Application of OsATS3 gene in regulating rice tolerance to waterlogging stress
By knocking out the OsATS3 gene using CRISPR/Cas9 technology, the growth of rice seedlings after germination was regulated, solving the problems of difficult seed germination and low seedling survival rate in direct rice seedling production. This resulted in rice seedlings with well-developed root systems, rapid seedling growth, and high seedling survival rate, thus promoting the development of rice breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- AGRO BIOLOGICAL GENE RES CENT GUANGDONG ACADEMY OF AGRI SCI
- Filing Date
- 2024-11-19
- Publication Date
- 2026-04-21
AI Technical Summary
Existing direct-seeded rice varieties face difficulties in seed germination under flooded and low-oxygen conditions, resulting in low seedling rates and unstable yields. Furthermore, the scarcity of low-oxygen germination-tolerant genes and superior genes limits the development of the rice industry.
By knocking out the OsATS3 gene using CRISPR/Cas9 technology, the growth of seedling roots, aboveground seedling length, and seedling survival rate after rice seed germination were regulated. Gene editing was performed using specific target sequences of the OsATS3 gene, such as SEQ ID NO.3 and SEQ ID NO.4, to obtain homozygous plants with OsATS3 gene knockout.
Under flooded conditions, the OsATS3 gene knockout lines exhibited phenotypes such as well-developed seedling roots, rapid aboveground growth, fast emergence of the first leaf, and high seedling survival rate, solving the problems of slow seedling growth and low seedling survival rate in direct-seeded rice and providing new rice breeding resources.
Smart Images

Figure CN119220591B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically involving the application of the OsATS3 gene in regulating rice's tolerance to flooding stress. Background Technology
[0002] Rice is one of the world's most important food crops. With the shortage of rural labor and rising labor costs, rice production is shifting from transplanting to direct seeding. The area of direct-seeded rice in Guangdong Province has exceeded 100,000 hectares. 2 The rice industry is growing rapidly, gradually expanding from western Guangdong to other parts of the province. However, most of the rice varieties currently being promoted are transplanted, with a severe shortage of direct-seeded varieties. Although suitable direct-seeded varieties have been selected from transplanted varieties, their application has limitations. Directly using these varieties for direct seeding leads to unstable yields and annual yield reductions. Difficult seed germination and low seedling rates under flooded and low-oxygen conditions are significant factors affecting rice yield. Currently, few hypoxia-tolerant germination genes have been cloned, and superior genes are even rarer, limiting the development of the rice industry. Summary of the Invention
[0003] To overcome the aforementioned defects and shortcomings of existing technologies, this invention provides an application of the OsATS3 gene in regulating root growth, aboveground seedling length, first leaf growth rate, and seedling survival rate in rice seedlings under flooded conditions. This invention obtains homozygous plants with the OsATS3 gene knocked out through gene knockout. Compared to the wild type, seedlings from OsATS3 knockout seeds exhibit well-developed root systems, faster aboveground seedling length, faster first leaf emergence, and a higher seedling survival rate.
[0004] The first objective of this invention is the application of the OsATS3 gene in regulating rice waterlogging stress tolerance, wherein the OsATS3 gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID NO.2.
[0005] Preferably, the nucleotide sequence of the OsATS3 gene is shown in SEQ ID NO.1.
[0006] Preferably, the application is the use of knocking out the OsATS3 gene to promote root growth in rice seedlings under flooded conditions.
[0007] Preferably, the application is the use of knocking out the OsATS3 gene to promote the aboveground growth of rice seedlings under flooded conditions.
[0008] Preferably, the application is the use of knocking out the OsATS3 gene to accelerate the emergence of the first leaf in rice seedlings under flooded conditions.
[0009] Preferably, the application is the use of knocking out the OsATS3 gene to improve the rice seedling rate under flooded conditions.
[0010] Preferably, the OsATS3 gene knockout is performed using CRISPR / Cas9 technology, and the nucleotide sequence of the specific target site is shown in SEQ ID NO.3 or SEQ ID NO.4.
[0011] The second objective of this invention is to provide a method for obtaining improved rice that exhibits well-developed root systems, rapid aboveground growth, rapid emergence of the first leaf, and high seedling survival rate under flooded conditions, comprising the step of knocking out the OsATS3 gene; wherein the OsATS3 gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID NO.2.
[0012] Preferably, the nucleotide sequence of the OsATS3 gene is shown in SEQ ID NO.1.
[0013] Preferably, the OsATS3 gene knockout is performed by knocking out the OsATS3 gene using CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.4.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] The OsATS3 gene and its encoded protein of this invention can be used to regulate root development, aboveground seedling growth, first leaf development, and seedling survival rate in rice seedlings after germination under flooded conditions. OsATS3 gene knockout lines exhibit a phenotype characterized by well-developed seedling roots, faster aboveground seedling growth, quicker first leaf emergence, and higher seedling survival rate under flooded conditions. Therefore, this invention can provide genetic resources for solving problems such as slow seedling growth, inhibited radicle development, and low seedling survival rate in direct-seeded rice, as well as for breeding new rice varieties. This invention is of great significance for solving problems such as slow seedling growth, inhibited radicle development, and low seedling survival rate in direct-seeded rice and has broad application prospects in plant breeding. Attached Figure Description
[0016] Figure 1 This is a mutation type and sequencing peak diagram of OsATS3 gene knockout plants.
[0017] Figure 2 These are actual photos of WT, osats3-2, and osats3-3 rice seeds after germination for 4 days under 2cm water immersion conditions.
[0018] Figure 3 These are actual photos of WT, osats3-2, and osats3-3 rice seeds after 6 days of germination under 2cm water conditions.
[0019] Figure 4 This is a biostatistical analysis of root length and aboveground seedling length of WT, osats3-2, and osats3-3 rice seeds after 6 days of germination under 2cm water conditions.
[0020] Figure 5 These are actual images of WT, osats3-2, and osats3-3 rice seeds after 10 days of germination under 7cm water conditions. Among them, A shows the state of representative WT, osats3-2, and osats3-3 rice seeds after 10 days of germination under 7cm water conditions, and B shows the overall state of WT, osats3-2, and osats3-3 rice seeds after 10 days of germination under 7cm water conditions.
[0021] Figure 6 This is a statistical result of the seedling emergence rate of WT, osats3-2, and osats3-3 rice seeds after 10 days of germination under 7cm water conditions; *** indicates that there is a significant difference in seedling emergence rate between the OsATS3 gene knockout line and the WT line at the p<0.001 level. Detailed Implementation
[0022] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0023] OsATS3 is an embryo-specific protein 3, but it is also expressed in other tissues of rice. Its amino acid sequence contains PLAT (Polycystin-1, Lipoxygenase, Alpha-Toxin) DOMAIN, but its function remains unclear and has not been reported in the literature. The following examples demonstrate the use of gene knockout to obtain homozygous OsATS3 knockout plants. Compared to the wild type, OsATS3 knockout plants exhibited well-developed root systems, faster aboveground seedling growth, faster first leaf emergence, and a higher seedling survival rate during flooded germination treatment.
[0024] Example 1: Construction of OsATS3 gene knockout vector and obtaining rice gene knockout plants
[0025] Gene knockout plants were obtained by editing the OsATS3 gene in wild-type rice (Zhonghua 11) using the CRISPR / Cas9 genome editing system. The specific method is as follows.
[0026] The exon sequences of the target gene OsATS3 (whose CDS sequence is shown in SEQ ID NO.1, 543 bp in length, encoding a protein with an amino acid sequence of 180 amino acids as shown in SEQ ID NO.2) were analyzed using the CRISPR P v2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR). Two specific target sequences were selected: target 1: ACAATGTCCGCCGTCCGCGCCGG (SEQ ID NO.3); and target 2: GCGTACCGGAACGAGGCGTACGG (SEQ ID NO.4). Two expression cassettes linked to sgRNAs were obtained by overlap PCR: U6a-target 1-sgRNA and U3-target 2-sgRNA. Taking advantage of the non-overlapping cleavage and recognition sites of the BsaI enzyme, these two expression cassettes were ligated into the pYLCRISPR / Cas9Pubi-H vector to generate the pCRISPR-OsATS3 vector containing the OsATS3-specific target, which was then transformed into Agrobacterium EHA105 competent cells. After extracting plasmids from positive clones, they were sent to a company for sequencing. PCRISPR-OsATS3 plasmids with correct results were selected, and tissues with successfully knocked-out OsATS3 gene were screened by Agrobacterium infection of rice callus tissue, resulting in the regeneration of gene-edited plants.
[0027] 2. Obtaining homozygous OsATS3 gene knockout lines
[0028] Total genomic DNA was extracted from single T0 generation transgenic plants. Using this DNA as a template, primers flanking the specific target sites of the OsATS3 gene (07890-T12-F: GTGGGTGTTCGTTGCAGGAG, SEQ ID NO.5; 07890-T12-R: TAGAGGTAGCAGACGCCGTAC, SEQ ID NO.6) were used to amplify the nucleotide sequences containing target sites 1 and 2. The amplified products with a single, clear target band were recovered and sent to the company for sequencing. After sequencing, the sequencing results were decoded and analyzed using the DSDecodeM website (http: / / skl.scau.edu.cn / dsdecode / ). Two homozygous OsATS3 gene knockout lines, osats3-2 and osats3-3, with independent mutation sites were selected (sequencing results of the knockout lines are shown below). Figure 1 (As shown) to conduct subsequent experiments.
[0029] Example 2: Germination analysis of rice seeds from OsATS3 gene knockout lines in water at a depth of 2 cm
[0030] Seeds from wild-type rice plants WT, the OsATS3 gene knockout lines osats3-2 and osats3-3 were placed in transparent square germination boxes, with 200 mL of distilled water added to a depth of 2 cm. The boxes were incubated at 28°C with a light / dark cycle of 12 h / 12 h, and the water was changed every two days. Each germination box contained 30 rice seeds, and the process was repeated three times. Germination was observed periodically. After 4 days of germination under waterlogged conditions, the root length of the gene-edited lines was significantly longer than that of the wild-type plants. Figure 2 Six days after germination under flooded conditions, the first leaves of osats3-2 and osats3-3 had emerged, with average above-ground seedling lengths of 8.0 cm and 9.0 cm, respectively, and root lengths continued to elongate, averaging 6.4 cm and 6.7 cm, respectively. The wild type had not yet emerged its first leaf, and roots had just begun to sprout, with an average root length of 0.8 cm. Figure 3 ). Statistical data on root length and aboveground seedling length of osats3-2, osats3-3, and wild-type WT 6 days after germination under flooded conditions are as follows: Figure 4 As shown.
[0031] Example 3: Germination analysis of rice seeds from OsATS3 gene knockout lines in water at a depth of 7 cm
[0032] Seeds from wild-type rice plants WT and OsATS3 knockout lines osats3-2 and osats3-3 were placed in transparent culture bottles, with 280 mL of distilled water added to a depth of 7 cm. The bottles were incubated at 28°C with a light / dark cycle of 12 h / 12 h, and the distilled water was changed every two days. Each culture bottle contained 20 rice seeds, and the experiment was repeated three times. After 10 days of germination under submerged conditions, the seedling survival rate was calculated using the formula: Seedling survival rate = Number of seeds that germinated and formed normal seedlings / Total number of seeds. The results showed that after 10 days of germination under 7 cm submerged conditions, the leaf and root development of the OsATS3 knockout lines osats3-2 and osats3-3 was superior to that of the wild-type plant WT, while WT mostly produced deformed seedlings with abnormal root development. Figure 5 The survival rate of wild-type seedlings was only 48%, while the survival rates of osats3-2 and osats3-3 reached 92% and 90%, respectively. The survival rates of the OsATS3 gene knockout lines osats3-2 and osats3-3 were significantly higher than those of the wild-type. Figure 6 ).
Claims
1. Knockout OsATS3 The application of genes in improving rice's tolerance to waterlogging stress is characterized by, The aforementioned OsATS3 The gene is a gene that encodes a protein with an amino acid sequence as shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that, The aforementioned OsATS3 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
3. The application according to claim 1, characterized in that, To knock out OsATS3 Application of genes in promoting root growth of rice seedlings under flooded conditions.
4. The application according to claim 1, characterized in that, To knock out OsATS3 Application of genes in promoting aboveground growth of rice seedlings under flooded conditions.
5. The application according to claim 1, characterized in that, To knock out OsATS3 Application of genes to accelerate the growth of the first leaf in rice seedlings under flooded conditions.
6. The application according to claim 1, characterized in that, To knock out OsATS3 Application of genes in improving rice seedling survival rate under flooded conditions.
7. The application according to claim 3, characterized in that, The aforementioned knockout OsATS3 Genes are knocked out using CRISPR / Cas9 technology. OsATS3 The gene, whose specific target nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.
4.
8. A method for obtaining improved rice seedlings with well-developed root systems, rapid above-ground growth, fast emergence of the first leaf, and high seedling survival rate under flooded conditions, characterized in that, Includes knockout OsATS3 The steps of gene generation; the described OsATS3 The gene is a gene that encodes a protein with an amino acid sequence as shown in SEQ ID NO.
2.
9. The method according to claim 8, characterized in that, The aforementioned OsATS3 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
10. The method according to claim 8, characterized in that, The aforementioned knockout OsATS3 The gene was knocked out using CRISPR / Cas9 technology. OsATS3 The gene, whose specific target nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.4.
Citation Information
Patent Citations
Application of OsOPR13 gene in regulation and control of rice seed germination
CN116656700A
Application of rice OsMAPK7 gene in improving water logging resistance of rice
CN117625677A