: 39 and 40, 41 and 42, and 43 and 73, the gcvP gene (protein sequence: SEQ ID NO: 1, gene sequence: SEQ ID NO: 4 or 28), gcvT gene (protein sequence: SEQ ID NO: 2, gene sequence: SEQ ID NO: 5 or 29), and gcvH gene (protein sequence: SEQ ID NO: 3, gene sequence: SEQ ID NO: 6 or 30) derived from Mycobacterium smegmatis were amplified.
[0208] Using Escherichia coli K 12 substr MG1655 genomic DNA as a template and primer combinations of SEQ ID NOs: 51 and 52, 53 and 54, and 55 and 74, gcvP gene (protein sequence: SEQ ID NO: 45, gene sequence: SEQ ID NO: 48), gcvT gene (protein sequence: SEQ ID NO: 46, gene sequence: SEQ ID NO: 49), and gcvH gene (protein sequence: SEQ ID NO: 47, gene sequence: SEQ ID NO: 50) derived from g E. coli were amplified.
[0209] Using Corynebacterium stationis ATCC6872 genomic DNA as a template and primer combinations of SEQ ID NOs: 63 and 64, 65 and 66, and 67 and 75, the gcvP gene (protein sequence: SEQ ID NO: 57, gene sequence: SEQ ID NO: 60), gcvT gene (protein sequence: SEQ ID NO: 58, gene sequence: SEQ ID NO: 61), and gcvH gene (protein sequence: SEQ ID NO: 59, gene sequence: SEQ ID NO: 62) from Corynebacterium stationis were amplified.
[0210] The promoter sequence (PlysC) of the lysC gene was amplified using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template. Specifically, the PlysC sequence was amplified using primer combinations of SEQ ID NOs: 76 and 70 for gcvPTH expression from Mycobacterium smegmatis, SEQ ID NOs: 76 and 71 for gcvPTH expression from Escherichia coli, and SEQ ID NOs: 76 and 72 for gcvPTH expression from Corynebacterium stationanis.
[0211] PCR was performed 25 times at 95°C for 30 seconds for denaturation; 55°C for 30 seconds for annealing; and 72°C for 3 minutes for polymerization. As a result, each PlysC (353 bp) fragment and DNA fragments of the gcvP gene, gcvT gene, and gcvH gene derived from each microorganism were obtained. After treating with restriction enzyme NotI and heat-treating at 65°C for 20 minutes, the vector amplified above and the PlysC fragment, gcvP gene fragment, gcvT gene fragment and gcvH gene DNA fragment were cloned using TaKaRa's Infusion Cloning Kit according to the provided manual to introduce the gcvP gene, gcvT gene and gcvH gene derived from Mycobacterium smegmatis, Escherichia coli and Corynebacterium stationaris into the sdaA gene position on the chromosome, thereby obtaining vectors pDZ_ΔsdaA (ATCC13869) ::PlysC-gcvPTH (M. sm), pDZ_ΔsdaA (ATCC13869) ::PlysC-gcvPTH (E. coli), pDZ_ΔsdaA(ATCC13869) ::PlysC-gcvPTH(C. st) was constructed.
[0212]
[0213] The manufactured vectors were transformed into the CA04-8405 strain (US Patent Publication No. US 10995378 B2), a tryptophan-producing strain, through electroporation, and through a secondary crossing process, a strain with the sdaA gene deleted on the chromosome and a strain with the sdaA gene deleted and the gcvPTH gene derived from each microorganism were obtained, respectively. Appropriate substitution of the glycine cleavage system genes from Mycobacterium smegmatis, Escherichia coli, and Corynebacterium stationensis was initially confirmed by amplification of each glycine cleavage system gene using the MASA (Mutant Allele Specific Amplification) PCR technique (Takeda et al., Hum. Mutation, 2, 112-117 (1993)) using primer combinations of SEQ ID NOs: 21 and 12 and 13 and 22, and was finally confirmed by analyzing the gcvPTH sequence using primer combinations of SEQ ID NOs: 23 and 24. The final selected strains were named CA04-8405ΔsdaA::PlysC-gcvPTH (M. sm), CA04-8405ΔsdaA::PlysC-gcvPTH (C. st), and CA04-8405ΔsdaA::PlysC-gcvPTH (E. coli), respectively.
[0214]
[0215] (2) Preparation of gcvPTH overexpressing strain derived from Mycobacterium smegmatis
[0216] In addition, a strain overexpressing GcvP, GcvT, and GcvH derived from Mycobacterium smegmatis was obtained by transforming the CA04-8405 strain with the pECCG117_PlysC-gcvPTH (M. sm) vector prepared in Example 1 using electroporation, and was named CA04-8405 pECCG117_PlysC-gcvPTH (M. sm).
[0217] The primer sequences used in the above examples are as shown in Table 4 below.
[0218]
[0219] (3) Evaluation of tryptophan production capacity
[0220] The tryptophan productivity of the mutants obtained in the above examples was measured using the following method. Each strain was inoculated into a 250-ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250-ml corner-baffle flask containing 25 ml of production medium and cultured at 30°C for 24 hours with shaking at 200 rpm. After completion of culture, the amount of L-tryptophan produced was measured by HPLC.
[0221] <Jongbaeji>
[0222] Glucose 20g, peptone 10g, yeast extract 5g, urea 1.5g, KH2PO4 4g, K2HPO4 8g, MgSO4 7H2O 0.5g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg (per 1 liter of distilled water)
[0223] <Production medium>
[0224] Glucose 30g, (NH4)2SO4 15g, MgSO4 7H2O 1.2g, KH2PO4 1g, yeast extract 5g, biotin 900 μg, thiamine hydrochloride 4500 μg, calcium-pantothenic acid 4500 μg, CaCO3 30g (based on 1 liter of distilled water)
[0225]
[0226] The tryptophan production ability of the mutant strains obtained in the above example is shown in Table 5 below.
[0227] StrainTryptophan concentration (g / L)L-gly concentration (g / L)Increase in tryptophan concentration compared to the controlControl (CA04-8405)1.520.2-CA04-8405ΔsdaA1.700.211.84%CA04-8405ΔsdaA::PlysC-gcvPTH (M. sm)2.180.043.42%CA04-8405ΔsdaA::PlysC-gcvPTH (E. coli)1.790.211.84%CA04-8405ΔsdaA::PlysC-gcvPTH (C. st)1.800.211.84%CA04-8405 pECCG117_PlysC-gcvPTH (M. sm)2.680.076.32%
[0228] As shown in Table 5 above, the CA04-8405ΔsdaA strain, in which the sdaA gene was deleted, showed an approximately 12% increase in tryptophan production compared to the control group. The Corynebacterium glutamicum strain (CA04-8405ΔsdaA::PlysC-gcvPTH (M. sm)) in which the sdaA gene was deleted and a glycine cleavage system gene from Mycobacterium smegmatis was introduced showed an approximately 43% increase in tryptophan production compared to the control group, showing a significantly superior effect. A Corynebacterium glutamicum strain (CA04-8405 pECCG117_PlysC-gcvPTH (M. sm)) overexpressing the glycine cleavage system gene derived from Mycobacterium smegmatis showed a significantly superior effect, with tryptophan production increasing by approximately 76% compared to the control group.
[0229]
[0230] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
Claims
1. A microorganism of the genus Corynebacterium that produces at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, with enhanced activity of the glycine cleavage system.
2. A microorganism of the genus Corynebacterium, wherein the glycine cleavage system comprises at least one subunit selected from the group consisting of GcvP, GcvT, and GcvH polypeptides.
3. A microorganism of the genus Corynebacterium, wherein the glycine cleavage system comprises at least one selected from the group consisting of a GcvP polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 90% or more sequence identity therewith, a GcvT polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having 90% or more sequence identity therewith, and a GcvH polypeptide comprising the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence having 90% or more sequence identity therewith.
4. In the first paragraph, the microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium into which a glycine cleavage system derived from Mycobacterium smegmatis or a polynucleotide encoding the same has been introduced.
5. In the first paragraph, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
6. A microorganism of the genus Corynebacterium that produces at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, with weakened L-serine deaminase activity.
7. A microorganism of the genus Corynebacterium, wherein the L-serine deaminase in paragraph 6 is encoded by the sdaA gene.
8. In paragraph 6, the microorganism is a microorganism of the genus Corynebacterium, in which part or all of the sdaA gene is missing.
9. A microorganism of the genus Corynebacterium, wherein the sdaA gene comprises a nucleic acid sequence of SEQ ID NO: 26 or SEQ ID NO: 27 or a nucleic acid sequence having 90% or more sequence identity therewith, in accordance with paragraph 7 or paragraph 8.
10. In paragraph 6, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
11. A production method for at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan, comprising a step of culturing a microorganism of the genus Corynebacterium according to any one of claims 1 to 10 in a medium.
12. A production method according to claim 11, further comprising a step of recovering at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan from the culture medium or microorganism.
13. A production composition comprising at least one microorganism of the genus Corynebacterium selected from the group consisting of pantothenic acid, pantoic acid and tryptophan, wherein the composition comprises any one of the microorganisms of the genus Corynebacterium as defined in any one of claims 1 to 10.
14. Use of a microorganism of the genus Corynebacterium according to any one of claims 1 to 10 for the production of at least one selected from the group consisting of pantothenic acid, pantoic acid, and tryptophan.
Citation Information
Patent Citations
Strain overexpressing l-tryptophan by enhancing sub substrates supply and process for producing l-tryptophan using the same
KR101830002B1
Nucleotide sequences of coryneform bacteria coding forproteins involved in l-serine metabolism and method forproducing l-serine
KR1020050108387A
Microorganisms and processes for enhanced production of pantothenate
US20040146996A1
Microorganism for producing pantoic acid, and construction method therefor and application thereof
US20240011059A1