Primer probe combination, detection reagent and detection kit for detecting vancomycin drug-resistant gene and application of primer probe combination, detection reagent and detection kit

Abstract

The invention relates to the technical field of biological detection, in particular to a primer probe combination for detecting a vancomycin drug resistance gene, a detection reagent, a detection kit and application thereof. Due to the fact that different types of antibacterial agents have different in-vitro antibacterial activities on strains generating different vancomycin, corresponding primers are designed for nucleic acid amplification, the method is the most reliable and direct method, the consumed time is short by 50 min, the kit can detect drug-resistant genes of vancomycin more comprehensively, can detect vanA, vanB, vanD and vanM, and is high in sensitivity, the detection limit concentration is 50 copies / mL, and the kit can be used for detecting drug-resistant genes of vancomycin. And accurate medication for clinical anti-infection treatment and prevention and control of hospital infection are facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a primer-probe combination, a detection reagent, a detection kit and applications thereof for detecting vancomycin resistance genes. Background Art

[0002] Vancomycin is a glycopeptide antibacterial drug that interferes with the synthesis of the bacterial cell wall by interfering with peptidoglycan, a key component of the bacterial cell wall structure, and inhibits the production of phospholipids and polypeptides in the cell wall. It is currently the first-line drug for the treatment of Gram-positive bacterial infections such as methicillin-resistant Staphylococcus aureus, Staphylococcus epidermidis, and drug-resistant Enterococci.

[0003] Enterococcus is a common conditional pathogen of hospital infection. In recent years, the infection rate of vancomycin-resistant Enterococcus (VRE) has increased year by year, and 7% to 10% of bacteremia is caused by enterococcal infection. VRE can cause infection in multiple parts of the human body, mainly as a result of the selectivity of broad-spectrum antimicrobial drugs. VRE can be directly transmitted through blood infection or colonization growth, and can also be indirectly transmitted through food, medical equipment, contaminated environment, contact with medical staff, etc. VRE includes vancomycin-resistant Enterococcus faecium and vancomycin-resistant Enterococcus faecalis, and has obvious drug resistance, involving phenotypes such as VanA, VanB, VanD, VanM and VanN. Among them, VanA, VanB, VanD, and VanM can encode the synthesis of peptidoglycan precursors with D-Ala-D-Lac as the terminal, mediating moderate or high resistance to vancomycin. At present, Enterococcus faecium and Enterococcus faecalis have developed resistance to multiple antimicrobial drugs such as vancomycin, penicillin and teicoplanin. Rapid identification of resistant bacterial pathogens and their characteristics plays an important role in infection prevention and control. In order to improve the efficiency of VRE prevention and control and prevent its early spread in the hospital, it is of great significance to identify the carriers of resistant enterococci as soon as possible.

[0004] The existing technology for detecting vancomycin resistance genes has problems such as incomplete gene coverage, complex detection methods or primer designs, difficulty in sequencing after product recovery, and inability to be used for cloning; and high false positive rate. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a primer-probe combination, a detection reagent, a detection kit and its application for detecting vancomycin resistance genes. The present invention provides a primer-probe combination for rapid detection of vancomycin resistance genes. The detection results are accurate and reliable with high sensitivity, which can effectively play the role of accurate diagnosis, drug resistance tracing, and drug resistance control.

[0006] The present invention provides a primer-probe combination, comprising a primer set X and a probe X;

[0007] The primer set X includes primer (2X-1) and primer 2X;

[0008] The primer (2X-1) has:

[0009] (1), the nucleotide sequence shown in SEQ ID NO: (3X-2); or

[0010] (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as (1); or

[0011] (3) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (1) or (2);

[0012] The primer 2X has:

[0013] (4) the nucleotide sequence shown in SEQ ID NO: (3X-1); or

[0014] (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or

[0015] (6) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (4) or (5);

[0016] The probe X has:

[0017] (7), the nucleotide sequence shown in SEQ ID NO: (3X); or

[0018] (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as (7); or

[0019] (9) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (7) or (8);

[0020] The X includes any one or more integers between 1 and 4.

[0021] In some specific embodiments of the present invention, the primer-probe combination for identifying the drug-resistant gene vanA includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:1, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:2, and a probe having a nucleotide sequence as shown in SEQ ID NO:3.

[0022] In some specific embodiments of the present invention, the primer-probe combination for identifying the drug-resistant gene vanB includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:4, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:5, and a probe having a nucleotide sequence as shown in SEQ ID NO:6.

[0023] In some specific embodiments of the present invention, the primer-probe combination for identifying the drug-resistant gene vanD includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:7, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:8, and a probe having a nucleotide sequence as shown in SEQ ID NO:9.

[0024] In some specific embodiments of the present invention, the primer-probe combination for identifying the drug-resistant gene vanM includes: a forward primer having a nucleotide sequence as shown in SEQ ID NO:10, a reverse primer having a nucleotide sequence as shown in SEQ ID NO:11, and a probe having a nucleotide sequence as shown in SEQ ID NO:12.

[0025] In some embodiments, a primer probe set for an internal standard gene is also included, and the internal standard gene includes β-globin or GADPH gene.

[0026] In some specific embodiments, the internal standard gene is β-globin, and the primer probe set for β-globin includes:

[0027] (10), the forward primer has the nucleotide sequence shown in SEQ ID NO: 13, the reverse primer has the nucleotide sequence shown in SEQ ID NO: 14, and the probe has the nucleotide sequence shown in SEQ ID NO: 15; or

[0028] (11) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as (10); or

[0029] (12) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (10) or (11).

[0030] The present invention provides the use of the primer-probe combination in preparing a reagent or a kit for detecting vancomycin resistance genes:

[0031] The drug resistance gene includes at least one of vanA, vanB, vanD and vanM.

[0032] The invention provides a reagent, comprising the primer-probe combination, and acceptable auxiliary materials and additives.

[0033] The present invention provides a kit, comprising the primer-probe combination or the reagent, and a PCR reaction reagent.

[0034] In some embodiments, the PCR reaction reagents include: Buffer, dNTPs, DNA polymerase, sample DNA, MgCl2 and H2O.

[0035] In some embodiments, the PCR reaction reagents include dUTP.

[0036] In some specific embodiments, the Buffer includes:

[0037]

[0038]

[0039] In some specific embodiments,

[0040] The Buffer includes:

[0041]

[0042] In some specific embodiments of the present invention, the PCR reaction system of the kit comprises:

[0043]

[0044] In some embodiments, the PCR reaction procedure includes:

[0045]

[0046] The present invention also provides the use of any of the following items in detecting vancomycin resistance genes vanA, vanB, vanD and vanM:

[0047] 1. the primer-probe combination; and / or

[0048] II, the reagent; and / or

[0049] III. the kit.

[0050] The present invention provides the use of any of the following items in screening drugs against vancomycin-resistant bacteria:

[0051] 1. the primer-probe combination; and / or

[0052] II, the reagent; and / or

[0053] III. the kit.

[0054] In some embodiments of the present invention, the use is for non-disease diagnosis or treatment purposes.

[0055] The present invention provides a primer-probe combination, a detection reagent, a detection kit and applications thereof for detecting vancomycin resistance genes. Since different types of antimicrobial drugs have different in vitro antimicrobial activities against different vancomycin-producing strains, corresponding primers are designed for nucleic acid amplification, which is the most reliable and direct method, and takes only 50 minutes. The kit can detect vancomycin resistance genes more comprehensively, can detect vanA, vanB, vanD, and vanM, and has relatively high sensitivity, with a detection limit concentration of 50 copies / mL, which is beneficial to accurate drug use in clinical anti-infection treatment and hospital infection prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 The results of detecting the amplification of VanA gene at different concentrations using the primer-probe combination provided in the present application are shown;

[0057] Figure 2 The results of detecting the amplification of VanD gene at different concentrations using the primer-probe combination provided in the present application are shown;

[0058] Figure 3 The results of detecting the amplification of VanB gene at different concentrations by the primer-probe combination provided in the present application are shown;

[0059] Figure 4 The results of detecting the amplification of VanM gene at different concentrations by the primer-probe combination provided in the present application are shown;

[0060] Figure 5 The results of detecting 200 copies / mLVanA gene amplification using the primer-probe combination provided by the present application in the comparative example and the comparative patents 1 and 2 are shown;

[0061] Figure 6 The results of detecting 200 copies / mLVanB gene amplification using the primer-probe combination provided by the present application in the comparative example and the comparative patents 1 and 2 are shown;

[0062] Figure 7 The results of the primer-probe combination provided in the comparative example and the comparative patent 1 for detecting the amplification of 200 copies / mLVanM gene are shown. DETAILED DESCRIPTION

[0063] The present invention provides primer probe combinations, detection reagents, detection kits and applications thereof for detecting vancomycin resistance genes. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0064] The test materials used in the present invention are all common commercial products and can be purchased in the market. The present invention is further described below in conjunction with the embodiments.

[0065] Example

[0066] By using DNAman software to compare and analyze the existing vanA (GenBank: M97297.1), vanB (KF823969.1), vanD (GenBank: AY082011.1), and vanM (GenBank: FJ349556.1) sequences in the NCBI database, a highly conservative and highly specific sequence was selected. Reverse transcription polymerase chain reaction (RT-PCR) was used to detect vanA, vanB, vanD, and vanM, and four genotypes could be detected simultaneously in the same sample. The design of the primer pair is the key to the success of the present invention.

[0067] The primer-probe combinations are shown in Table 1 below.

[0068] Table 1

[0069]

[0070]

[0071] The nucleic acid extraction and purification reagents (registration number: Yuzheng 20180037) of Zhengzhou Antu Bioengineering Co., Ltd. were used for nucleic acid extraction and purification. The specific steps are as follows:

[0072] (1) Add 30 μL of proteinase K, 200 μL of sample or other sample type solution after treatment (dilute the sample to 100 copies / mL, 50 copies / mL), 100 μL of magnetic bead suspension (mix the magnetic beads before aspiration), and 1.2 mL of lysis solution into the reaction container, mix well, and incubate in a 37°C incubator for 2 min;

[0073] (2) magnetically aspirating the mixed solution after incubation for 1 min 30 s and discarding the waste solution;

[0074] (3) Demagnetize, add 2 mL of washing solution A, mix well, magnetically absorb for 1 min 30 s, and discard the waste liquid;

[0075] (4) Demagnetize, add 2 mL of washing solution B, mix well, magnetically absorb for 1 min 30 s, and discard the waste liquid (minimize the residue);

[0076] (5) Add 100-300 μL (according to the requirements of subsequent experiments) of eluent, mix well, and dissociate in a dry thermostat at 80° C. for 5 min; in this example, 220 μL of eluent is used.

[0077] (6) After 2 min of magnetic adsorption, the extracted or purified product was obtained for subsequent experiments.

[0078] The method for rapid and simultaneous typing of drug-resistant genes vanA, vanB, vanD, and vanM by RT-PCR specifically comprises the following steps: (1) preparing the DNA of the test sample; (2) performing one-step RT-PCR amplification on the DNA sample in step (1): the reaction system is 30 to 120 μL, and 50 μL is used in this embodiment. In the 50 μL reaction system, the following are included: primer probes of vanA, vanB, vanD, and vanM, primer probes of β-globin internal standard, the concentration of each primer can be 100 uM, the amount is 0.08 μL, the concentration of each probe can be 100 uM, the amount is 0.02 μL, Buffer 10 μL, 3 mM dNTPs 0.5 μL, 5 U / μL mixed enzyme (DNA polymerase: Taq DNA polymerase, Guangdong Feipeng Biotechnology Co., Ltd.) 0.5 μL, sample DNA 10 μL, MgCl2 final concentration 10 uM, the total system is 50 uL, and the rest is supplemented with H2O. All of the above were added to the reaction tube and mixed evenly, and then placed in an amplification PCR instrument (Jena Soft4.0) for the following reaction: 50°C for 2 min; 95°C pre-denaturation for 1 min; 94°C denaturation for 5 s, 60°C annealing for 15 s (light collection), 45 cycles.

[0079] The buffer components and addition amounts are shown in Table 2.

[0080] Table 2

[0081]

[0082]

[0083] Table 3 Effect of buffer component concentration on target gene ct value

[0084]

[0085] When the components were at the lowest, middle and highest concentrations, all genes could be detected normally at the detection position. Therefore, the buffer composition and addition amount shown in Table 2 can meet the reagent requirements.

[0086] The vanA, vanB, vanD, and vanM gene samples with concentrations of 50 copies / mL, 100 copies / mL, 200 copies / mL, 400 copies / mL, and 800 copies / mL were prepared, and the primer probe sets shown in Table 1 were used for detection, and the detection results are shown in Table 3. The results show that when detecting vanA, vanB, vanD, and vanM gene samples in the above concentration range, the primer probe set of combination 1 can detect them normally. The detection results of the primer probe set of combination 1 for detecting 50 copies / mL, 100 copies / mL, and 200 copies / mL of vanA, vanB, vanD, and vanM genes are shown in Table 3. Figures 1 to 4 shown.

[0087] Cross pathogen sample extraction: The samples containing Escherichia coli, Enterococcus faecalis, Enterococcus faecium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterobacter cloacae, Klebsiella oxytoca, Acinetobacter baumannii, Citrobacter freundii, Staphylococcus aureus, and Proteus mirabilis in the tube were mixed with a pipette, and the nucleic acid extraction and purification reagents of Zhengzhou Antu Bioengineering Co., Ltd. were used for nucleic acid extraction and purification. The kit was amplified, and the results are shown in Table 4. There was no crossover in the test results. Samples with detection limit concentrations of vanA, vanB, vanD, and vanM were selected, and the interfering substances were added to the samples at 3 times the peak concentration. The samples were treated by a cross-reaction method. The detection sensitivity of the kit of the present invention will not be affected by endogenous interfering substances such as mucin, digestive enzymes, and blood; exogenous interfering substances such as vancomycin, teicoplanin, chloramphenicol, penicillin, fosfomycin, ampicillin, erythromycin, tetracycline, rifampicin, linezolid, oxacillin, ciprofloxacin, and levofloxacin. The results are shown in Table 5.

[0088] Table 4 Verification comparison between control group and experimental group

[0089]

[0090] Table 5 Effect of cross-links on reagents

[0091]

[0092]

[0093] Table 6 Anti-interference ability of reagents

[0094] Interfering substances VanA VanB VanD VanM / (No Additive) 32.81 34.03 33.71 34.11 Mucin 33.62 34.69 34.92 34.45 Digestive enzymes 33.24 34.99 33.51 34.8 blood 33.14 34.35 33.01 34.56 Vancomycin 32.91 34.19 34.69 34.33 Teicoplanin 33.16 33.13 35 34.25 Chloramphenicol 32.99 33.75 34.75 34.96 penicillin 32.17 33.37 34.67 34.55 Fosfomycin 32.95 33.43 33.11 34.1 Ampicillin 32.63 34.16 34.7 34.85 Erythromycin 33.36 33.78 33.33 34.97 tetracycline 32.92 34.31 34.87 34.01 Rifampin 33.34 33.18 34.29 34.94 Linezolid 33.55 34.92 34.4 34.24 Oxacillin 32.72 34.29 34.24 34.09 Ciprofloxacin 32.59 33.75 34.96 34.38 Levofloxacin 33.24 34.2 33.48 34.63

[0095] Comparative Example

[0096] The vanA, vanB and vanM primer probe sets disclosed in the prior art are used as a comparison for rapid and simultaneous typing detection of drug resistance genes by RT-PCR, wherein the primer probe sets disclosed in the prior art are as follows:

[0097] Patent 1 (201710984842.9-Primer composition, probe composition, kit for detecting vancomycin-resistant gene, and application thereof: The method uses fluorescent PCR method for detection of three genes, VanA, VanB and VanM):

[0098] VanA:

[0099] Upstream primer: CAAGTCAGGTGAAGATGGATCCA (SEQ ID NO: 31);

[0100] Downstream primer: TTGTCCATACAAATTGCTGAGCTT (SEQ ID NO: 32);

[0101] Probe: CCGGTATCCCTTTTGTAGGCTGCGATATTC (SEQ ID NO: 33);

[0102] VanB:

[0103] Upstream primer: GCCCGGTTTACATCGTACAG (SEQ ID NO: 34);

[0104] Downstream primer: AGTGCAGGAAGCGTGATTCC (SEQ ID NO: 35);

[0105] Probe: CCACGTATGATGGCCGCCGC (SEQ ID NO: 36);

[0106] VanM:

[0107] Upstream primer: TGGCAAGACAATATGACAGCAA (SEQ ID NO: 37);

[0108] Downstream primer: GCACAACCGACCTCATAACCTAA (SEQ ID NO: 38);

[0109] Probe: TCCTAATTGAGCAGGGTGT (SEQ ID NO: 39).

[0110] The concentration of KCl was 50 mM, the concentration of MgCl2 was 3.5 mM, the concentration of Tris-HCl was 10 mM, the final concentration of dUTP (100 mM) was 400 μM, the final concentration of dATP (100 mM) was 200 μM, the final concentration of dCTP (100 mM) was 200 μM, the final concentration of dGTP (100 mM) was 200 μM, the final concentration of upstream and downstream primers and probes (100 μM) of VnA, VnB, and VnM was 300 nM, the final concentration of the primer probe of 16S rRNA internal standard (100 μM) was 200 nM, the template addition amount was 5 μL, Taq enzyme was 1.5 U / μL, UNG enzyme was 0.2 U / μL, and the reaction conditions were 50°C for 2 minutes, pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 15 seconds, annealing at 60°C for 60 seconds (light collection), and 45 cycles.

[0111] Patent 2 (201710024527.1-LAMP primer combination for detecting vancomycin resistance gene and its application disclosure: This technology uses LAMP technology to detect the two genes VanA and VanB):

[0112] Primer set for detecting drug resistance gene vanA:

[0113] External primer F3: CAATTGCTATTCAGCTGTACT (SEQ ID NO: 40);

[0114] External primer B3: CGATTTGTCCATACAAATTGCT (SEQ ID NO: 41);

[0115] Internal primer FIP: GCTACATCAACATGGTTGATTTCATCTCGCCGGATAAAAAAATGCA (SEQ ID NO: 42);

[0116] Internal primer BIP: GCAAGTCAGGTGAAGATGGATCGAGCTTTGAATATCGCAGCCTA (SEQ ID NO: 43);

[0117] Loop primer LF: GGTTCTTTTTAACAAGTAATCCG (SEQ ID NO: 44);

[0118] Loop primer LB: ACAAGGTCTGTTTGAATTGTC (SEQ ID NO: 45).

[0119] Primer set for detecting drug resistance gene vanB (5'→3'):

[0120] External primer F3: AGAAGCGGCAGGACAAT (SEQ ID NO: 46);

[0121] External primer B3: CTCGACCGGAATGTCTG (SEQ ID NO: 47);

[0122] Internal primer FIP: CCATGACCGCACACCCGAGGAAAAATCTTAATTGAGCAAGCG (SEQ ID NO: 48);

[0123] Inner primer BIP: GGCTGAGCCACGGTATCTTCCGGGAACTGTAATCATCGCAT (SEQ IDNO: 49);

[0124] Loop primer LF: CTCACAGCCCGAAAT (SEQ ID NO: 50);

[0125] Loop primer LB (SEQ ID NO: 12): CATCAGGAAAACGAGC (SEQ ID NO: 51).

[0126] Reaction system (10μL): 7.0μL reaction solution (product of Biobio Group Co., Ltd., catalog number CP.440020), 1μL primer mixture, 1μL template DNA (5pg-50pg), add water to 10μL. Primer mixture is a mixture of primers in primer group I or primer group II. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 are both 0.5μM, the final concentrations of the inner primer FIP and the inner primer BIP are both 2μM, and the final concentrations of the loop primer LF and the loop primer LB are both 1μM. Reaction conditions: constant temperature of 65℃ for 50min. The results are as follows Figure 7 shown.

[0127] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination, characterized in that: comprising a primer set X and a probe X; The primer set X includes primer (2X-1) and primer 2X; The primer (2X-1) has: (1), the nucleotide sequence shown in SEQ ID NO: (3X-2); or (2) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as (1); or (3) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (1) or (2); The primer 2X has: (4) the nucleotide sequence shown in SEQ ID NO: (3X-1); or (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or (6) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (4) or (5); The probe X has: (7), the nucleotide sequence shown in SEQ ID NO: (3X); or (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as (7); or (9) a nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (7) or (8); The X includes any one or more integers between 1 and 4.

2. The primer-probe combination according to claim 1, characterized in that: Also included are primer probe sets for internal standard genes, including β-globin or GADPH genes.

3. The primer-probe combination according to claim 2, characterized in that: The internal standard gene is β-globin, and the primer probe set of β-globin includes: (10), the forward primer has the nucleotide sequence shown in SEQ ID NO: 13, the reverse primer has the nucleotide sequence shown in SEQ ID NO: 14, and the probe has the nucleotide sequence shown in SEQ ID NO: 15; or (11) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as (10); or (12) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence shown in (10) or (11).

4. Use of the primer-probe combination according to any one of claims 1 to 3 in the preparation of a reagent or a kit for detecting vancomycin resistance genes: The drug resistance gene includes at least one of vanA, vanB, vanD and vanM.

5. A reagent, characterized in that The invention comprises the primer-probe combination according to any one of claims 1 to 3, and acceptable auxiliary materials and additives.

6. A kit, characterized in that The method comprises the primer-probe combination according to any one of claims 1 to 3 or the reagent according to claim 5, and a PCR reaction reagent.

7. The kit according to claim 6, characterized in that The PCR reaction reagents include: Buffer, dNTPs, DNA polymerase, sample DNA, MgCl2 and H2O.

8. The kit according to claim 7, characterized in that The Buffer includes:

9. The kit according to any one of claims 6 to 8, characterized in that The PCR reaction procedure includes:

10. Use of any of the following in screening for drugs against vancomycin-resistant bacteria: I. The primer-probe combination according to any one of claims 1 to 3; and / or II. The reagent according to claim 5; and / or III. The kit according to any one of claims 6 to 9.

Images