Breeding method of blue dot jack mackerel

By screening for the microsatellite marker JS-3, which is associated with growth traits in blue-spotted mackerel, the problem of screening for superior parent stock in existing technologies has been solved, enabling efficient breeding of blue-spotted mackerel and improving the growth traits of offspring.

CN119220698BActive Publication Date: 2026-06-02NINGBO ACADEMY OF OCEAN & FISHERY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NINGBO ACADEMY OF OCEAN & FISHERY
Filing Date
2024-10-29
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In the current technology, there are few studies on molecular markers related to the growth traits of blue-spotted mackerel, making it difficult to effectively screen out parents with growth advantages for breeding.

Method used

By analyzing the microsatellite primer amplification products of fast-growing and slow-growing populations of blue-spotted mackerel, molecular markers linked to growth traits were screened out. Parents were selected using the screened molecular markers for breeding. Specifically, microsatellite locus JS-3 and its primers were used to perform PCR amplification of ACTGTACACTAGAATGGAACATGC and CGTGGTGGCTTAGTGACGTA, and individuals with a 192bp specific band were selected as parents.

Benefits of technology

Effective breeding of blue-spotted mackerel was achieved, individuals with significant growth potential were selected, and the growth trait performance of offspring was improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119220698B_ABST
    Figure CN119220698B_ABST
Patent Text Reader

Abstract

The application provides a breeding method of blue dot jack mackerel, which is screening molecular markers linked to growth traits by analyzing microsatellite primer amplification products of a fast growth group and a slow growth group of the blue dot jack mackerel, and screening parents for genetic breeding of the blue dot jack mackerel by using the screened molecular markers. The application obtains microsatellite markers linked to growth traits of the blue dot jack mackerel by analyzing amplification products of different growth traits of the blue dot jack mackerel, and the microsatellite markers can be used to screen blue dot jack mackerel individuals with better growth potential, thereby providing effective molecular markers for genetic breeding operation of the blue dot jack mackerel.
Need to check novelty before this filing date? Find Prior Art