Breeding method of blue dot jack mackerel
By screening for the microsatellite marker JS-3, which is associated with growth traits in blue-spotted mackerel, the problem of screening for superior parent stock in existing technologies has been solved, enabling efficient breeding of blue-spotted mackerel and improving the growth traits of offspring.
Patent Information
- Application Number
- CN202411515055.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-29
- Publication Date
- 2026-06-02
- Estimated Expiration
- 2044-10-29
AI Technical Summary
In the current technology, there are few studies on molecular markers related to the growth traits of blue-spotted mackerel, making it difficult to effectively screen out parents with growth advantages for breeding.
By analyzing the microsatellite primer amplification products of fast-growing and slow-growing populations of blue-spotted mackerel, molecular markers linked to growth traits were screened out. Parents were selected using the screened molecular markers for breeding. Specifically, microsatellite locus JS-3 and its primers were used to perform PCR amplification of ACTGTACACTAGAATGGAACATGC and CGTGGTGGCTTAGTGACGTA, and individuals with a 192bp specific band were selected as parents.
Effective breeding of blue-spotted mackerel was achieved, individuals with significant growth potential were selected, and the growth trait performance of offspring was improved.
Smart Images

Figure CN119220698B_ABST
Abstract
Citation Information
Patent Citations
Microsatellite marker screening of fast-growing largemouth black basses and application thereof
CN102127599A
Microsatellite marker related to growth traits of hippocampus kelloggi and application of microsatellite marker
CN117025788A