Application of AIE fluorescent molecule in real-time fluorescent quantitative PCR or high-resolution melting curve analysis

Abstract

The invention discloses an application of an AIE fluorescent molecule in real-time fluorescent quantitative PCR (polymerase chain reaction) or high-resolution melting curve analysis. The AIE fluorescent molecule is selected from any one of structures shown in a formula (1) and a formula (2). The AIE fluorescent molecule is used for real-time fluorescent quantitative PCR and high-resolution melting curve analysis, has the advantages of high sensitivity, high inhibitor resistance, high resolution, multiple compatibility and the like, and is an ideal dye used for genetic typing and pathogen multiple detection through a high-resolution melting curve. The defects that the existing nucleic acid dye is poor in sensitivity and poor in anti-inhibitor capacity and is poor in effect or cannot detect when being applied to a low-concentration template sample and a complex sample are effectively overcome, and particularly the problems that the existing dye cannot provide specific information of each sequence and the like are solved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to an application of an AIE fluorescent molecule in real-time fluorescence quantitative PCR or high-resolution melting curve analysis. Background Art

[0002] Real-time fluorescence quantitative PCR (qPCR) and high-resolution melting curve analysis (HRM) are advanced technologies that can be used for nucleic acid quantification, mutation detection, and genotyping analysis. The application of real-time fluorescence quantitative PCR continues to expand, and many different systems have been developed, including probe-based methods such as Taqman probes, molecular beacons, and scorpion primers. Although the probe method has high specificity, it is expensive, is limited by instrument channels during multiplex detection, and may have a high background due to fluorescence leakage. Another method is to use DNA intercalating dyes to bind to double-stranded DNA. Compared with the unbound state, the dye has higher fluorescence after binding to double-stranded DNA. Subsequently, the melting curve of the qPCR amplification product is analyzed to obtain an indication of specific amplification. The dye method is simple and fast to operate, has high throughput, high sensitivity, low cost, and accurate results. It is not limited by the position and type of mutant bases. No sequence-specific probes are required. The high-resolution melting can be directly run after the qPCR is completed to complete the analysis of the sample, realizing a true closed-tube operation.

[0003] At present, the most commonly used fluorescent dye is SYBR Green I. Due to its low cost, high efficiency, universal detection of amplified DNA, and the ability to distinguish qPCR products through melting curve analysis, it has become the most widely used DNA dye for real-time fluorescence quantitative PCR. However, it is a non-saturated dye. SYBR Green I cannot block all minor groove positions of dsDNA, and is far from saturating the minor grooves in the DNA double helix structure. In this way, when the DNA double helix is ​​gradually denatured at high temperature, some fluorescent dye molecules will randomly bind to the vacant minor groove positions of the double-stranded DNA that has not yet been melted, and the dye molecules will rearrange, causing confusion in the fluorescent signal and decreased specificity, which cannot accurately reflect the dsDNA melting process. In addition, it inhibits PCR in a concentration-dependent manner, affects the melting temperature of DNA, and preferentially binds to GC sequences when binding to DNA. These shortcomings limit the analysis of multiple PCR based on HRM using SYBR Green I.

[0004] EvaGreen is a new generation of saturation dyes suitable for both real-time fluorescence quantitative PCR and HRM analysis. This dye selectively binds to double-stranded DNA through a new mechanism called "release on demand" and can saturate the double-stranded minor groove of the PCR reaction product. This mechanism ensures low PCR inhibition and eliminates the defect of "dye redistribution", allowing EvaGreen to be used for both nucleic acid quantification and high-resolution melting curve analysis (HRM) of multiple qPCR products. However, when conducting real-time fluorescence quantitative PCR detection, low template concentrations and complex sample materials (containing many PCR inhibitors) will make PCR amplification more difficult. These inhibitors can affect or quench the fluorescence of the fluorescent substances used. In addition, DNA sequences with high GC content are widely present in the genome. They are particularly prone to forming secondary structures that interfere with PCR, increase the difficulty of amplification, and are prone to non-specific amplification. Therefore, the amplification of high GC templates is also a very important factor. When used for HRM analysis of multiple qPCR products, there must be sufficient resolution for amplicons with Tm values ​​that differ by less than 2°C (determined by length and GC content). Existing saturated dyes, including EvaGreen, still have their own drawbacks in dealing with the above problems. In summary, there are three main problems with the existing technology:

[0005] The first problem is that the existing saturation dyes have poor ability to resist PCR inhibitors and are not effective when applied to the detection of complex sample materials;

[0006] The second problem is that when performing HRM detection of multiplex qPCR products, the existing saturation dyes prefer to amplify low GC regions, resulting in an imbalance in the proportion of PCR products. In addition, when performing multiplex detection, amplicons with Tm values ​​around 90°C cannot be amplified, and at most only five-plex amplification can be performed.

[0007] The third problem is that HRM detects and analyzes DNA sequence variations, including various mutations (such as substitution / insertion / deletion / repetition, etc., which can affect the expression of related genes, thereby changing the physiological and biochemical activities of cells, and ultimately leading to huge differences at the individual level). However, the existing saturated dyes are not sufficient to distinguish amplicons with Tm values ​​less than 2°C, and it is difficult to genotype converted homozygous mutants; therefore, there is still a great market demand for dyes that are compatible with high sensitivity, strong inhibitor resistance, multiple compatibility, and high resolution. Summary of the invention

[0008] In order to solve the above technical problems, the present invention provides an application of an AIE fluorescent molecule in real-time fluorescence quantitative PCR or high-resolution melting curve analysis.

[0009] The technical solution of the present invention is as follows:

[0010] The present invention provides an application of an AIE fluorescent molecule in real-time fluorescence quantitative PCR or high-resolution melting curve analysis, wherein the AIE fluorescent molecule is selected from any one of the structures of formula (1) and formula (2);

[0011]

[0012] In formula (1), R1 and R2 are each independently selected from one of the following structures:

[0013]

[0014] R3 is selected from one of the following structures:

[0015]

[0016] R4 - 、R7 - Each is independently an anion;

[0017] R8, R 13 , R 14 Each is independently selected from one of the following structures:

[0018] R5, R6, R9, R 10 , R 11 , R 12 Each is independently selected from one of -H, -NH2, -COOH, -CN, -CHO, -OH, -CH3; n1 and n2 are integers greater than or equal to 1;

[0019] Wherein, * indicates the substitution position;

[0020] In formula (2), Q1, Q2, Q3, and Q4 are each independently selected from one of the following structures:

[0021]

[0022] Q 10 - Each is independently an anion;

[0023] Q5, Q6, Q7, Q8, Q9, Q 11 Each is independently selected from one of -H, -COOH, -CN, -CHO, -OH, -CH3;

[0024] n3 is an integer greater than or equal to 1.

[0025] Preferably, in formula (1), R1 and R2 have the same structure; in formula (2), Q1 and Q4 have the same structure, or Q2 and Q3 have the same structure. Preferably, the AIE fluorescent molecule is selected from any one of the following structures:

[0026]

[0027] Preferably, the AIE fluorescent molecule is selected from any one of the following structures:

[0028]

[0029]

[0030] Further preferably, the R9, R 10 , R 12 , Q5, Q6 are each independently selected from one of -H, -COOH, -CN, and -CHO. Further preferably, the AIE fluorescent molecule is selected from any one of the following structures:

[0031]

[0032]

[0033] Preferably, the n1 is an integer of 1-4 (1, 2, 3, 4); the n2 is an integer of 1-4 (1, 2, 3, 4); and the n3 is an integer of 1-4 (1, 2, 3, 4).

[0034] Further preferably, n1 is 2 or 3; n2 is 2 or 3; n3 is 1 or 2;

[0035] Preferably, the anion is selected from F - , Cl - Br - ,I - 、NO2 - 、NO3 - PF6 - CF3SO3 - 、ClO4 - One or more of .

[0036] Preferably, the AIE fluorescent molecule is selected from any one of the structures of Chemical Formula I to Chemical Formula IV;

[0037]

[0038]

[0039] Preferably, the AIE fluorescent molecule of the present invention is used as a nucleic acid dye in real-time fluorescence quantitative PCR or high-resolution melting curve analysis.

[0040] Preferably, the working concentration of the AIE fluorescent molecule is 1-5 (1, 2, 3, 4, 5) μM.

[0041] Preferably, the real-time fluorescence quantitative PCR is used for nucleic acid quantification; the high-resolution melting curve is used for genotyping, gene mutation detection or multiple pathogen detection.

[0042] More preferably, the target nucleic acid concentration of the nucleic acid quantification is 5.6 to 5.6×10 6 copies; the samples to be tested for nucleic acid quantification are purified samples, crude lysed samples and untreated samples; the number of multiplex detection of pathogens is 1 to 7 (1, 2, 3, 4, 5, 6, 7). Compared with existing dyes, the AIE fluorescent molecule detection sample of the present invention has a wider applicability, which can include purified samples, crude lysed samples and unpurified blood samples; in terms of multiplex detection, its detection is 1-2 times more than that of existing dyes; and its detection limit can be as low as a single copy; at the same time, single base mutations can be clearly distinguished in terms of genotyping.

[0043] The present invention also provides an AIE saturated fluorescent dye for real-time fluorescence quantitative PCR or high-resolution melting curve analysis, comprising the above-mentioned AIE fluorescent molecule and a solvent. The solvent comprises at least one of dimethyl sulfoxide, dimethylformamide, dimethylacetamide, water, and methanol.

[0044] The present invention provides a method for real-time fluorescence quantitative PCR amplification based on the above-mentioned AIE fluorescent molecule, comprising the following steps:

[0045] (1) constructing a qPCR reaction system, including: a sample to be tested, a forward primer and a reverse primer complementary to a template to be tested in the sample to be tested, an AIE fluorescent dye (containing an AIE fluorescent molecule) and a corresponding PCR buffer;

[0046] (2) performing qPCR amplification on the template in the reaction system to form a double-stranded DNA-AIE saturated fluorescent dye complex;

[0047] (3) After each qPCR amplification, the fluorescence value is detected by an instrument, and the Ct value of the qPCR reaction system and the amount of amplified products are analyzed to determine the amount of the template to be tested in the sample to be tested.

[0048] Preferably, the real-time fluorescence quantitative PCR amplification primers designed for detecting the rtxA gene based on the above-mentioned AIE fluorescent molecule include the following:

[0049] rtxA Plasmid:

[0050] GGTGCCGCGAACAGCATCAGTTCACGCGTTGAGACAGGTAACATCACCTTCCGTGGCGCAGGTGCG

[0051] GATAACCATTTAGTCCGTAAAGGCAAAGTGGGCGATATTACTCTGCAAGGTGCTGGGGCTTCAAACC

[0052] GCATTGAGCGGACACATCAGGCCGAAGATGTCTACACGGCAAACCCGCGGCAATAT

[0053] Forward primer VCF: CACGCGTTGAGACAGGTAACATCAC

[0054] Reverse Primer VCR: CAGCACCTTGCAGAGTAATATCGCC

[0055] The target gene fragment size is 99 bp.

[0056] Preferably, the real-time fluorescence quantitative PCR amplification system is: PCR master mix buffer 1×, AIE fluorescent molecule 1-5 μM, upstream and downstream primers 200 nM-400 nM each, and an appropriate amount of template.

[0057] Preferably, the reaction procedure of the qPCR reaction system in step (1) comprises the following steps:

[0058] Stage 1: pre-denaturation at 95°C for 5 min;

[0059] Stage 2: denaturation at 95°C for 15 seconds;

[0060] The third stage: annealing at 58°C and extension at 72°C for 45s, followed by fluorescence data collection;

[0061] Repeat the second and third stages for a total of 40 cycles.

[0062] The present invention provides a method for high-resolution melting curve analysis based on the above-mentioned AIE fluorescent molecule, comprising the following steps:

[0063] (1) constructing a qPCR reaction system, including: a sample to be tested, a forward primer and a reverse primer complementary to a template to be tested in the sample to be tested, an AIE fluorescent dye (containing an AIE fluorescent molecule) and a corresponding PCR buffer;

[0064] (2) performing qPCR amplification on the template in the reaction system to form a double-stranded DNA-AIE saturated fluorescent dye complex;

[0065] (3) After the qPCR amplification is completed, the melting curve information of the amplified product is collected, and the Tm value of each gene in the qPCR reaction system is detected to determine whether the sample to be tested can distinguish the template to be tested.

[0066] Preferably, the real-time fluorescent PCR amplification primers based on the above-mentioned AIE fluorescent molecules and the plasmids thereof designed for detecting each gene are referred to in the examples.

[0067] Preferably, the real-time fluorescence quantitative PCR amplification system is: PCR master mix buffer 1×, AIE fluorescent molecule 1-5 μM, upstream and downstream primers 200 nM-400 nM each, and an appropriate amount of template.

[0068] Preferably, the procedure of the qPCR reaction system in step (1) comprises the following steps:

[0069] Stage 1: pre-denaturation at 95°C for 5 min;

[0070] Stage 2: denaturation at 95°C for 15 seconds;

[0071] The third stage: annealing at 58°C and extension at 72°C for 45s;

[0072] Repeat the second and third stages for a total of 40 cycles.

[0073] The fourth stage: the melting curve information of the amplified product was collected, which was to react at 95°C for 15s, at 60°C for 1min, and then to 95°C at a rate of 0.025°C / s for 1s, and the fluorescence signal was collected.

[0074] Preferably, the templates to be tested include various genomic DNAs, plasmids of various different genes, wild-type and mutant templates.

[0075] Preferably, the test samples include human blood samples and throat swab samples.

[0076] Compared with the prior art, the present invention has the following beneficial effects:

[0077] The AIE fluorescent molecule of the present invention is used as a nucleic acid dye in the application of real-time fluorescence quantitative PCR or high-resolution melting curve analysis. Compared with existing products, it can not only maintain high sensitivity for purified samples, but also, due to its strong anti-inhibitor ability, it can also perform direct amplification on blood samples and maintain high sensitivity; and because there is no migration between the dyes (which can be judged by the Tm value), when detecting DNA sequence variations, including various mutations (such as substitution / insertion / deletion / duplication, etc.), its accuracy can be guaranteed, and it can also be compatible with HRM analysis of multiple PCR amplification products. And because it can amplify high GC templates, therefore, in actual applications, it will not prefer low GC region amplification, which will lead to an imbalance in the proportion of PCR products. At present, HRM analysis of up to 7 target amplification products can be performed. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 It is a sensitivity standard curve diagram of AIE fluorescent molecules of formula I, formula II, formula III, formula IV and SYBR Green, EvaGreen, SYTO 9 and LCGreen.

[0079] Figure 2 It is the sensitivity standard curve diagram of AIE fluorescent molecules of formula VI and formula VII.

[0080] Figure 3 It is a multiple melting curve diagram of AIE fluorescent molecules of formula I, formula II, formula III, formula IV and SYBR Green, EvaGreen, SYTO 9 and LCGreen.

[0081] Figure 4 It is the multiple melting curve diagram of AIE fluorescent molecules of formula VI and formula VIII.

[0082] Figure 5 It is the genotyping diagram of AIE fluorescent molecules of formula I, formula II, formula III and EvaGreen, SYTO 9 and LC Green.

[0083] Figure 6 These are the anti-inhibitor diagrams of AIE fluorescent molecules of formula I, formula II, formula III and SYBR Green, EvaGreen, SYTO 9 and LC Green. DETAILED DESCRIPTION

[0084] The technical solutions in the embodiments of the present invention are described clearly and specifically below in conjunction with the accompanying drawings of the present invention, but the implementation and protection scope of the present invention are not limited to the following embodiments. The experimental methods in the following embodiments without specifying specific conditions are usually carried out under conventional conditions, such as those recommended by the manufacturer.

[0085] There are many methods for qPCR reaction procedures, such as two-step method and three-step method. The conventional two-step method is denaturation at 95°C, annealing and extension at 60°C; the three-step method is denaturation at 95°C, annealing at 58°C and extension at 72°C. The specific method to be used needs to be selected in combination with the primer annealing temperature, the characteristics of the enzyme, and the specific implementation plan. The length of the sample detected by the method of the present invention is generally not more than 500bp, and is generally selected to be 100-300bp, and the best is 100-200bp.

[0086] The SYBR Green fluorescent dye (model S917731) used in the implementation of the present invention was purchased from Macklin; EvaGreen fluorescent dye (model 31000-T) was purchased from Biotium; LC Green fluorescent dye (model BCHM-ASY-0005) was purchased from Idaho; SYTO 9 fluorescent dye (model BS34854) was purchased from Thermo Fisher Scientific; Taq DNA polymerase (model A131) was purchased from Beijing Kangrun Chengye Biotechnology Co., Ltd.; PCR mix (model Q513) was purchased from Novozyme; magnesium ions and dNTP solutions were purchased from Sangon Biotechnology Co., Ltd.; forward primers, reverse primers, and gene synthesis were synthesized by Shanghai Diying Biotechnology Co., Ltd. The nucleic acid saturated fluorescent dye contained in the system of the present invention can solve the problems of complex system amplification, nonspecific amplification, low sensitivity, etc., and provides a new method of fluorescence quantitative PCR and high-resolution melting curve analysis.

[0087] The structures of the AIE fluorescent molecules used in the examples are as follows:

[0088]

[0089]

[0090] The structures of the comparative AIE fluorescent molecules of chemical formula V, chemical formula VI, formula VII, and formula VIII used in the examples are as follows:

[0091]

[0092] Embodiment 1:

[0093] Application of the AIE fluorescent molecules of the present invention

[0094] (I) Preparation of the AIE fluorescent dye of the present invention

[0095] Weigh 5.5 mg of formula Ⅰ AIE fluorescent molecule solid, add 1 mL of biological grade anhydrous DMSO, fully dissolve to obtain an initial solution dye with a concentration of 10 mM, and then dilute it with biological grade anhydrous DMSO to 100 μM as the mother solution concentration. When used, dilute to 1-3 μM as the working concentration, for example, adding 0.25 μL of dye mother solution to 25 μL amplification system is 1 μM working concentration; based on this, prepare formula II, formula III, formula IV, formula V, formula VI, formula VII, and formula VIII into dye mother solutions with a concentration of 100 μM.

[0096] (II) The specific experimental method of applying the AIE fluorescent molecule of the present invention to the sensitivity test in qPCR amplification is as follows:

[0097] 1. Construct rtxA plasmid as the template to be tested;

[0098] rtxA Plasmid:

[0099] GGTGCCGCGAACAGCATCAGTTCACGCGTTGAGACAGGTAACATCACCTTCCGTGGCGCAGGTGCG

[0100] GATAACCATTTAGTCCGTAAAGGCAAAGTGGGCGATATTACTCTGCAAGGTGCTGGGGCTTCAAACC

[0101] GCATTGAGCGGACACATCAGGCCGAAGATGTCTACACGGCAAACCCGCGGCAATAT

[0102] 2. Design forward primers and reverse primers that are complementary to the template to be tested in the sample to be tested;

[0103] Forward primer VCF: CACGCGTTGAGACAGGTAACATCAC

[0104] Reverse Primer VCR: CAGCACCTTGCAGAGTAATATCGCC

[0105] 3. Construct a qPCR reaction system: Add the substances required for the reaction to the system, including different concentrations of the test template, forward primer and reverse primer, AIE fluorescent dye, hot start DNA polymerase and corresponding buffer (2×PCR mastermix). The final system is 20 μL. At the same time, when performing the above sample operations, select commercial dyes (EvaGreen, LC Green, SYTO 9, SYBR Green) to replace AIE fluorescent molecular dyes for the same experiment and analysis.

[0106] The qPCR reaction system was established. The total reaction system was 20 μL. Refer to the table below to add each reagent.

[0107] Table 1 PCR reaction system

[0108]

[0109] 4. After the qPCR reaction system is prepared, place it in the PCR instrument and set the corresponding program for reaction; the qPCR reaction program is:

[0110] A three-step qPCR reaction procedure was used.

[0111] Stage 1: pre-denaturation at 95°C for 5 min;

[0112] Stage 2: denaturation at 95°C for 15 seconds;

[0113] The third stage: annealing at 58 °C for 15 s and extension at 72 °C for 45 s, followed by fluorescence data collection;

[0114] Repeat the second and third stages for a total of 40 cycles;

[0115] 5. After qPCR amplification is completed, the data is automatically analyzed and processed by the instrument analysis module; the results are as follows Figure 1 and Figure 2 As shown, the concentration of the template to be tested in the figure is 5.6×10 6 , 5.6×10 5 , 5.6×10 4 , 5.6×10 3 , 5.6×10 2 , 5.6×10 1 , 5.6×10 0 ; The concentrations of commercial dyes are all optimal working concentrations.

[0116] Results: From Figure 1 and Figure 2 It can be seen that:

[0117] from Figure 1It can be seen that: compared with commercial dyes (EvaGreen, LC Green, SYTO 9, SYBRGreen), the sensitivity of the AIE fluorescent molecule of the present invention can be as low as 5.6 copies, which is consistent with LC Green, and the other commercial dyes can only reach 56 copies; the sensitivity of formula I is 5.6 copies, formula II is also 5.6 copies, formula III is 56 copies, and formula IV is 560 copies; the corresponding r values ​​are: formula I is 0.992; formula II is 0.993; formula III is 0.996; formula IV is 0.992; EvaGreen is 0.991; LC Green is 0.972; SYTO 9 is 0.992; SYBR Green is 0.995;

[0118] from Figure 2 It can be seen that among the AIE fluorescent molecules in the control group, Formula V has no amplification, the sensitivity of Formula VI can only reach 560 copies, the sensitivity of Formula VII can also reach 5.6 copies, and Formula VIII shows no amplification; the corresponding r values ​​are: Formula VI is 0.983; Formula VII is 0.988;

[0119] (III) The specific experimental method of applying the AIE fluorescent molecule of the present invention to multiple tests in high-resolution dissolution curve analysis is as follows:

[0120] 1. Six groups of plasmids were constructed, namely XZ plasmid, LZ plasmid, AF2 plasmid, rtxA plasmid, 3a plasmid, and ProGRP plasmid. At the same time, λDNA genome was added to the system for sevenfold amplification detection;

[0121] 2. Design primers for the above seven targets respectively. The key point in primer design is that the Tm values ​​of their melting curves can be distinguished from each other; the targets and their primers are:

[0122] Adenovirus plasmid (XZ plasmid):

[0123] gcaataacaatggcaatattagcaccaattcttggcataatcttcttgtgcttcatggaagactctaattatgtgagccagatacgtggtcttattgctacagcagtattaatt

[0124] gctggtgggcacgcctgtttgacactcacaggcacaaccacgtcattatttgttgtcatactaacttgtaggttcatacgtatggcaacagt

[0125] XZ forward primer: GGCAATATTAGCACCAATTC

[0126] XZ reverse primer: AGTCTTCCATGAAGCACAA

[0127] Rotavirus plasmid (LZ plasmid):

[0128] aaatgaatcgtcttctacaacgtcaactctttctggaaaatctattggtaggagtgaacagtacatttcaccggatgcagaggcattcaataagtacatgttgtcgaagtct

[0129] ccagaggatattggaccatctgattctgcttcaaacgatccactcaccagcttttcgattagatcgaatgcagttaagacaaatgcagacgctggc

[0130] LZ forward primer: GCAGAGGCATTCAATAAGTA

[0131] LZ reverse primer: GAATCAGATGGTCCAATATCC

[0132] AF2 Plasmid:

[0133] AAGGTCAGAGAACTAGATATTGGGGAAGAGTTCTGGGATACATGTGCAGAAGCTGCAAGTTTGT TACACAGGTATACATGTGCTGTGGTGGTTTGCTGCA

[0134] AF2 forward primer: AAGGTCAGAGAACTAGATATT

[0135] AF2 reverse primer: TGCAGCAACACCACAGCA

[0136] rtxA Plasmid:

[0137] GGTGCCGCGAACAGCATCAGTTCACGCGTTGAGACAGGTAACATCACCTTCCGTGGCGCAGGTGCG

[0138] GATAACCATTTAGTCCGTAAAGGCAAAGTGGGCGATATTACTCTGCAAGGTGCTGGGGCTTCAAACC

[0139] GCATTGAGCGGACACATCAGGCCGAAGATGTCTACACGGCAAACCCGCGGCAATAT

[0140] rtxA forward primer VCF: CACGCGTTGAGACAGGTAACATCAC

[0141] rtxA reverse primer VCR: CAGCACCTTGCAGAGTAATATCGCC

[0142] 3a plasmid:

[0143] ATTCTTGGGAAAATTCAGATGATAGCCGTAATAAATTGTCGAAAATACCTTCAACACCCAAATTAATAC

[0144] CAAAAGTTACCAAAACTGCAGACAAGCATAAAGATGTCATCATCAACCAAGTGTACCGCCGGAAGCA

[0145] CCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGTCCCGCAC

[0146] CTCGACCATCATGACCGACTACAAC

[0147] 3a forward primer: GCAGACAAGCATAAAGATGT

[0148] 3a Reverse primer: TGTAGTCGGTCATGATGGT

[0149] ProGRP Plasmid:

[0150] TATTCCGGATTATTCATACCGTCCCACCATCGGGCGCGGATCCGCCACCATGCTGCTGGTCAACCAGTCCCACCAGGGCTTCAACAAGGAGCACACCAGCAAGATGGTCAGCGCTATTGTGCTGTACGTGCTGCTGGCCGCCGCCGCTCACTCCGCCTTCGCTCATCACCACCACCACCATAGCACTGGTGAGAGCAGCAGCGTGAGCGAGCGTGGCTCCCTGAAGCAGCAGCTGCGCGAGTACATCCG TTGGGAGGAGGCCGCTCGTAACCTGCTGGGTCTGATCGAGGCCAAGGAGAACCGCAACCACCAGCCCCCTCAGCCTAAGGCTCTGGGTAACCAGCAGCCTAGCTGGGACAGCGAGGACTCCTCCAACTTCAAGGACTGGTCCCACCCCCAGTTCGAAAAGTAAAAGCTTGTCGAGAAGTACTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGProGRP forward primer: TATTCCGGATTATTCATACC

[0151] ProGRP reverse primer: CCTCTACAAATGTGGTATGG

[0152] λDNA genome (purchased from Takara)

[0153] λDNA forward primer: AACGTCTCTTCAGGCCACTG

[0154] λDNA reverse primer: TGCTTATAACGCCGCATTGC

[0155] 3. Construct qPCR reaction system: prepare several groups of plasmid templates with the same template amount (5.6×10 5), and after exploring the primer concentrations, the above primers were found to have the best primer concentrations corresponding to each of them, which were 80nM-150nM (different targets corresponded to different concentrations in multiple detection, the primer concentration of XZ plasmid was 80nM, the primer concentration of LZ plasmid was 80nM, the primer concentration of AF2 plasmid was 150nM, the primer concentration of rtxA plasmid was 80nM, the primer concentration of 3a plasmid was 150nM, the primer concentration of ProGRP plasmid was 80nM, and the primer concentration of λDNA was 150nM), together with PCR master mix and corresponding commercial dyes, or AIE fluorescent dyes of the experimental group or control group were added to the same system, and real-time fluorescence quantitative PCR reaction and high-resolution melting curve analysis were performed.

[0156] The qPCR reaction system was established. The total reaction system was 20 μL. Refer to the table below to add each reagent.

[0157] Table 2 qPCR reaction system

[0158]

[0159] 4.qPCR reaction and high-resolution melting curve analysis

[0160] A three-step qPCR reaction procedure was used.

[0161] Stage 1: pre-denaturation at 95°C for 5 min;

[0162] Stage 2: denaturation at 95°C for 15 seconds;

[0163] The third stage: annealing at 58 °C for 15 s and extension at 72 °C for 45 s;

[0164] Repeat the second and third stages for a total of 40 cycles;

[0165] The fourth stage: automatic collection of melting curve information of amplification products. The program is designed to react at 95°C for 15 seconds, at 60°C for 1 minute, and then rise to 95°C at a rate of 0.025°C / s for 1 second, and collect fluorescence signals.

[0166] 5. After completion, the data is analyzed and processed through the analysis module;

[0167] The results are as follows Figure 3 and Figure 4 shown. Figure 3The experimental group AIE fluorescence formula I showed that there were 7 obvious peaks (which could be judged by the number of peaks), and the positions of the single melting peaks could correspond (the corresponding Tm value data were shown in Table 3), indicating that formula I could perform seven-fold amplification; formula II and formula III had six peaks, indicating that one plasmid was not amplified (single-fold detectable, multiple-fold undetectable), and six-fold detection could be achieved; the corresponding formula IV showed that only five-fold amplification could be performed; the commercial dyes EvaGreen, LC Green, and SYTO 9 could only perform five-fold amplification; SYBR Green could not perform multiplex amplification (results not shown). Figure 4 It shows that among the dye molecules in the control group, Formula VI can only perform double amplification, Formula VII can only perform quadruple amplification; Formula V and VIII showed no amplification curve in Example 1, so no multiplex test was performed. It shows that both Formula I and Formula II can amplify 1-2 times more than the commercial dyes.

[0168] Table 3

[0169]

[0170]

[0171] (IV) The specific experimental method of applying the AIE fluorescent molecule of the present invention to genotyping test in high-resolution melting curve analysis is as follows:

[0172] 1. To determine the ability to compare the genotyping assays of each dye pair under optimal conditions, the ThermoFisher MeltDoctor HRM positive control kit (containing allele A DNA (20×), allele G DNA (20×), allele A / G DNA (20×), and primer mix (20×)) was purchased for testing.

[0173] 2. The qPCR reaction system and the concentrations of primers and templates were all based on the conditions recommended by the manufacturer. The concentrations of each commercial dye were also based on the conditions recommended by the manufacturer. The AIE fluorescent molecules in the experimental group were all used at a concentration of 3 μM.

[0174] The AIE fluorescent molecules (Formula I, Formula II, Formula III) were tested for genotyping, and commercial dyes (EvaGreen, LC Green, SYTO 9) were used for comparison. The results are as follows Figure 5 shown. Figure 5It shows that the AIE fluorescent molecules of the experimental group, Formula I and Formula II, can both clearly distinguish allele A DNA and allele G DNA, with Formula I having a better distinction effect; Formula III cannot distinguish; the commercial dyes LC Green and SYTO 9 have the same distinction effects as Formula I and Formula II; the effect of the commercial dye EvaGreen is relatively poor; this shows that the fluorescent molecules of Formula I and Formula II can be fully used in genotyping research and have good results.

[0175] (V) The specific experimental method of applying the AIE fluorescent molecule of the present invention to the test of the ability to resist inhibitors in qPCR amplification is as follows:

[0176] 1. Crude samples without nucleic acid extraction and purification were used as templates. Crude samples contained hemoglobin, anticoagulants, immunoglobulins, humic acid and other substances that have inhibitory effects on qPCR. In addition, the qPCR reaction system contained surfactants that promoted sample lysis, which would also have a certain degree of inhibitory effect on qPCR. In order to verify the ability of each dye molecule to resist these substances, purified throat swab samples, throat swab samples that were only crudely extracted, and samples without any extraction were selected for blood direct amplification.

[0177] 2. Design forward primers and reverse primers complementary to the fragment to be tested (CFTR gene) in the human genome;

[0178] CFTR forward primer: ACTTGAGTGCTGTAGGGGAG

[0179] CFTR reverse primer: GACTTCATGGGGTCGAGTTG

[0180] 3. Prepare samples processed in different ways at the same time: 1) samples extracted and purified from human throat swabs using a nucleic acid extraction kit (product model: MNFSH-030); 2) samples that were initially lysed from human throat swabs (crudely extracted throat swab samples); 3) and blood samples that were not processed in any way;

[0181] 4. Construct a qPCR reaction system: Add the substances required for the reaction to the system, including samples treated in different ways, forward primers and reverse primers, the AIE fluorescent dye of the present invention, Taq enzyme-GoTaq Hot Start Polymerase (Promega) and corresponding PCR buffer, MgCl2, dNTPs, and the final system is 25 μL; refer to the table below to add each reagent.

[0182] Table 4 qPCR reaction system

[0183]

[0184] 5. After the qPCR reaction system is prepared, place it in the PCR instrument and set the corresponding program for reaction;

[0185] A three-step qPCR reaction procedure was used.

[0186] Stage 1: pre-denaturation at 95°C for 5 min;

[0187] Stage 2: denaturation at 95°C for 15 seconds;

[0188] The third stage: annealing at 60 °C for 15 s and extension at 72 °C for 45 s, followed by fluorescence data collection;

[0189] Repeat the second and third stages for a total of 40 cycles;

[0190] 6. After qPCR amplification is completed, the data is analyzed and processed through the analysis module;

[0191] The AIE fluorescent molecules (Formula I, Formula II, Formula III) were tested for their ability to resist inhibitors. At the same time, commercial dyes (EvaGreen, LC Green, SYTO 9, SYBR Green) were used to replace the AIE fluorescent dye molecules for the same experimental analysis for comparison. The results are as follows: Figure 6 As shown;

[0192] from Figure 6 It can be seen that the ΔCt of the AIE fluorescent molecules of the experimental group, Formula I and Formula II, in the detection of crude extraction samples is very small compared with that of the purified samples, while the ΔCt values ​​of the commercial dyes are all relatively large. The smaller the difference (ΔCt) between the crude extraction samples and the purified samples, the stronger the ability to resist inhibitors; this shows that Formula I and Formula II have strong ability to resist inhibitors, while the commercial dyes LC Green, EvaGreen, SYBR Green, and SYTO 9 are relatively poor; further analysis of the blood direct amplification samples showed that the Ct values ​​of Formula I and Formula II, as well as the SYBRGreen molecule were equivalent, the Ct value of the SYTO 9 molecule increased significantly, and EvaGreen and LC Green had no amplification at all; this shows that Formula I and Formula II, as well as the SYBR Green molecule can realize direct amplification of blood samples and have strong ability to resist inhibitors; while the ability of SYTO 9 to resist inhibitors is poor; EvaGreen and LC Green cannot be used for direct amplification of blood samples at all; the ΔCt of Formula III is equivalent to that of SYBR Green and smaller than that of SYTO 9, and can be used for direct amplification detection of blood samples.

Claims

1. An application of an AIE fluorescent molecule in real-time fluorescence quantitative PCR or high-resolution melting curve analysis, characterized in that: The AIE fluorescent molecule is selected from any one of the structures of formula (1) and formula (2); In formula (1), R1 and R2 are each independently selected from one of the following structures: R3 is selected from one of the following structures: R4 - 、R7 - Each is independently an anion; R8, R 13 , R 14 Each is independently selected from one of the following structures: R5, R6, R9, R 10 , R 11 , R 12 Each is independently selected from one of -H, -NH2, -COOH, -CN, -CHO, -OH, -CH3; n1 and n2 are integers greater than or equal to 1; Wherein, * indicates the substitution position; In formula (2), Q1, Q2, Q3, and Q4 are each independently selected from one of the following structures: Q 10 - Each is independently an anion; Q5, Q6, Q7, Q8, Q9, Q 11 Each is independently selected from one of -H, -COOH, -CN, -CHO, -OH, -CH3; n3 is an integer greater than or equal to 1.

2. The use according to claim 1, characterized in that: In formula (1), R1 and R2 have the same structure; in formula (2), Q1 and Q4 have the same structure, or Q2 and Q3 have the same structure.

3. The use according to claim 1, characterized in that: The AIE fluorescent molecule is selected from any one of the following structures:

4. The use according to claim 1, characterized in that: The AIE fluorescent molecule is selected from any one of the following structures:

5. The use according to claim 4, characterized in that: R9, R 10 , R 12 , Q5, and Q6 are each independently selected from one of -H, -COOH, -CN, and -CHO.

6. The use according to claim 4, characterized in that: The AIE fluorescent molecule is selected from any one of the following structures:

7. The use according to claim 1, characterized in that: The n1, n2, and n3 are integers of 1-4.

8. The use according to claim 1, characterized in that: The anion is selected from F - , Cl - Br - ,I - 、NO2 - 、NO3 - PF6 - CF3SO3 - 、ClO4 - One or more of .

9. The use according to claim 1, characterized in that: The AIE fluorescent molecule is used as a nucleic acid dye; The real-time fluorescence quantitative PCR is used for nucleic acid quantification; the high-resolution melting curve analysis is used for genotyping, gene mutation detection or pathogen multiplex detection.

10. The use according to claim 9, characterized in that: The target nucleic acid concentration of the nucleic acid quantification is 5.6 to 5.6×10 6 copies; the samples to be tested for nucleic acid quantification are purified samples, crude lysate samples and untreated samples; the number of multiplex detection of pathogens is 1 to 7.

Images