Tobacco NtTIRd gene and its application

Abstract

This invention relates to the field of biotechnology, and more particularly to the tobacco NtTIRd gene and its applications. Experiments have shown that NtTIRd gene loss-of-function mutants exhibit increased resistance to quinclorac acid phytotoxicity, thereby eliminating or mitigating losses to tobacco production caused by phytotoxicity. Therefore, this invention is the first to reveal that the NtTIRd gene can be used to regulate plant resistance to quinclorac acid phytotoxicity, providing a new approach for obtaining superior tobacco plants through breeding.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the tobacco NtTIRd gene and its applications. Background Technology

[0002] Tobacco (scientific name: Nicotiana tabacum L.) is an annual herbaceous plant belonging to the genus Nicotiana in the family Solanaceae. It is an important economic crop, and its economic benefits are determined by the yield of its leaves.

[0003] Quinclorac is a herbicide widely used for barnyard grass control. However, its extensive use has caused phytotoxicity to tobacco plants. This phytotoxicity typically occurs during the rosette stage to the vigorous growth stage. Quinclorac stress leads to decreased tobacco yield and quality, affecting the industrial usability and safety of tobacco leaves. Current solutions primarily involve developing new herbicides that do not cause harm to tobacco or improving tobacco's resistance to quinclorac.

[0004] Improving tobacco resistance to quinclorac through genetic engineering is an effective method. Therefore, discovering tobacco resistance genes is of great significance in the field of tobacco breeding that provides resistance to quinclorac. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide the tobacco NtTIRd gene and its application.

[0006] This invention provides the application of tobacco TIRd as a target in plant breeding and / or in the preparation of products that aid in plant breeding;

[0007] The tobacco TIRd includes at least one of the amino acid sequences shown in a) to c) below:

[0008] a) An amino acid sequence as shown in SEQ ID NO:2; or

[0009] b) An amino acid sequence obtained by substituting, deleting, or adding one or more amino acids to the amino acid sequence described in (a), and which has the same function as the amino acid sequence described in (a); or

[0010] c) An amino acid sequence having at least 90% sequence identity with the amino acid sequence described in (a) or (b).

[0011] Furthermore, the plant breeding includes regulating plant resistance to quinclorac acid; the regulation includes increasing or decreasing it.

[0012] Furthermore, the plants include plants from the Brassicaceae, Asteraceae, Chenopodiaceae, Rutaceae, Moraceae, Fabaceae, and / or Solanaceae families; the Solanaceae plants include tobacco.

[0013] This invention provides plant breeding or assisted breeding products, comprising at least one of the following: A) to C:

[0014] A) Amplification primers, detection primers, and / or targeting primers using the nucleic acid encoding the tobacco TIRd as a template;

[0015] B) Interference fragments targeting the tobacco TIRd;

[0016] C) gRNA targeting the tobacco TIRd;

[0017] D) Expression cassettes containing interfering fragments as described in B), or gRNAs as described in C);

[0018] E) A recombinant vector containing the interfering fragment as described in B), or the gRNA as described in C), or the interfering fragment as described in D);

[0019] F) Transformation or transfection of host cells with the recombinant vector described in E);

[0020] G), a mixture obtained by culturing host cells as described in F).

[0021] Furthermore, in the product described in this invention, the target nucleotide sequence of the gRNA is shown in SEQ ID NO:5.

[0022] In this invention, the nucleic acid encoding tobacco TIRd includes at least one of the nucleic acids shown in i) to v) below:

[0023] i) Having a nucleotide sequence as shown in SEQ ID NO:2; or

[0024] ii) with at least one complementary nucleic acid molecule among the nucleic acid molecules shown in i); or

[0025] iii) Nucleic acid molecules that encode the same protein as those in i) or ii), but are different from those in i) or ii) due to the degeneracy of the genetic code; or

[0026] iv) Nucleic acid molecules obtained by substituting, deleting, or adding one or more bases to the nucleic acid molecules shown in i), ii), or iii), and having the same or similar function as the nucleic acid molecules shown in i), ii), or iii); or

[0027] A nucleic acid molecule that has at least 80% sequence identity with the nucleotide sequence described in v), i), ii), iii), or iv).

[0028] In this invention, the nucleic acid may be optimized or unoptimized, and this invention does not limit the optimization. The optimization includes, but is not limited to: codon usage bias, elimination of secondary structures that are unfavorable to expression (such as hairpin structures), alteration of GC content, CpG dinucleotide content, mRNA secondary structure, hidden splicing sites, early polyadenylation sites, internal ribosome entry and binding sites, negative CpG islands, RNA unstable regions, repetitive sequences (direct repeats, inverted repeats, etc.), and restriction sites that may affect cloning.

[0029] This invention also provides an expression cassette, also known as an expression unit, which refers to a DNA sequence from the start of a promoter to the end of a terminator. Regulatory fragments may also be included on either side of or between the promoter and terminator. These regulatory fragments may include promoters, enhancers, transcription termination signals, polyadenylation sequences, origins of replication, nucleic acid restriction sites, and homologous recombination sites operatively linked to the nucleic acid sequence, such as enhancers of promoters, poly(A) signals, etc.

[0030] The recombinant vectors described in this invention vary in type, function, and experimental objectives. In a specific embodiment of this invention, a cloning vector is used to amplify and analyze the NtTIRd gene sequence, and a CRISPR / Cas9 vector is used to achieve the deletion of NtTIRd gene function. In this invention, the CRISPR / Cas9 vector containing the gRNA inserts an A base between 62bp and 63bp of the NtTIRd gene, causing a frameshift mutation, resulting in gene function deletion.

[0031] This invention provides a kit comprising the product and excipients described herein.

[0032] Furthermore, the excipients are used to assist the product in functioning, maintain the activity of the product, or preserve the product, and the present invention does not limit this; in the present invention, the excipients include at least one of: DNA extraction reagent, culture medium, DNA reverse transcription reagent, antibiotic and / or buffer solution.

[0033] This invention provides the application of the product or kit described herein in plant breeding or assisted plant breeding.

[0034] This invention provides a method for plant breeding or assisted plant breeding, which includes plant breeding using the products or kits described in this invention.

[0035] Through experiments, this invention has found that NtTIRd gene loss-of-function mutants exhibit increased resistance to quinclorac acid phytotoxicity, thereby eliminating or mitigating the losses caused by phytotoxicity to tobacco production. Therefore, this invention is the first to reveal that the NtTIRd gene can be used to regulate plant resistance to quinclorac acid phytotoxicity, providing a new approach for tobacco breeding to obtain superior plants. Attached Figure Description

[0036] Figure 1 Electrophoresis diagram of the CDS amplification products of the NtTIRd gene;

[0037] Figure 2 Image showing CRISPR / Cas9 recombinant plasmid colony PCR detection;

[0038] Figure 3 A diagram showing the mutation types at target sites;

[0039] Figure 4 Leaf width analysis for mutants. Detailed Implementation

[0040] This invention provides the tobacco NtTIRd gene and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0041]

[0042] The amino acid sequence of the NtTIRd protein: (SEQ ID NO:2);

[0043] Biomaterials:

[0044] Tobacco variety: K326, a common cultivated tobacco variety. The seeds used were preserved by Hunan Tobacco Industry Co., Ltd. Growing conditions for tobacco: temperature (27±1)℃, relative humidity (60±5)%, light / dark cycle 16 h / 8 h.

[0045] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments:

[0046] Example 1: Obtaining the tobacco auxin receptor NtTIRd gene

[0047] (1) PCR amplification primer design

[0048] Based on the existing tobacco genome sequence, primers for PCR amplification of the CDS region of the NtTIRd gene were designed, and the sequences are as follows:

[0049] Upstream primer 21036f: 5'-cattcagatttcagaagaaacac-3' (SEQ ID NO:3);

[0050] Downstream primer 21036r: 5'-atttgtcttcacgatcgc-3' (SEQ ID NO:4);

[0051] (2) Preparation of PCR amplification template

[0052] Total RNA was extracted from K326 tobacco leaf material using the SuperPure Plant polyRNA Kit. TransScript was then used to analyze the RNA. ® The II Reverse Transcriptase kit reverse transcribes the extracted total RNA into cDNA. This cDNA is then used as a template for PCR amplification.

[0053] (3) PCR amplification

[0054] Referring to the instructions for the 2× TransTaq High Fidelity (HiFi) PCR SuperMix, the cDNA prepared in step (2) was used as a template, and PCR amplification was performed using the primers designed in step (1). The reaction system was added according to the instructions, and the PCR reaction was performed. The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 100 s, 30 cycles; 72℃ extension for 5 min.

[0055] The PCR amplification products were detected by 1% agarose gel electrophoresis. The electrophoresis results are as follows: Figure 1 As shown, there is a clear and single target band at around 1800 bp.

[0056] The target fragment was recovered via gel extraction and sent for sequencing. The sequencing results are shown in SEQ ID NO:1.

[0057] Example 2: Construction of gene editing vector

[0058] To obtain tobacco plants resistant to quinclorac, gene editing vectors were constructed using CRISPR / Cas9 technology and gene transformation was performed to obtain tobacco plants with the NtTIRd gene knocked out.

[0059] This embodiment provides a brief overview of the experimental procedures related to the construction of gene editing vectors:

[0060] (1) Design of primers for editing target sites

[0061] The following primer sequences were designed to target the NtTIRd gene target region (specific target sequence: tgtccttcagatctctccgg, SEQ ID NO:5):

[0062] TIRd-f: 5'-gattgatcccagcttgaaaaaaccg-3' (SEQ ID NO: 6);

[0063] TIRd-r: 5'-aaaccggttttttcaagctgggatc-3' (SEQ ID NO:7);

[0064] (2) Primer annealing and vector ligation

[0065] Referring to the Annealing Buffer for DNA Oligos (5×) kit instructions, double-stranded DNA at the target site was obtained by primer annealing. The annealing reaction system was as follows: Annealing Buffer for DNA Oligos (5×), 4 μL; forward and reverse primers (TIRd-f, TIRd-r), 4 μL each (50 μmol / μL); Nuclease-free water was added to a final volume of 20 μL. The reaction program was: 95℃ for 5 min, decreasing by 0.1℃ every 8 seconds until reaching 25℃.

[0066] The annealing product was ligated with the BsaⅠ-digested CRISPR / Cas9 vector, and CRISPR / Cas9 expression vectors for knocking out the NtTIRd gene were obtained by screening. The 20 μL ligation system was designed as follows: annealing product, 6 μL; digestion product (BsaⅠ-digested CRISPR / Cas9 vector), 3 μL; 10×T4 DNA Ligase Buffer, 2 μL; T4 DNA Ligase, 1 μL; sterile water was added to 20 μL, and ligation was carried out at 37℃ for 3 h.

[0067] The ligation product was transformed into DH5α *E. coli* competent cells for replication, followed by screening and colony PCR identification. For identification, primer pairs U26-jiance-F (5'-ttaggtttacccgccaata-3', SEQ ID NO:8) and TIRd-r were used to detect positive clones. Electrophoresis results are shown below. Figure 2As shown, all five clones exhibited specific target bands at approximately 500 bp, indicating they were all positive clones. Editing plasmids were extracted from the positive clones.

[0068] Example 3: Obtaining transgenic strains with NtTIRd gene knockout

[0069] The editing plasmid extracted in Example 2 was transformed into Agrobacterium and then into tobacco plants to construct transgenic plants with the NtTIRd gene knocked out. The specific experimental process is as follows.

[0070] (1) Transformation of Agrobacterium

[0071] Thaw competent Agrobacterium GV3101 cells on ice, add 6 μL of the editing vector prepared in Example 2, and mix gently. Place the mixture in a pre-chilled electroporation cuvette and incubate on ice for 5 min. Blot dry the cuvette with absorbent paper, then place it in the electroporation chamber for electroporation. Electroporation conditions: voltage 2.5 kV, capacitance 25 μF, resistance 200 Ω. After electroporation, quickly add 800 μL of YEB liquid medium preheated to 28°C and incubate at 28°C for 3 h with shaking at 220 rpm. Spread the bacterial culture evenly onto YEB solid medium containing rifampicin (100 μg / mL), streptomycin (50 μg / mL), and kanamycin (50 μg / mL), and incubate at 28°C until single colonies form. Pick single colonies, expand the culture, and perform PCR identification using U26-jiance-F and TIRa1-r primers. The correctly identified strain is the positive engineered bacteria.

[0072] (2) Transformation of tobacco plants

[0073] The prepared positive-positive engineered bacteria were cultured to OD200. 600 =0.6, centrifuge at 4000 rpm for 5 min to collect the bacterial cells, and then suspend the bacterial cells in 20 mL of MS liquid medium. Take leaves from K326 sterile seedlings that have grown for about one month and cut them into 0.5-1 cm pieces. 2 Square leaf discs were prepared. The leaf discs were then placed in the bacterial solution and immersed for 10 minutes. Excess bacterial solution around the leaf discs was blotted dry with sterile filter paper, and the discs were incubated in the dark for 3 days on MS medium supplemented with 6-BA (2 mg / L) and NAA (0.5 mg / L). The MS medium composition was: 4.4 g / L MS inorganic salts, 30 g / L sucrose, 2.5 g / L plant gel, pH 5.8–5.9.

[0074] Wash the leaf discs with sterile water containing Cef (400 mg / L) and absorb excess liquid with sterile filter paper. Transfer the leaf discs to MS solid selection medium containing 6-BA (2 mg / L), NAA (0.5 mg / L), Cef (200 mg / L) and Kan (50 mg / L) and incubate at 28°C under light.

[0075] When the adventitious buds grow to 0.5 cm, they are transferred to MS solid medium containing Cef (200 mg / L) and Kan (50 mg / L) to root.

[0076] After about a month of growth, the seedlings were transplanted into soil, and a small number of leaves were taken to extract genomic DNA. PCR was used to detect positive transgenic plants. The detection primers were U26-jiance-F and TIRd-r.

[0077] Based on the genome sequence, detection primers spanning the NtTIRd gene target site were designed to detect the mutation type at the target site. The specific primers are as follows:

[0078] Df: 5'-gtgaagagatgtctgaagatgagg-3' (SEQ ID NO:9);

[0079] Dr: 5'-gataccaagatttgctgacgag-3' (SEQ ID NO:10);

[0080] The PCR amplification products are sent for sequencing, and the mutation type is determined based on the sequencing results. Target site mutation types include... Figure 3 As shown, in the T0 generation plant D-8-5, a nucleotide deletion mutation was detected at the target site of the NtTIRd gene, inserting one base A (specifically, an A base is inserted between 62bp and 63bp in the nucleotide sequence shown in SEQ ID NO:1), causing a frameshift mutation in the NtTIRd protein, thereby inactivating the NtTIRd protein. No mutation was detected at the target site in the NtTIRd gene of the wild-type plant.

[0081] Example 4: Dichloroquinoline acid resistance test

[0082] To determine the resistance level of NtTIRd gene knockout mutants to quinclorac acid, the resistance of wild-type K326 and NtTIRd gene mutant D-8-5 to quinclorac acid was measured using leaf width as an indicator.

[0083] A pot experiment was conducted to determine the resistance of the mutant in Example 3 to quinclorac acid by treating it with dichloroquinoline carboxylic acid. Specifically, mutant D-8-5 and wild-type K326 were treated with 20 mL of dichloroquinoline acid solution per plant at the 5-leaf stage, with a final concentration of 0.2 mg / kg. Leaf width was measured after 30 days of treatment. The top three leaves were measured. Untreated K326 (treated with the same volume of water) served as a control. Data were statistically analyzed, and the results are as follows: Figure 4 As shown. Under conditions of dichloroquinoline phytotoxicity, compared to the control K326, the width of the upper three leaves of D-8-5 increased by 48.0%, 35.7%, and 32.1%, respectively, indicating that D-8-5 exhibited significant resistance. Figure 4 In the study, K326 served as the control, untreated with quinoline carboxylic acid; K326Q was treated with quinoline carboxylic acid; D-8-5 was untreated with quinoline carboxylic acid; and D-8-5Q was treated with quinoline carboxylic acid. The percentages 71.0% and 16.0% represent the decrease in leaf width of the first leaf (K326 and D-8-5) before and after quinoline carboxylic acid treatment, respectively; 79.50% and 40.8% represent the decrease in leaf width of the second leaf (K326 and D-8-5) before and after quinoline carboxylic acid treatment, respectively; and 81.6% and 48.8% represent the decrease in leaf width of the third leaf (K326 and D-8-5) before and after quinoline carboxylic acid treatment, respectively.

[0084] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of tobacco TIRd as a target in improving tobacco resistance to dichloroquinolinic acid; The amino acid sequence of the tobacco TIRd is shown in SEQ ID NO:2; The improvement of tobacco's resistance to dichloroquinoline acid is achieved by gRNA knockout; The target nucleotide sequence of the gRNA is shown in SEQ ID NO:5.

Images