Application of Desi1 protein in rice resistance to sheath blight
By regulating the expression of the Desi1 protein in rice and creating resistant germplasm using CRISPR/Cas9 gene editing technology, the problem of high cost of chemical control of rice sheath blight has been solved, providing an economical and environmentally friendly control measure and enhancing rice's resistance to sheath blight.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHENYANG AGRI UNIV
- Filing Date
- 2024-11-19
- Publication Date
- 2026-05-26
Smart Images

Figure CN119220589B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of Desi1 protein in rice resistance to sheath blight. Background Technology
[0002] Rice, as a staple food crop in my country, plays a crucial role in the country's food production. Rice sheath blight is a global disease caused by Rhizoctonia solani Kühn. Under suitable environmental conditions, sheath blight can cause rice yield reductions of up to 50%, posing a serious threat to production. Currently, disease control relies mainly on chemical control, but chemical control is costly, pollutes the environment, and easily leads to drug resistance. Therefore, adopting economical and environmentally friendly control measures is particularly urgent. Breeding and cultivating disease-resistant varieties is the most economical, safe, and effective strategy for controlling rice sheath blight.
[0003] SUMOylation is a post-translational modification widely present in eukaryotic cells. SUMOylation regulates protein-protein interactions, subcellular localization of substrate proteins, activity, and stability. SUMOylation is always in dynamic equilibrium, and its level is regulated by SUMO proteases. Currently, two classes of SUMO proteases have been reported in plants: ubiquitin-like proteases (ULPs) and deSUmoylating isopeptidases (Desi). Compared to ULP-type SUMO proteases, the intracellular functions and substrates of Desi-type SUMO proteases are less well-documented. SUMO proteases can interact with SUMOylated substrate proteins, cleaving the modified SUMO molecules to achieve deSUMOylation. The cleaved SUMO molecules can then recycle and participate in SUMOylation (Morrell and Sadanandom, 2019). SUMOylation is involved in regulating numerous biological processes, including stress response, signal transduction, cell cycle, protein transport, transcription, translation, DNA damage response, chromatin integrity, and nuclear transport (Hannoun et al., 2016; Seeler et al., 2003; van den Burg et al., 2010; Wohlschlegel et al., 2004). In plants and animals, SUMOylation is primarily involved in the regulation of immune responses (Hannoun et al., 2016; van den Burg et al., 2010). In recent years, numerous studies have demonstrated the crucial role of SUMOylation in regulating plant immune responses. However, whether SUMOylation participates in regulating the interaction between rice and sheath blight pathogens remains unreported. Summary of the Invention
[0004] This invention provides the application of Desi1 protein in rice resistance to sheath blight. The SUMO protease Desi1 positively regulates the defense response of rice to sheath blight. Knocking out Desi1 makes rice more sensitive to sheath blight, and overexpression of Desi1 enhances the resistance of rice to sheath blight. This is of great significance for the creation of rice germplasm resources resistant to sheath blight and the effective control of sheath blight.
[0005] This invention provides the application of Desi1 protein in regulating rice resistance to sheath blight, and the amino acid sequence of the Desi1 protein is shown in SEQ ID No. 1.
[0006] In one specific embodiment of the present invention, the nucleotide sequence of the gene encoding the Desi1 protein is shown in SEQ ID No. 2.
[0007] In one specific embodiment of the present invention, the regulation includes: knocking out the gene encoding the Desi1 protein to enhance the susceptibility of rice to sheath blight; and overexpressing the gene encoding the Desi1 protein to enhance the resistance of rice to sheath blight.
[0008] This invention provides the application of the Desi1 gene in the creation of rice germplasm with resistance to rice sheath blight, the nucleotide sequence of which is shown in SEQ ID No. 2.
[0009] This invention provides a method for creating rice germplasm related to rice sheath blight resistance, comprising knocking out or overexpressing the Desi1 gene in the rice genome, wherein the nucleotide sequence of the Desi1 gene is shown in SEQ ID No. 2.
[0010] In one specific embodiment of the present invention, the knockout method includes the CRISPR / Cas9 gene editing method, and the nucleotide sequence of the sgRNA used is shown in SEQ ID No. 3: CGACATCTCGCCGCGGTACA.
[0011] In one specific embodiment of the present invention, the sgRNA is inserted into a CRISPR-Cas9 vector to obtain a gene knockout vector.
[0012] In one specific embodiment of the present invention, the overexpression includes cloning the Desi1 gene into the plant expression vector PGA1611 to obtain an overexpression vector, and using the overexpression vector to transfect a target rice variety to obtain overexpression germplasm.
[0013] This invention provides the application of rice germplasm obtained using the above-described creation method in the study of resistance to rice sheath blight.
[0014] Beneficial Effects: This invention provides the application of the Desi1 protein in regulating rice resistance to sheath blight. The amino acid sequence of the Desi1 protein is shown in SEQ ID No. 1. This invention obtains the Desi1-OX transgenic plant overexpressing Desi1 through overexpression transgenic technology. Sheath blight resistance identification shows that Desi1-OX is more resistant to sheath blight than the wild-type rice control. This invention also uses CRISPR / Cas9 gene editing to edit the gene encoding the Desi1 protein in recipient rice, obtaining the Desi1 mutant transgenic plant desi1. Sheath blight resistance identification shows that desi1 is more susceptible to sheath blight than the wild-type rice control. This invention confirms that the Desi1 protein is related to rice resistance to sheath blight, and that Desi1 overexpression enhances rice resistance to sheath blight. It can be used to create new rice germplasm resistant to sheath blight, demonstrating that the application described in this invention is of great significance for the creation of rice germplasm resources resistant to sheath blight and the effective control of sheath blight. Attached Figure Description
[0015] Figure 1 This is a sequencing analysis diagram of the desi1 transgenic line;
[0016] Figure 2 This is a partial structural diagram and molecular detection diagram of the Desi1-OX overexpression recombinant vector;
[0017] Figure 3 Phenotypic figures of desi1 transgenic rice and Desi1-OX transgenic rice after inoculation with sheath blight. Detailed Implementation
[0018] This invention provides the application of Desi1 protein in regulating rice resistance to sheath blight. The amino acid sequence of the Desi1 protein is shown in SEQ ID No. 1: MAEEGYKVVLNVYDLSNGLARQLSTSFLGKPIEAIWHTGVVVYGNEYFFGGGIQSLAAGRTPYGRPVRVVEMGETHIPREVFEDYLRDISPRYTAETYRLLSHNCNNFSNEVAQFLVGAGIPDYILNLPAEVMSSPMGPLIMPMIQNLESTLRTNAAPQATQFVPSSVPPPPPPQNKPGEGSSSSKQEDKAAKAKQGSAADPLGGARGKVQEEVMREFAAIMASGTLRASEAAALAMRRVMERHGNATMQQS*.
[0019] The Desi1 protein of this invention contains a total of 252 amino acids, which is 759 bp of the nucleotide sequence in the Desi1 (LOC_Os02g56900) gene. The nucleotide sequence of the Desi1 gene is shown in SEQ ID. Shown in No.2: ATGGCGGAGGAAGGGTACAAGGTTGTTCTTAACGTGTACGACCTCAGCAACGGCCTCGCGCGGCAGCTCTCCACCTCCTTCCTCGGCAAGCCAATCGAGGCCATCTGGCATACGGGCGTGGTGGTGTACGGGAACGAGTACTTCTTCGGCGGCGGGATCCAGTCGCTGGCGGCGGGGAGGA CGCCGTACGGGCGGCCGGTGCGGGTGGTGGAGATGGGCGAGACGCACATCCCGCGGGAGGTGTTCGAGGACTACCTCCGCGACATCTCGCCGCGGTACACGGCGGAGACGTACCGGCTGCTCAGCCACAACTGCAACAACTTCAGCAACGAGGTGGCGCAATTCCTCGTCGGCGCCGGCATCCCGACT ACATCCTCAACCTCCCCGCCGAGGTCATGTCCAGCCCCATGGGCCCCCTCATGCCCATGATTCAGAACCTCGAGTCCACGCTCCGGACCAACGCCGCGCCGCAGGCCACGCAGTTCGTCCCCTCGTCCGTGCCGCCGCCGCCGCCGCCGCAGAACAAGCCCGGCGAGGGCTCGTCTTCCTCGAAGC AAGAAGACAAGGCGGCCAAAGCGAAGCAGGGCTCGGCGGCTGACCCGCTCGGCGGCGCGAGGGGGAAGGTGCAGGAGGAGGTGATGCGGGAGTTCGCGGCGATCATGGCGAGCGGGACGCTGCGGGCGAGCGAGGCGGCGGCGCTGGCGATGCGGCGGGTCATGGAGCGGCACGGCAACGCCACCATGC AGCAGAGCTAG.
[0020] In one specific embodiment of the present invention, the regulation includes: knocking out the gene encoding the Desi1 protein to enhance the susceptibility of rice to sheath blight; and overexpressing the gene encoding the Desi1 protein to enhance the resistance of rice to sheath blight.
[0021] This invention provides the application of the Desi1 gene in the creation of rice germplasm with resistance to rice sheath blight, the nucleotide sequence of which is shown in SEQ ID No. 2.
[0022] In one specific embodiment of the present invention, gene knockout of the rice genome can be achieved by gene editing to obtain germplasm that is more sensitive to rice sheath blight; alternatively, overexpression of the Desi1 gene in the rice genome can be achieved to obtain germplasm with high resistance to rice sheath blight.
[0023] This invention provides a method for creating rice germplasm related to rice sheath blight resistance, comprising knocking out or overexpressing the Desi1 gene in the rice genome, wherein the nucleotide sequence of the Desi1 gene is shown in SEQ ID No. 2.
[0024] In one specific embodiment of the present invention, the knockout method includes the CRISPR / Cas9 gene editing method, and the nucleotide sequence of the sgRNA used is shown in SEQ ID No. 3: CGACATCTCGCCGCGGTACA.
[0025] In one specific embodiment of the present invention, the method includes inserting the sgRNA into a CRISPR-Cas9 vector to obtain a gene knockout vector. The CRISPR-Cas9 vector construction kit used in the present invention was purchased from Hangzhou Baige Biotechnology Co., Ltd. (Cat#BGK01).
[0026] In one specific embodiment of the present invention, the overexpression includes cloning the Desi1 gene into the plant expression vector PGA1611 to obtain an overexpression vector, and using the overexpression vector to transfect a target rice variety to obtain overexpression germplasm.
[0027] This invention provides the application of rice germplasm obtained using the above-described method in resistance to rice sheath blight.
[0028] To further illustrate the present invention, the application of the Desi1 protein provided by the present invention in rice resistance to sheath blight is described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0029] Example 1
[0030] Obtaining the CRISPR / Cas9 gene-edited transgenic rice plant desi1
[0031] 1. The acquisition of genetically modified rice
[0032] The Desi1 gene sequence shown in SEQ ID No. 2 was provided to the company, and Wuhan Boyuan Biotechnology Co., Ltd. was responsible for target site sequence design, primer design, vector construction and transformation, transforming the rice variety ZH11. The final result was T0 generation transgenic rice.
[0033] 2. Identification of genetically modified rice
[0034] The obtained transgenic plants were further verified by sequencing analysis, such as Figure 1 As shown. Sequencing analysis of positive plants revealed that plant #5 had a T base inserted between positions 263 and 264 of the Desi1 coding gene sequence, and plant #19 had a C base deleted at position 264 of the Desi1 coding gene sequence. This caused a frameshift in the amino acid sequence encoded by the OsDesi1 gene, resulting in the loss of function of the OsDesi1 gene. Figure 1 The gene-edited plants were named desi1-5 and desi1-19, respectively.
[0035] Example 2
[0036] Obtaining Desi1-overexpressing transgenic rice plants
[0037] 1) Construction of recombinant vectors for overexpressing the Desi1 gene
[0038] The nucleotide sequence of the Desi1 (LOC_Os02g56900) gene is shown in SEQ ID No. 2, and the encoded protein is OsDesi1, with the amino acid sequence shown in SEQ ID No. 1.
[0039] The amplified sequence fragment was cloned into the plant expression vector PGA1611 (Piao HL, XuanYH, Park SH, JeBI, Park SJ, Park SH, Kim CM, Huang J, Wang GK, Kim MJ, Kang SM, Lee IJ, Kwon TR, KimYH, Yeo US, Yi G, Son D, Han CD. OsCIPK31, a CBL-interacting protein kinase is involved in germination and seedling growth under abiotic stress conditions in rice plants. Mol Cells. 2010, 30: 19-27; available to the public from Gyeongsang National University, South Korea) and linked to the backbone to obtain an overexpression vector of the OsDesi1 gene ( Figure 2 (A)
[0040] 2) Obtaining transgenic rice overexpressing the OsDesi1 gene
[0041] The obtained PGA1611-OsDesi1 overexpression vector was transformed into Agrobacterium LBA4404 and then into rice variety ZH11. Hygromycin screening yielded T0 generation PGA1611-OsDesi1 transgenic rice, which is the OsDesi1-OX overexpression transgenic line, named Desi1-OX. The specific operations were performed by Wuhan Boyuan Biotechnology Co., Ltd.
[0042] 3) Molecular identification of Desi1-OX transgenic rice plants
[0043] Molecular identification was performed on the T0 generation Desi1-OX transgenic rice and wild-type rice ZH11 obtained above. Total RNA was extracted from the roots of various rice species, reverse transcribed, and then identified using qRT-PCR with the following primers:
[0044] OsDesi1-F(SEQ ID No.4):ACCACCATACATTCGACGCG;
[0045] OsDesi1-R (SEQ ID No. 5):GGGTTATCGTTATCCATCCATCGG;
[0046] The internal reference gene is Ubiquitin, and the internal reference primers are:
[0047] Ubiquitin-F (SEQ ID No. 6):CACGGTTCAACAACATCCAG;
[0048] Ubiquitin-R (SEQ ID No. 7):TGAAGACCCTGACTGGGAAG;
[0049] The results are as follows Figure 2 As shown in Figure B, the average relative expression level of Desi1 in T0 generation Desi1-OX transgenic rice was significantly higher than that in wild-type rice ZH11.
[0050] Example 3
[0051] Phenotypic observation of desi1 transgenic rice and Desi1-OX transgenic rice after inoculation with sheath blight
[0052] Resistance was determined by inoculating live organisms with *Rhizoctonia solani*.
[0053] Live inoculation: The leaf sheath of the rice plant to be inoculated was moistened with a spray bottle. Using sterile forceps, a piece of bark covered with *Rhizoctonia solani* mycelium was taken and inserted into the leaf sheath of the third leaf from the bottom of the rice plant. The leaf sheath containing the bark was moistened again with a spray bottle. The inoculation site was wrapped with plastic wrap to maintain moisture and placed under normal growth conditions for continued cultivation. The plastic wrap was removed after 72 hours. Each treatment was replicated three times. Data was collected and analyzed 10–15 days after inoculation.
[0054] Inoculation results of desi1 mutant plants showed that the lesions of desi1 mutant plants were significantly larger than those of wild-type plants, and these mutants were more susceptible to the disease. Figure 3 The inoculation results of Desi1-OX transgenic plants showed that the lesion length of the overexpressing plants was significantly smaller than that of the wild type. Figure 3 This indicates that plants that overexpress this trait are more resistant to disease.
[0055] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of overexpression of the gene encoding Desi1 protein in improving resistance to rice sheath blight, characterized in that, The amino acid sequence of the Desi1 protein is shown in SEQ ID No.
1.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the Desi1 protein is shown in SEQ ID No.
2.
3. Overexpression Desi1 The application of genes in creating rice germplasm with enhanced resistance to sheath blight is characterized by, The Desi1 The nucleotide sequence of the gene is shown in SEQ ID No.
2.
4. A method for creating rice germplasm with enhanced resistance to sheath blight, characterized in that, Including the rice genome Desi1 The gene is overexpressed, the Desi1 The nucleotide sequence of the gene is shown in SEQ ID No.
2.
5. The method of creation according to claim 4, characterized in that, The overexpression includes the... Desi1 The gene was cloned into the plant expression vector PGA1611 to obtain an overexpression vector, which was then used to transfect the target rice variety to obtain overexpression germplasm.