Application of Detection Reagent for Genes Related to Cashmere Goat Hair Follicle Development

By providing detection reagents for genes related to wool follicles development, including lncRNA MSTRG.20890.1, chi-miR-24-3p and ADAMTS3, the problem of ineffective regulation of hair follicle development in the prior art is solved, and specific regulation and detection of hair follicle development is achieved.

CN119220697BActive Publication Date: 2025-06-27INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411512321.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-28
Publication Date
2025-06-27
Estimated Expiration
2044-10-28

AI Technical Summary

Technical Problem

The existing lncRNAs involved in hair follicle development cannot respond to specific regulatory effects, resulting in the unknown relationship between detection reagents related to genes of wool follicles development and hair follicle development.

Method used

Detection reagents for genes related to wool follicles development are provided, including lncRNA MSTRG.20890.1, chi-miR-24-3p and ADAMTS3. Through the detection and regulation of these genes, they can be used to detect hair follicle development and prepare hair follicle development promoters.

Benefits of technology

By analyzing the gene expression profiles of different embryo stages of velvet goats, it was found that lncRNA MSTRG.20890.1 was significantly differentially expressed during secondary hair follicle morphogenesis, and it was proved that it regulates the proliferation and migration of dermal fibroblasts by competitively binding to chi-miR-24-3p with ADAMTS3, thereby inhibiting the formation of dermal papillary structure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119220697B_ABST
    Figure CN119220697B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of genetic engineering technology, and specifically relates to the application of detection reagents for genes related to the hair follicle development of cashmere goats. The genes related to the hair follicle development of cashmere goats are any one or more of lncRNA MSTRG.20890.1, chi-miR-24-3p, and ADAMTS3. The lncRNA MSTRG.20890.1 competitively binds to the chi-miR-24-3p with the ADAMTS3. The present invention discovers that lncRNA MSTRG.20890.1 is significantly differentially expressed during the morphogenesis of secondary hair follicles in cashmere goats. At the same time, it is proved that lncRNA MSTRG.20890.1 regulates the proliferation and migration of dermal fibroblasts by competitively binding to chi-miR-24-3p with ADAMTS3, thereby inhibiting the formation of dermal papilla structures.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of a detection reagent for genes related to hair follicle development in cashmere goats. Background Art

[0002] Cashmere goats are excellent livestock breeds formed through long-term natural selection and artificial breeding. Inner Mongolia cashmere goats are characterized by strong adaptability, tolerance to roughage, strong disease resistance, and strong physique. The cashmere produced by Inner Mongolia cashmere goats has a soft touch and good luster, and is known as "soft gold" and "fiber gemstone", with high economic value. The hair follicles of cashmere goats can be divided into primary hair follicles that grow wool and secondary hair follicles that grow cashmere. Cashmere is one of the important textile raw materials in the textile industry. The process of hair follicle development begins in the embryonic period and is completed after birth. At 45 days of embryonic development in cashmere goats, the fetal skin forms a complete epidermal structure, and the formation of hair follicles has not yet started. At about 55 days of embryonic development, primary hair follicles begin to form, and the keratinocytes in the basal layer of the epidermis are arranged in a palisade shape to form the hair bud structure of the primary hair follicle. At about 65 days of embryonic development, the hair bud structure of the primary hair follicle grows downward into the dermis of the skin. At about 75 days of embryonic development, the morphology of secondary hair follicles begins to occur.

[0003] Long non-coding RNA, abbreviated as lncRNA, is a non-coding RNA with a transcription length exceeding 200 nucleotides and lacking protein-coding ability. Non-coding RNA is abbreviated as ncRNA. lncRNA is mainly transcribed by RNA polymerase II, so it has a structure similar to that of mRNA. It usually has a 7mC cap structure at the 5' end and a poly-A tail structure at the 3' end in some cases. Different from mRNA, lncRNA has unique transcription, processing, and modification patterns. Recent studies have shown that although lncRNA does not have the function of encoding proteins, it indirectly regulates the expression of protein-coding genes in aspects such as epigenetic regulation, transcriptional regulation, and post-transcriptional regulation. Existing lncRNAs involved in hair follicle development cannot reflect specific regulatory effects, so the relationship between the detection reagent for genes related to hair follicle development in cashmere goats and hair follicle development is unknown. Summary of the Invention

[0004] To solve the above problems, the present invention provides the application of a detection reagent for genes related to hair follicle development in cashmere goats.

[0005] The application of a detection reagent for genes related to hair follicle development in cashmere goats in the preparation of a detection kit for hair follicle development, wherein the genes related to hair follicle development in cashmere goats are any one or more of lncRNA MSTRG.20890.1, chi-miR-24-3p, and ADAMTS3, and the lncRNA MSTRG.20890.1 competitively binds to the chi-miR-24-3p with the ADAMTS3, as Figure 9 shown;

[0006] The nucleotide sequence of lncRNA MSTRG.20890.1 is as follows Figures 10 - 12 shown, as shown in SEQ ID NO.45;

[0007] The nucleotide sequence of chi-miR-24-3p is UGGCUCAGUUCAGCAGGAAC, denoted as SEQ ID NO.46;

[0008] The nucleotide sequence of ADAMTS3 is as follows Figures 13 - 14 shown, as shown in SEQ ID NO.47.

[0009] Preferably, when the related gene is lncRNA MSTRG.20890.1, the detection reagent is the sequence shown in SEQ ID NO.24-25.

[0010] Preferably, when the related gene is chi-miR-24-3p, the detection reagent is the sequence shown in SEQ ID NO.26-28.

[0011] Preferably, when the related gene is ADAMTS3, the detection reagent is the sequence shown in SEQ ID NO.29-30.

[0012] Use of a reagent for inhibiting the expression of the lncRNA MSTRG.20890.1 in the preparation of a hair follicle development promoter.

[0013] Preferably, the reagent for inhibiting the expression of lncRNA MSTRG.20890.1 is the sequence shown in SEQ ID NO.1-2, the sequence shown in SEQ ID NO.3-4, or the sequence shown in SEQ ID NO.5-6.

[0014] Use of a reagent for promoting the expression of the chi-miR-24-3p in the preparation of a hair follicle development promoter.

[0015] Preferably, the reagent for promoting the expression of chi-miR-24-3p is the sequence shown in SEQ ID NO.22.

[0016] Use of a reagent for inhibiting the expression of the ADAMTS3 in the preparation of a hair follicle development promoter.

[0017] Preferably, the reagent for inhibiting the expression of ADAMTS3 is the sequence shown in SEQ ID NO.13-14, the sequence shown in SEQ ID NO.15-16, or the sequence shown in SEQ ID NO.17-18.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] In the present invention, by analyzing the gene expression profiles of different embryonic stages of cashmere goats, it is found that lncRNA MSTRG.20890.1 located in the cytoplasm is significantly differentially expressed during the morphogenesis of secondary hair follicles in cashmere goats. At the same time, it is demonstrated that lncRNA MSTRG.20890.1 regulates the proliferation and migration of dermal fibroblasts by competitively binding to chi-miR-24-3p with ADAMTS3, thereby inhibiting the formation of dermal papilla structures. Thus, detection reagents for lncRNA MSTRG.20890.1, chi-miR-24-3p, and / or ADAMTS3 can be used to detect hair follicle development and prepare promoters for hair follicle development. Description of the Drawings

[0020] Figure 1 For the functional analysis of lncRNA MSTRG.20890.1 in dermal fibroblasts, A is the screening of lncRNA MSTRG.20890.1 related to the morphogenesis of secondary hair follicles, B is the expression of lncRNA in different treatment groups, C is the detection of apoptosis of dermal fibroblasts after interfering with lncRNA MSTRG.20890.1, where (1) is NC, (2) is sh-NC, (3) is MSTRG.20890.1-sh, (4) is the statistical situation, D is the detection of the proliferation of lncRNA MSTRG.20890.1-sh cell line using EDU, where (1) is the proliferation diagram, (2) is the statistical situation, E is the detection of the proliferation of lncRNA MSTRG.20890.1-sh cell line using CCK8, F is the expression of lncRNA MSTRG.20890.1 in skin tissues at different embryonic stages, G is the screening of the interfering vector of lncRNA MSTRG.20890.1, H is the detection of the migration of lncRNA MSTRG.20890.1-sh cell line using the cell scratch assay, where (1) is the migration diagram, (2) is the statistical situation, I is the detection of the cell cycle of lncRNA MSTRG.20890.1-sh cell line using DNA staining, where (1) is NC, (2) is sh-NC, (3) is MSTRG.20890.1-sh, (4) is the statistical situation.

[0021] Figure 2LncRNA MSTRG.20890.1 can target and bind to chi-miR-24-3p. A shows the detection of the expression of lncRNA MSTRG.20890.1 in the nucleus and cytoplasm of dermal fibroblasts. B shows the prediction of the distribution of lncRNA MSTRG.20890.1 in cells by the lncLocator software. C shows the schematic diagram of the construction of wild-type / mutant lncRNA MSTRG.20890.1 luciferase reporter vectors. D shows the sequence of the binding site between lncRNA MSTRG.20890.1 and chi-miR-24-3p predicted by the RNAhybrid v2.1.2 software. E shows the relative expression of chi-miR-24-3p after transfecting dermal fibroblasts with lncRNA MSTRG.20890.1-sh. F shows the detection of the target binding between lncRNA MSTRG.20890.1 and chi-miR-24-3p by the dual-luciferase reporter gene system.

[0022] Figure 3 Chi-miR-24-3p can reverse the effect of lncRNA MSTRG.20890.1 on the phenotype of dermal fibroblasts. A shows the detection of the cell cycle of the lncRNA MSTRG.20890.1-sh cell line after adding the chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is lncRNA MSTRG.20890.1-sh, (3) is lncRNA MSTRG.20890.1-sh + chi-miR-24-3p inhibitor, and (4) is the statistical result. B shows the detection of the migration of the lncRNA MSTRG.20890.1-sh cell line after adding the chi-miR-24-3p inhibitor, where (1) is the migration map and (2) is the statistical result. C shows the detection of cell proliferation after adding the chi-miR-24-3p inhibitor to the lncRNA MSTRG.20890.1-sh cell line, where (1) is the proliferation map and (2) is the statistical result. D shows the detection of apoptosis of the lncRNA MSTRG.20890.1-sh cell line after adding the chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is lncRNA MSTRG.20890.1-sh, (3) is lncRNA MSTRG.20890.1-sh + chi-miR-24-3p inhibitor, and (4) is the statistical result. E shows the detection of the expression of cell proliferation / apoptosis marker genes by qRT-PCR. F shows the detection of the expression of lncRNA MSTRG.20890.1 in the chi-miR-24-3p interference / overexpression cell line.

[0023] Figure 4 For the prediction and analysis of chi-miR-24-3p target genes, A is for constructing the chi-miR-24-3p-mRNA regulatory network, B is a schematic diagram for constructing the wild-type / mutant ADAMTS3-3'UTR luciferase reporter vector, C is for detecting the expression of ADAMTS3 in chi-miR-24-3p-interfered / overexpressed dermal fibroblast cell lines, and D is for detecting the target binding of chi-miR-24-3p and ADAMTS3-3'UTR by the dual-luciferase reporter gene system.

[0024] Figure 5 For the GO enrichment analysis of chi-miR-24-3p target genes.

[0025] Figure 6 For the KEGG enrichment analysis of chi-miR-24-3p target genes.

[0026] Figure 7 For the functional analysis of ADAMTS3 in dermal fibroblasts, A is for screening the ADAMTS3 interference vector, B is for detecting the apoptosis of dermal fibroblasts after ADAMTS3 interference, where (1) is NC, (2) is sh-NC, (3) is ADAMTS3-sh, and (4) is the statistical situation, C is for detecting the migration of the ADAMTS3-sh cell line by the cell scratch assay, where (1) is the migration map and (2) is the statistical situation, D is for detecting the proliferation of the ADAMTS3-sh cell line using EDU, where (1) is the migration map and (2) is the statistical situation, and E is for detecting the cell cycle of the ADAMTS3-sh cell line using DNA staining, where (1) is NC, (2) is sh-NC, (3) is ADAMTS3-sh, and (4) is the statistical situation.

[0027] Figure 8To determine whether Chi-miR-24-3p can reverse the effect of ADAMTS3 on the phenotype of dermal fibroblasts, A shows the apoptosis detection of the ADAMTS3-sh cell line after adding the chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is ADAMTS3-sh, (3) is ADAMTS3-sh + chi-miR-24-3p inhibitor, and (4) is the statistical result; B shows the migration detection of the ADAMTS3-sh cell line after adding the chi-miR-24-3p inhibitor, where (1) is the migration graph and (2) is the statistical result; C shows the cell cycle detection of the ADAMTS3-sh cell line after adding the chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is ADAMTS3-sh, (3) is ADAMTS3-sh + chi-miR-24-3p inhibitor, and (4) is the statistical result; D shows the proliferation detection of the ADAMTS3-sh cell line after adding the chi-miR-24-3p inhibitor, where (1) is the migration graph and (2) is the statistical result; E shows the detection of the expression of cell proliferation / apoptosis marker genes by qRT-PCR.

[0028] Figure 9 It is a schematic diagram of the lncRNA MSTRG.20890.1 / chi-miR-24-3p / ADAMTS3 regulatory mechanism.

[0029] Figure 10 It is the fragment from the 1st bp to the 2744th bp in the lncRNA MSTRG.20890.1 sequence of the present invention.

[0030] Figure 11 It is the fragment from the 2745th bp to the 7013th bp in the lncRNA MSTRG.20890.1 sequence of the present invention.

[0031] Figure 12 It is the fragment from the 7014th bp to the 11217th bp in the lncRNA MSTRG.20890.1 sequence of the invention.

[0032] The lncRNA MSTRG.20890.1 sequence described is Figures 10 - 12 formed by connecting the sequences in

[0033] Figure 13 It is the fragment from the 1st bp to the 4259th bp in the ADAMTS3 sequence of the present invention.

[0034] Figure 14 It is the fragment from the 4260th bp to the 5842nd bp in the ADAMTS3 sequence of the present invention.

[0035] The ADAMTS3 sequence described above is Figures 13 - 14 sequentially concatenated by the sequences in

[0036] Note: NC represents the blank control, and sh-NC represents the negative control. Specific Embodiments

[0037] The specific embodiments of the present invention will be described in detail below. However, it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0038] Examples

[0039] Twelve 3-year-old Inner Mongolia cashmere goat ewes with the same feeding conditions were selected and divided into 4 groups. The ewes were mated and the mating time was recorded. According to the mating records, the ewes were subjected to cesarean section, and the fetal skin tissues at 45, 55, 65, and 75 days of embryonic development were collected and stored in liquid nitrogen.

[0040] 1. Screening and Identification of Key lncRNAs in Secondary Hair Follicle Morphogenesis

[0041] In previous studies, transcriptome sequencing was performed on 12 lateral skin tissues at four different embryonic stages of Inner Mongolia cashmere goats, and the lncRNA expression profiles in the skin tissues at four different embryonic stages were obtained. The four different embryonic stages were: 45 days denoted as d45, 55 days denoted as d55, 65 days denoted as d65, and 75 days denoted as d75.

[0042] First, the total RNA of the samples was extracted using Trizol reagent. The detection of all 12 samples met the sequencing standards, and the sequencing standards were: 1.8 < OD260 / OD280 < 2.4, 1.5 < OD260 / OD230 < 2.4, 7 ≤ Rin < 10. Subsequently, paired-end sequencing was performed using IlluminaHiseq 4000 to obtain the raw data. The data was aligned with the reference genome using Bowtie and Hisat2 tools, the reads were assembled and transcribed using Stringtie, and CPC and CNCI were used to predict the coding ability of the RNA. Finally, RNAs with a transcript length greater than 200bp, a CPC score ≤ 0.5, and a CNCI score ≤ 0 were regarded as lncRNAs for subsequent studies.

[0043] Screening of differentially expressed lncRNAs related to secondary hair follicle morphogenesis based on embryonic hair follicle development characteristics. The three comparison groups of d55vsd45, d65vsd45, and d65vsd55 were used as stage A related to primary hair follicle development, and the three comparison groups of d75vsd45, d75vsd55, and d75vsd65 were used as stage B related to primary and secondary hair follicle development. The common part of stage B and stage A was removed from stage B, that is, the intersecting part was removed from stage B, and the remaining part was used as important lncRNAs related to secondary hair follicle morphogenesis and development. The screening criteria for differentially expressed lncRNAs were based on FPKM values, and edge software was used for differential expression analysis. The screening conditions were |log2(Foldchange)|≥1 and P≤0.05.

[0044] 2. Cell culture

[0045] Dermal fibroblasts were cultured in Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12 complete medium containing 10% fetal bovine serum, 100 μg / ml penicillin, and 100 μg / ml streptomycin. All cell lines were cultured in an incubator at 37°C with 5% carbon dioxide.

[0046] 3. Construction of interference / overexpression cell lines

[0047] The lncRNA MSTRG.20890.1 interference plasmid, ADAMTS3 interference plasmid, and chi-miR-24-3p interference / overexpression plasmid were prepared by Shanghai Hanheng Biotechnology Co., Ltd. Lentiviral transfection was performed according to the manufacturer's instructions. Cells were cultured in basal medium containing the optimal concentration of polybrene for 4 hours, then the medium was changed and lentivirus was added for transfection. After transfection, puromycin was added for resistance screening. Finally, qRT-PCR was used to detect whether each cell line was successfully constructed.

[0048] Construction process of lncRNA MSTRG.20890.1 interference vector: According to the sequence information of lncRNA MSTRG.20890.1, the target fragment was amplified and purified by PCR method and PAGE purification method. Finally, 3 pairs of shRNAs of lncRNA MSTRG.20890.1 were obtained, which were named lncRNA MSTRG.20890.1-sh1, lncRNA MSTRG.20890.1-sh2, and lncRNA MSTRG.20890.1-sh3 respectively. The shRNA sequence information is shown in Table 1.

[0049] Table 1 shRNA sequence information of lncRNA MSTRG.20890.1

[0050]

[0051] The lncRNA MSTRG.20890.1-sh1, lncRNA MSTRG.20890.1-sh2, and lncRNA MSTRG.20890.1-sh3 fragments were respectively ligated to the pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector (purchased from Hanheng Biotechnology (Shanghai) Co., Ltd.) using the T4 ligation method to complete the construction of the lncRNA MSTRG.20890.1 interference plasmid.

[0052] Subsequently, the constructed interference plasmid was mixed with the transformed competent DH5α, the bacterial solution was spread on plates and cultured in an incubator for 16 h; single colonies were selected for colony verification, and positive clones were verified by sequencing; if the sequencing results were consistent with the target sequence, plasmid extraction and purification were performed. Among them, the lncRNA MSTRG.20890.1-shRNA synthesized by PCR amplification was a hairpin structure, which could be cleaved in cells to form siRNA, and the siRNA bound to the RNA-induced silencing complex (RISC), thereby inhibiting the expression of the lncRNA MSTRG.20890.1 gene. The siRNA sequence information of lncRNA MSTRG.20890.1 is shown in Table 2.

[0053] Table 2 siRNA sequence information of lncRNA MSTRG.20890.1

[0054]

[0055] The construction process of the ADAMTS3 interference vector was the same as that of the lncRNA MSTRG.20890.1 interference vector, and lncRNA MSTRG.20890.1 was simply changed to ADAMTS3. The shRNA sequence information of ADAMTS3 is shown in Table 1, and the siRNA sequence information of ADAMTS3 is shown in Table 2.

[0056] Table 3 shRNA sequence information of ADAMTS3

[0057]

[0058] Table 4 siRNA sequence information of ADAMTS3

[0059] Gene Name Sequence Sequence Number ADAMTS3 - siRNA1 CAAACACCACTGGTTGCCATATGAA SEQ ID NO.19 ADAMTS3 - siRNA2 CAGTAAATCCAATGGTGCTAACTTA SEQ ID NO.20 ADAMTS3 - siRNA3 TCTCCGGTGCCTGGGAATATATGA SEQ ID NO.21

[0060] Construction process of the chi-miR-24-3p interference / overexpression vector:

[0061] According to the chi-miR-24-3p sequence information, the target fragment was amplified by PCR method. Finally, the interference sequence of chi-miR-24-3p and the overexpression sequence of chi-miR-24-3p were obtained respectively, and they were named chi-miR-24-3p inhibitor and chi-miR-24-3p mimic respectively. The sequence information is as follows:

[0062] chi-miR-24-3p mimic: GAAGTCAAGCAAGACTATGTCAGCGGTAGATGATGTGTGAGTAGAGCTGGGCGCTTTCAAAGGAGACGTCCTCTTGTGATTTCCGAGCACGGTGAACTCTCTCTTGTATTTGCAGTCCAGGTCTGTGTCTTCTGCAGCGCCAGTGGAACGAGGCCGAGCGAGCTCCCAGCCGAGGCGCTGCTTCTCCGGGCTGTCAGTTGGACCCGCCCTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAGTTCAGCAGGAACAGGAGTCGAGCCCTAGAGCAAAGCCTTCCTGTTTGTAAGTGCCCAGAGGCCTGGGAGCTGAGACTGCAGCTGCGTGAGGACCGGCCTGAGCGCCCGCAGCACAGCTGACCGGCAGCGGTGGTGGCCCCTCTGTATGTGTCCTGTGTGTGGGTGTCGGTACAGTCAGAGTTCTGTTGATACAAGAGAAATGAGCTTCCACCCGAAAAGGC, denoted as SEQ ID NO.22;

[0063] chi-miR-24-3p inhibitor: GTTCCTGCTTCCTGAGCCATATACGTTCCTGCTTCCTGAGCCAACATCGTTCCTGCTTCCTGAGCCATCTTCAGTTCCTGCTTCCTGAGCCA, denoted as SEQ ID NO.23.

[0064] The chi-miR-24-3p inhibitor and chi-miR-24-3p mimic fragments were respectively ligated to the pHBLV-CMV-ZsGreen-T2A-Puro vector (purchased from Hanheng Biotechnology (Shanghai) Co., Ltd.) using the HB infusionTM one-step cloning and ligation system to complete the construction of the lncRNA MSTRG.20890.1 interference plasmid. Subsequently, the constructed interference plasmid was mixed with the transformed competent DH5a, the bacterial solution was spread on plates and cultured in an incubator for 16 h; single colonies were selected for colony verification, and positive clones were verified by sequencing; if the sequencing results were consistent with the target sequence, plasmid extraction and purification were carried out.

[0065] 4. Real-time fluorescence quantitative PCR

[0066] Total RNA was extracted from cells using Trizol reagent (Invitrogen) according to the manufacturer's instructions. Genomic DNA in the total RNA was removed using gDNA Eraser, and the treated RNA was reverse-transcribed. lncRNA and mRNA were reverse-transcribed into cDNA using the Primer ScriptTM reagent kit (Takara, China), and qRT-PCR was performed using TB Premix ExTaq TM II (Takara, China). For miRNA qRT-PCR, RNA was reverse-transcribed into cDNA, and qRT-PCR was performed using the Bulge Loop miRNA qRT-PCR Starter Kit (RiboBio, China). The expression levels of lncRNA, mRNA, and miRNA were all calculated using the 2 -ΔΔCT method.

[0067] 5. Nucleocytoplasmic separation experiment

[0068] The subcellular localization of lncRNA MSTRG.20890.1 in the cytoplasm, nucleus, ribosome, etc. was predicted using lncLocator. At the same time, according to the manufacturer's instructions, the cytoplasmic RNA and nuclear RNA of dermal fibroblasts were extracted and purified using the Cytoplasmic&Nuclear RNA Purification Kit (Norgen Biotek), and their expression in different cell locations was detected using qRT-PCR.

[0069] 6. Dual luciferase

[0070] Use Targetscan and miRanda software to predict the miRNAs targeted by lncRNAs and the mRNAs targeted by miRNAs, and preliminarily construct an lncRNA-miRNA-mRNA regulatory network. Subsequently, based on the prediction results, select the chi-miR-24-3p / ADAMTS3 signaling axis as a candidate target for lncRNA MSTRG.20890.1. Use the dual-luciferase reporter gene system to detect the targeting relationships between lncRNA MSTRG.20890.1 and chi-miR-24-3p, and between chi-miR-24-3p and ADAMTS3, respectively. Use the LipoFiter transfection reagent to co-transfect chi-miR-24-3p mimic with psiCHECK2-MSTRG.20890.1-WT / MUT and psiCHECK2-ADAMTS3-WT / MUT (the vectors were synthesized by Hanheng, China). After 48 hours of transfection, use the dual-luciferase reporter assay system (Promega, Wisconsin) to detect the luciferase level and normalize the Renilla luciferase activity.

[0071] 7. CCK8

[0072] Measure the cell proliferation ability using the Cell Counting Kit-8 (CCK-8) (Solarbio, China) according to the manufacturer's instructions. Measure the optical density at a wavelength of 450 nm using an enzyme-linked immunosorbent assay reader.

[0073] 8. EdU assay

[0074] The EdU assay was performed based on the instructions of the BeyoClick TM EdU-555 Cell Proliferation Detection Kit (Beyotime, China). After culturing dermal fibroblasts in a 24-well plate for 24 h, incubate with 1× EDU working solution for 2 h, fix with 4% paraformaldehyde for 15 min, incubate with 0.3% Triton X-100 for 15 min, and stain with 1× Hoechst for 15 min. Count in three random fields per well under an inverted fluorescence microscope. The proliferation rate of cells in each group was the ratio of EdU-labeled proliferating cells to Hoechst-labeled cells.

[0075] 9. Cell apoptosis detection

[0076] According to the manufacturer's instructions, the Annexin V-APC / PI Apoptosis Detection Kit (Elabscience Biotechnology, China) was used to measure cell apoptosis. A single-cell suspension was prepared, and 100 μl of 1x Annexin V Binding Buffer, 2.5 μl of Annexin V-APC Reagent, and 2.5 μl of PI Reagent were added in sequence. The cells were resuspended and incubated in the dark at room temperature for 20 min. Finally, 400 μl of 1x Annexin V Binding Buffer was added, and cell apoptosis was detected using a flow cytometer (apoptotic cells = (early apoptotic cells + late apoptotic cells) / total cells).

[0077] 10. DNA staining

[0078] According to the manufacturer's instructions, the cell cycle was measured by DNA content quantification method (Solarbio, China). Cells were collected and 70% pre-cooled ethanol was added. The cells were resuspended and placed in a refrigerator at 4°C for fixation. After 24 h, the fixing solution was removed; 100 μl of RNase A solution was added to the cell pellet and incubated in a water bath at 37°C for 30 minutes. Subsequently, 400 μl of propidium iodide (PI) staining solution was added and mixed well, and incubated in the dark at 4°C for 30 minutes. The red fluorescence at an excitation wavelength of 488 nm was detected using a flow cytometer.

[0079] 11. Cell scratch assay

[0080] The cell scratch assay was performed by scratching the cell monolayer with a sterile 200 μl pipette tip, and the scratched area was photographed using a microscope. After scratching, the cells were washed three times with PBS and fresh serum-free medium was replaced. The cells were cultured in an incubator at 37°C and 5% CO2. Images were collected at 0 h and 24 h after scratching. Cell migration rate = [(blank area at 0 h - blank area at 24 h) * 100 / blank area at 0 h].

[0081] Table 5 Detection of the sequence information of each gene

[0082]

[0083]

[0084] Results

[0085] 1. Screening of important lncRNAs for secondary hair follicle morphogenesis

[0086] Based on the transcriptome database of the skin of Inner Mongolia cashmere goats at 45, 55, 65, and 75 days constructed previously. |log2foldchange|≥1 and P value < 0.05 were used as the screening criteria for differential expression analysis. A total of 1209 differentially expressed lncRNAs were identified. Among them, there were 157 differentially expressed lncRNAs in the d45vsd55 comparison group, 802 differentially expressed lncRNAs in the d45vsd65 comparison group, 670 differentially expressed lncRNAs in the d45vsd75 comparison group, 807 differentially expressed lncRNAs in the d55vsd65 comparison group, 628 differentially expressed lncRNAs in the d55vsd75 comparison group, and 177 differentially expressed lncRNAs in the d65vsd75 comparison group, as Figure 1 in B.

[0087] Based on the characteristics of the morphogenesis and development of primary and secondary hair follicles in cashmere goats, lncRNAs differentially expressed at different embryonic stages were further screened and analyzed. First, the three comparison groups of d55vsd45, d65vsd45, and d65vsd55 were set as stage A, and there were 1051 lncRNAs related to the morphogenesis and development of primary hair follicles; the three comparison groups of d75vsd45, d75vsd55, and d75vsd65 were set as stage B, and there were 903 lncRNAs related to the morphogenesis and development of primary or secondary hair follicles. After removing the common part of stage B and stage A from stage B, the remaining 158 lncRNAs were regarded as important lncRNAs related to the morphogenesis and development of secondary hair follicles, as Figure 1 in A. Among the 158 lncRNAs related to the morphogenesis of secondary hair follicles, it was found that lncRNA MSTRG.20890.1 was significantly downregulated at embryonic day 75. Subsequently, qRT-PCR was used to further verify its expression in skin tissues at different embryonic stages. The results showed that lncRNA MSTRG.20890.1 was significantly downregulated at embryonic day 75, which is a critical period for the morphogenesis of secondary hair follicles, as Figure 1 in F.

[0088] 2. LncRNA MSTRG.20890.1 inhibits the proliferation and migration of dermal fibroblasts

[0089] LncRNA MSTRG.20890.1 is an RNA transcribed from the intron region of the ZNF385D gene, with a length of 11217 bp, as Figure 1A in it. The coding ability of lncRNA MSTRG.20890.1 was analyzed using CPC and CNCI software. The results showed that the scores of CPC and CNCI were 0.274 and -0.043 respectively, indicating that lncRNA MSTRG.20890.1 could not encode proteins. Subsequently, three pairs of lncRNA MSTRG.20890.1 interference vectors were constructed, and lncRNAMSTRG.20890.1-sh1 / 2 / 3 was transfected into dermal fibroblasts via lentivirus. The morphogenesis and development of hair follicles are the results of the continuous proliferation and differentiation of dermal fibroblasts and epithelial cells. In addition, dermal fibroblasts eventually form dermal papilla structures through continuous proliferation and differentiation, which is the signal center for the periodic growth and regeneration of hair follicles. Therefore, dermal fibroblasts were selected for subsequent experiments. The interference efficiency of the vectors was detected by qRT-PCR. Vectors sh1, sh2, and sh3 could all significantly inhibit the expression of lncRNAMSTRG.20890.1, and the interference efficiency of sh2 was the best, as Figure 1 G in it.

[0090] First, the effects of lncRNA MSTRG.20890.1 interference on dermal fibroblasts were detected by flow cytometry. The experimental results showed that when lncRNA MSTRG.20890.1 was interfered with, the proportion of late apoptotic cells in dermal fibroblasts was significantly lower than that in the control group, indicating that lncRNA MSTRG.20890.1-sh could inhibit the apoptosis of dermal fibroblasts, as Figure 1 C in it. In addition, CCK8 and EDU were used to detect the proliferation of the lncRNA MSTRG.20890.1-sh cell line respectively. The results showed that after interfering with lncRNA MSTRG.20890.1, the number of EDU-positive cells in dermal fibroblasts increased significantly, and the proliferation ability of the cells was also significantly higher than that in the control group, as Figure 1 D and E in it.

[0091] The above experimental results showed that after interfering with lncRNA MSTRG.20890.1, the proliferation ability of dermal fibroblasts could be promoted and cell apoptosis could be inhibited. Subsequently, flow cytometry was used to detect the changes in the cell cycle to further explore the promoting effect of lncRNAMSTRG.20890.1-sh on cell proliferation. It was found that after interfering with lncRNA MSTRG.20890.1, the number of S-phase cells increased significantly, while the proportions of G1-phase and G2 / M-phase cells decreased significantly, indicating that lncRNA MSTRG.20890.1-sh achieved cell proliferation by increasing the proportion of S-phase cells and blocking G1-phase and G2 / M-phase, as Figure 1I in [the text]. Hair follicles are the result of the continuous proliferation and differentiation of epithelial cells and dermal fibroblasts. During the entire process of hair follicle development, as the hair follicle structure matures, dermal fibroblasts not only proliferate and differentiate but also continuously penetrate into the dermis to form the dermal papilla structure of the hair follicle. Therefore, in the present invention, a cell scratch assay was used to explore the effect of lncRNA MSTRG.20890.1 on the migration ability of dermal fibroblasts. It was found that after transfection with lncRNA MSTRG.20890.1-sh, the migration ability of dermal fibroblasts was significantly enhanced, as shown in Figure 1 H in [the text]. The comprehensive results of the above experiments showed that lncRNA MSTRG.20890.1-sh could improve the proliferation and migration abilities of dermal fibroblasts. At the same time, its promoting effect on the proliferation of dermal fibroblasts might be achieved by increasing the proportion of S-phase cells.

[0092] 3. lncRNA MSTRG.20890.1 is involved in the morphogenesis and development of secondary hair follicles by binding to chi-miR-24-3p

[0093] The location of lncRNAs in cells determines their functions. Research has shown that lncRNAs in the cytoplasm can regulate gene expression by binding to miRNAs. Therefore, lncLocator software and a nuclear-cytoplasmic fractionation experiment were used to predict and analyze the location of lncRNA MSTRG.20890.1 in cells. The results showed that it was mainly expressed in the cytoplasm, as shown in Figure 2 A and B in [the text]. Subsequently, bioinformatics analysis was performed using the TargetScan and miRanda databases, and it was found that lncRNA MSTRG.20890.1 had potential binding sites with chi-miR-24-3p. Further, RNAhybrid (v2.1.2) software was used to obtain the binding site sequence information of lncRNA MSTRG.20890.1 and chi-miR-24-3p. Figure 2 D in [the text] shows that the free energy of the binding of lncRNA MSTRG.20890.1 and chi-miR-24-3p is less than -20 kcal / mol, indicating a strong binding ability. The expression of chi-miR-24-3p in the lncRNA MSTRG.20890.1-sh cell line was detected by qRT-PCR, and it was found that this miRNA was significantly highly expressed in the cell line, as shown in Figure 2 E in [the text]. In addition, wild-type and mutant lncRNA MSTRG.20890.1 dual-luciferase reporter plasmids were constructed, as shown in Figure 2C in it, and a dual-luciferase reporter gene assay was performed to verify the target binding relationship between lncRNA MSTRG.20890.1 and chi-miR-24-3p. The results showed that after overexpression of chi-miR-24-3p, the luciferase activity of the lncRNA MSTRG.20890.1-WT luciferase reporter gene was significantly reduced, while there was no significant change in the mutant type, indicating that there was indeed a target binding relationship between lncRNA MSTRG.20890.1 and chi-miR-24-3p, as shown in Figure 2 F in

[0094] 4. Chi-miR-24-3p can counteract the promoting effect of lncRNA MSTRG.20890.1-sh on the proliferation and migration of dermal fibroblasts.

[0095] To further explore the interaction between lncRNA MSTRG.20890.1 and chi-miR-24-3p in dermal fibroblasts, several rescue experiments were conducted by co-transfecting lncRNA MSTRG.20890.1-sh and chi-miR-24-3p inhibitor. First, the expression of lncRNA MSTRG.20890.1 was detected in the chi-miR-24-3p inhibitor and chi-miR-24-3p overexpression cell lines, respectively. After interference with chi-miR-24-3p, the expression of lncRNA MSTRG.20890.1 increased significantly. On the contrary, its expression decreased significantly in the chi-miR-24-3p overexpression cell line, as shown in Figure 3 F in Figure 3 A and C in Figure 3F in Figure 3 D in Figure 3 E in Figure 3 B in

[0096] 5. ADAMTS3 targets and binds to chi-miR-24-3p and is involved in the morphogenesis and development of secondary hair follicles

[0097] To further determine the potential regulatory mechanism, TargetScan and miRanda databases were used to predict the target genes of chi-miR-24-3p. It was found that chi-miR-24-3p had a targeting relationship with 1476 genes, and its regulatory network is shown in Figure 4 A in Figure 5 Figure 6 . Therefore, the ADAMTS3 gene enriched in the TGF-β signaling pathway was selected for subsequent experimental verification and analysis.

[0098] First, the targeting relationship between chi-miR-24-3p and ADAMTS3 was verified using the dual-luciferase reporter gene system. Wild-type and mutant plasmids of the 3'UTR region of ADAMTS3 were constructed respectively, as shown in Figure 4 ​B in it, and the wild-type and mutant plasmids were co-transfected with the overexpression of chi-miR-24-3p into 293T cells respectively. The relative luciferase activity in the cells was detected. The results of the dual-luciferase reporter system showed that the overexpression of chi-miR-24-3p significantly reduced the luciferase activity of the ADAMTS3-3'UTR-WT luciferase reporter gene, while the mutant type remained unchanged, indicating that chi-miR-24-3p indeed has a target binding site with ADAMTS3, as Figure 4 D in it. Subsequently, qRT-PCR was used to detect the expression of ADAMTS3 in the dermal fibroblast cell line with chi-miR-24-3p interference / overexpression. The results showed that interfering with chi-miR-24-3p could increase the expression level of ADAMTS3, while overexpressing chi-miR-24-3p could inhibit the expression of ADAMTS3, as Figure 4 C in it. The above results indicate that there is indeed a conserved target of chi-miR-24-3p in ADAMTS3, and this target binding site can significantly inhibit the expression of the ADAMTS3 gene.

[0099] 6. ADAMTS3 inhibits the proliferation and migration of dermal fibroblasts

[0100] The ADAMTS protease family was initially discovered in mice and is structurally similar to ADAM enzymes. This family can be divided into 4 subclasses, among which ADAMTS3 belongs to the second subclass and is an important gene in the TGF-β signaling pathway. Therefore, three ADAMTS3 interference vectors were constructed and transfected into dermal fibroblasts through lentivirus. qRT-PCR was used to detect the interference efficiency of ADAMTS3-sh1 / sh2 / sh3. The experimental results showed that the interference efficiency of ADAMTS3-sh2 was the best, as Figure 7 A in it. First, the EDU and AnnexinV-APC / PI double staining methods were used to detect cell proliferation and apoptosis respectively. The experimental results showed that ADAMTS3-sh could significantly inhibit the apoptosis of dermal fibroblasts, increase the proportion of EDU-positive cells, and accelerate cell proliferation, as Figure 7 B and D in it. In addition, the effect of ADAMTS3 on the cell cycle was further explored by DNA staining. It was found that knocking down ADAMTS3 significantly increased the proportion of cells in the S phase and G2 / M phase in dermal fibroblasts and decreased the proportion of cells in the G1 phase, as Figure 7 E in it. The results of the cell migration experiment showed that when ADAMTS3-sh was transfected into dermal fibroblasts, its cell migration ability was significantly increased, as Figure 7C in the figure. The results showed that knockdown of ADAMTS3 significantly enhanced the proliferation and migration of dermal fibroblasts and reduced the apoptosis of dermal fibroblasts. It should be noted that the effects of ADAMTS3-sh and lncRNA MSTRG.20890.1-sh on the phenotype of dermal fibroblasts are consistent, which is consistent with the ceRNA hypothesis.

[0101] 7. lncRNA MSTRG.20890.1 inhibits proliferation and apoptosis of dermal fibroblasts through the chi-miR-24-3p / ADAMTS3 signaling axis

[0102] Based on previous studies, it was found that chi-miR-24-3p can bind to lncRNA MSTRG.20890.1, and chi-miR-24-3p inhibitors can offset the promoting effects of lncRNA MSTRG.20890.1-sh on dermal fibroblast proliferation and migration and the inhibiting effects on apoptosis. Therefore, it was hypothesized that the chi-miR-24-3p inhibitor could also act as an inhibitor of ADAMTS3-sh to offset the effects of ADAMTS3-sh on the phenotype of dermal fibroblasts. To prove this hypothesis, co-transfection of ADAMTS3-sh and chi-miR-24-3p inhibitor was performed, and their relationship was verified at the cellular level by rescue experiments. The AnnexinV-APC / PI double staining method was used to detect changes in cell apoptosis after co-transfection of ADAMTS3-sh and chi-miR-24-3p inhibitor. It was found that the ADAMTS3-sh cell line with chi-miR-24-3p inhibitor could offset the inhibition of apoptosis induced by ADAMTS3-sh, such as Figure 8 A. The changes in cell proliferation and migration were detected using the EdU method and cell scratch assay. Figure 8 As can be seen from B and D, after the addition of the chi-miR-24-3p inhibitor to the ADAMTS3-sh cell line, the number of EDU-positive cells decreased significantly and the cell migration ability was also reduced. Subsequently, the effect of the chi-miR-24-3p inhibitor on the ADAMTS3-sh dermal fibroblast cell line was further explored by DNA staining. It was found that after interfering with ADAMTS3, the proportion of S phase cells in dermal fibroblasts increased significantly. When the chi-miR-24-3p inhibitor was added to the ADAMTS3-sh cell line, the increase in the proportion of S phase cells caused by ADAMTS3-sh was rescued. This suggests that the proliferation of dermal fibroblasts caused by ADAMTS3-sh may be achieved by increasing the proportion of S phase cells, such as Figure 8C in addition. Moreover, the expression of proliferation and apoptosis marker genes was detected in the ADAMTS3-sh cell line and the cell line co-transfected with ADAMTS3-sh and the chi-miR-24-3p inhibitor. It was found that ADAMTS3-sh could promote the expression of marker genes related to cell proliferation and inhibit the expression of apoptosis-related genes. When ADAMTS3-sh2 and the chi-miR-24-3p inhibitor were co-transfected, the expression of marker genes related to cell proliferation was significantly inhibited, while the expression of apoptosis-related marker genes was significantly promoted compared with the ADAMTS3-sh group, as Figure 8 E in. The above results indicate that as a target gene of chi-miR-24-3p, ADAMTS3 can promote the apoptosis of dermal fibroblasts, inhibit their proliferation and migration. The effect of ADAMTS3 on the phenotype of dermal fibroblasts is regulated by chi-miR-24-3p. This result further shows that there is indeed a targeting relationship between chi-miR-24-3p and ADAMTS3 in cells, and they jointly regulate the proliferation and migration of dermal fibroblasts.

[0103] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected. To avoid repetition, the present invention describes preferred embodiments.

[0104] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0105] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these changes and modifications.

Claims

1. Use of a detection reagent for cashmere goat hair follicle development-related genes in the preparation of a cashmere goat hair follicle development detection kit, characterized in that: The cashmere goat hair follicle development-related gene is lncRNA MSTRG.20890.1; The nucleotide sequence of lncRNA MSTRG.20890.1 is shown in SEQ ID NO.

45.

2. The use according to claim 1, characterized in that: When the related gene is lncRNA MSTRG.20890.1, the detection reagent is a sequence as shown in SEQ ID NO.24-25.

3. Use of an agent for inhibiting the expression of lncRNA MSTRG.20890.1 described in claim 1 in the preparation of a cashmere goat hair follicle development promoter, characterized in that: The reagent that inhibits the expression of lncRNA MSTRG.20890.1 is the sequence shown in SEQ ID NO.3-4.