Cotton anthocyanin accumulation related InDel molecular marker and application thereof

By developing InDel molecular marker primers and PCR amplification technology, the problem of identifying anthocyanin accumulation in cotton has been solved, enabling early, accurate, and low-cost cotton breeding and promoting the rapid development of cotton breeding.

CN119220731BActive Publication Date: 2025-11-18SHIHEZI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411656842.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2025-11-18
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for identifying anthocyanin accumulation in cotton limits the application of anthocyanins in cotton breeding. Furthermore, existing methods are complex, costly, and difficult to rapidly screen for special germplasm with high anthocyanin accumulation.

Method used

We developed primers based on InDel molecular markers and used PCR amplification and polyacrylamide gel electrophoresis to rapidly identify cotton varieties associated with anthocyanin accumulation by detecting sequence differences at specific sites in the cotton genome.

Benefits of technology

It enables early, accurate, rapid, and low-cost identification of anthocyanin accumulation in cotton, improving the efficiency and accuracy of cotton breeding and can be effectively used for molecular marker-assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_3
    Figure SMS_3
  • Figure HDA0005142292880000011
    Figure HDA0005142292880000011
Patent Text Reader

Abstract

The application discloses an InDel molecular marker related to cotton anthocyanin accumulation and application thereof, and belongs to the technical field of cotton genetic breeding. The molecular marker is located on a D07 chromosome of a cotton genome, and the nucleotide sequence is shown as SEQ ID NO. 2. A primer pair for amplifying the InDel molecular marker is shown as SEQ ID NO. 1F and SEQ ID NO. 1R. By detecting the molecular marker in cotton seed or seedling plant DNA, the application can accurately, quickly and efficiently identify the anthocyanin content accumulation difference between cotton varieties in an early stage. Through the molecular marker assisted selection developed by the application, cotton materials with different anthocyanin content accumulation can be rapidly, conveniently, directionally and labor-saving screened in an early stage, and the application can be effectively used for molecular marker assisted breeding of cotton.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cotton genetic breeding technology, specifically to an InDel molecular marker, primer, and its application for identifying cotton anthocyanin accumulation. Background Technology

[0002] Anthocyanins, belonging to the flavonoid pigments in the phenylalanine synthesis pathway, are important secondary metabolites in plants. In plants, anthocyanins accumulate in vacuoles, giving flowers, fruits, and vegetative organs their orange, red, and blue colors. These vibrant colors play a crucial role in attracting pollinators and in fruit dispersal, and are used as important agronomic traits in modern genetics research and landscape design, providing crop breeders with clear selection markers. Anthocyanins also act as stress protectants under biotic and abiotic stresses, such as strong light, cold, and pathogen infection, mitigating oxidative damage to plant cells. Furthermore, anthocyanins can serve as metabolic markers of nutrient deficiencies, such as nitrogen deficiency, sulfur deficiency, and high carbon stress.

[0003] Colorful cotton fibers are an ideal agronomic trait for cotton breeding, but the molecular basis controlling pigment biosynthesis and accumulation in fibers remains unclear. Existing research indicates that the pigments in most colored cotton petals and fibers originate from anthocyanins. Anthocyanin-rich cotton plants not only have high ornamental value, but the red leaves and red spots on the base of the flowers can also serve as important genetic markers for hybridization breeding. Furthermore, anthocyanin accumulation in cotton plants is crucial for protection against abiotic stress and pests. However, the current lack of specific anthocyanin-related cotton materials restricts their application in breeding. Therefore, identifying molecular markers related to anthocyanin synthesis, transport, and accumulation in plants, and rapidly screening for germplasm with specific anthocyanin accumulation, is of significant practical importance for cotton breeding and safe production.

[0004] InDel molecular markers are molecular markers that utilize sequence-specific primers designed around insertion / deletion sites to amplify sequence length polymorphisms via PCR. InDel marker development is based on sequence differences, exhibiting stable variation and high accuracy during the development process, avoiding ambiguity in subsequent analyses caused by specificity and complexity. As high-throughput molecular markers, InDel markers have a high frequency of distribution in plant genomes and possess advantages such as high genetic stability, wide distribution, strong polymorphism, and high versatility. They are currently widely used in major crops such as rice, maize, and cotton. Summary of the Invention

[0005] The purpose of this invention is to provide an InDel molecular marker for anthocyanin accumulation in cotton, primers for amplifying the molecular marker, and applications of the molecular marker.

[0006] This invention provides an InDel molecular marker for identifying anthocyanin accumulation in cotton, characterized in that the molecular marker is located at bases 8900751-8900767 on chromosome D07 of the cotton genome; the sequence at this location is GTGTCTCAACGGAAGC in the light red stem phenotype offspring and parents, while this sequence is missing in the blue stem phenotype.

[0007] Specifically, the nucleotide sequence of the Indel molecular marker in the upland cotton light red stem material with normal anthocyanin accumulation is shown in SEQ ID NO.1.

[0008] The present invention also provides the application of the molecular marker InDel in marker-assisted breeding of cotton.

[0009] Specifically, it is used to identify the anthocyanin accumulation in cotton offspring samples from crosses between the red-stemmed upland cotton material SD3 and the green-stemmed upland cotton mutant material rsl, which serves as the maternal parent.

[0010] Specifically, when the nucleotide sequence of SEQ ID NO.1 containing InDel is amplified using primers, if the amplified product is displayed as a single main band by polyacrylamide gel electrophoresis and the target band is 361 bp in length, it is identified as a homozygous individual with normal anthocyanin accumulation; if the target band is a single main band and the target band is 345 bp in length, it is identified as a homozygous individual with anthocyanin deficiency; if there are two target bands and the lengths of the target bands are 361 bp and 345 bp respectively, it can be identified as a heterozygous individual with anthocyanin deficiency in cotton.

[0011] This invention provides a primer pair for detecting the InDel molecular marker or identifying cotton varieties with anthocyanin accumulation.

[0012] Specifically, it consists of the upstream primer SEQ ID NO.1F and the downstream primer SEQ ID NO.1R.

[0013] This invention provides a method for identifying cotton varieties related to anthocyanin accumulation, comprising the following steps:

[0014] 1) Extract genomic DNA from cotton seedlings to be tested;

[0015] 2) Using the DNA extracted in step 1) as a template, PCR amplification was performed using the primers shown in SEQ ID NO.1F-R;

[0016] 3) When the amplified band is 361bp, it is a homozygous individual with normal anthocyanin accumulation; when the amplified band is 345bp, it is a homozygous individual with a deletion in anthocyanin accumulation; when there are two amplified bands, with lengths of 361bp and 345bp respectively, it is a heterozygous individual with a deletion in anthocyanin accumulation in cotton. Specifically, the PCR products amplified in step 2) are detected by polypropylene gel electrophoresis.

[0017] This invention also provides the application of the InDel molecular marker, the primer pair, or the identification method described herein in any of the following:

[0018] 1) Used for the identification of cotton varieties related to anthocyanin accumulation;

[0019] 2) Used for marker-assisted breeding of cotton.

[0020] Specifically, the identification or breeding refers to the cultivation of cotton varieties with light red stem phenotypes or green stem phenotypes. Specifically, the light red stem phenotype varieties have the GTGTCTCAACGGAAGC sequence, while the green stem phenotype varieties lack this sequence.

[0021] This invention has at least the following advantages and beneficial effects:

[0022] This invention provides InDel molecular markers for identifying anthocyanin accumulation in cotton. By using marker primers to detect whether cotton seeds or seedlings possess these molecular markers, it is possible to accurately, rapidly, and efficiently identify the normality of anthocyanin transport-related genes in cotton varieties at an early stage. The molecular markers of this invention are closely related to anthocyanin accumulation in cotton and can be effectively used for marker-assisted breeding of cotton. The method for identifying InDel molecular markers related to anthocyanin accumulation in cotton provided by this invention, compared to identification methods for other marker types such as SNPs, only requires conventional PCR and polyacrylamide gel electrophoresis detection, eliminating the need for sequencing. It is simple, rapid, and low-cost.

[0023] In specific experiments, the molecular marker of the present invention was verified by hybridization of upland cotton green stem mutant material rsl as the female parent and upland cotton red stem material SD3 as the male parent to obtain the hybrid F1 generation. The F1 generation was then self-pollinated to obtain an F2 self-pollinated population of 906 plants, and continuous self-pollination was used to obtain an F2:3 family population of 1136 plants. The accuracy rate was 100%. Therefore, the identification of cotton anthocyanin accumulation using this molecular marker is reliable. Attached Figure Description

[0024] Figure 1 The distribution of delta InDel-index on chromosomes for two offspring, with the horizontal axis representing chromosome length (Mb) and the vertical axis representing Δ (InDel index).

[0025] Figure 2 The distribution of delta_All-index on chromosomes for two offspring, with the horizontal axis representing chromosome length (Mb) and the vertical axis representing Δ(All index).

[0026] Figure 3 The image shows the CDS sequence alignment of the GhAT1 gene in materials with normal anthocyanin transport-related genes in the red phenotype of stems and materials without anthocyanin transport-related genes in the blue phenotype of stems.

[0027] Figure 4 Polypropylene gel electrophoresis images of InDel-labeled offspring: A, parental polypropylene gel electrophoresis images; M: DS2000, 1-2: red-stemmed parents, 3-4: green-stemmed parents; B, F2 population progeny polypropylene gel electrophoresis images; M: DS2000, 5-6, 8: red-stemmed progeny, 9-10, 11-12, 15: green-stemmed progeny; 1-4, 7, 11, 14, 16-17, 19-21: heterozygous light-red-stemmed progeny.

[0028] Figure 5 This is a box plot showing the distribution of total anthocyanin content in the stems of some individuals corresponding to the genotypes at the Indel locus in the F2 population of Example 3 of this invention. 1 / 1 represents the homozygous individual genotype with normal anthocyanin accumulation, 1 / 0 represents the heterozygous individual genotype with anthocyanin deficiency, and 0 / 0 represents the individual genotype with anthocyanin deficiency.

[0029] Figure 6 The results of localizing Indel markers related to anthocyanin accumulation in cotton populations. Detailed Implementation

[0030] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0031] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0032] This invention describes only preferred methods and materials; however, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0033] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0034] Example 1

[0035] 1. Using the upland cotton green-stemmed mutant material rsl as the female parent and the upland cotton red-stemmed material SD3 as the male parent, a hybrid F1 generation was obtained. The F1 generation was self-crossed to obtain the F2 generation. Twenty-five red-stemmed progeny SD3-25, 30 green-stemmed progeny rsl-30, one red-stemmed parent SD3, and one green-stemmed parent rsl were selected. 1-1.5g of young leaves were collected from each material and placed in correspondingly labeled 2ml centrifuge tubes. The collected 2ml centrifuge tubes containing leaf samples were stored at low temperature on dry ice and then sent to Beijing Novogene Co., Ltd. to construct a pooled sequencing pool for the parent and progeny types. The sterility trait gene was then located using pooled sequencing of extreme traits (BSA).

[0036] 2. DNA was extracted from the tender leaves of the samples using the CTAB method (Song Guoli, Cui Rongxia, Wang Kunbo, Guo Liping, Li Shaohui, Wang Chunying, Zhang Xiangdi. Rapid extraction of cotton DNA using a modified CTAB method. Cotton Science Journal 05(1998):50-52.). The extracted DNA passed the test. Following the standard procedure, the samples were randomly fragmented into 35bp fragments using a Covaris shredder. Library construction was performed using the TruSeq Library Construction Kit, and sequencing was performed using an Illumina HiSeq™ PE150. The obtained raw data was quality controlled to obtain clean data, which was then aligned to the upland cotton reference genome TM-1 (Zhang TZ, Hu Y, Jiang WK, et al. Sequencing of allotetraploid cotton (Gossypium hirsutum L.acc.TM-1) provides a resource for fiber improvement. Nat Biotechnol, 2015, 33(5):531-537.) using BWA software. The alignment rate of all aligned samples was between 98.54% and 99.55%, the average depth was between 10.53X and 28.02X, and the 1X and 4X coverage were greater than 96.04% and 89.74%, respectively (Table 1), which can be used for subsequent InDels detection and related analysis.

[0037] Table 1. Statistics on sequencing depth and coverage

[0038]

[0039]

[0040] 3. Based on the genotyping results, homozygous markers in the parents were screened, resulting in 305,835 InDels polymorphic markers selected from the offspring. TM-1 was chosen as the reference parent, and the InDel-index of the InDels marker sites between the two offspring was calculated. Figure 1 According to the InDel-index threshold, when the post-fit confidence P < 0.05, the target trait region is located on chromosome D07. Figure 2 The size of the InDels candidate interval is 2.75 MB Mb.

[0041] 4. Using the InDels of the candidate regions located by BSA, we designed 34 pairs of polymorphic primers and used DNA extracted from the young leaves of any one of the two parents as the amplification template. The amplified products were screened by polyacrylamide gel electrophoresis (Wang Lulu, Liu Xinting, Zhou Tao, et al. Optimization of silver staining polyacrylamide gel electrophoresis technology system [J]. Xinjiang Agricultural Sciences, 2019, 56(12):2312-2319.). When the target band was a single band and consistent with the SD3 band, it was a homozygous individual with normal anthocyanin accumulation; when the target band was a single band and consistent with the rs1 band, it was a homozygous individual with anthocyanin accumulation deficiency; when the target band was two bands, it was a heterozygous individual with anthocyanin accumulation deficiency in cotton. Finally, we successfully obtained 8 pairs of polymorphic primers related to anthocyanin accumulation in cotton. Subsequently, these eight primer pairs were used to amplify 906 F2 self-pollinated plants and 1136 F2:3 families obtained through continuous self-pollination. The amplified products were analyzed based on the number of exchanged individual plants counted by polyacrylamide gel electrophoresis and the results of field cotton fertility surveys. Finally, candidate genes were narrowed down to 8.0 kb on chromosome D07, and a genetic linkage map was constructed. Figure 6 The sequence contained two ORFs. Sequencing results showed that only the GhAT1 coding region had a 16bp deletion, further confirming that GhAT1 is a cotton anthocyanin transport-related gene, and the GhAT1 gene was ultimately identified as the candidate gene.

[0042] 5. The InDel molecular marker is located at positions 58-74 of the nucleotide sequence shown in SEQ ID No. 1. The sequence in this position is GGTCTCAACGGAAGC (SEQ ID No. 2) for the light red stem phenotype progeny and the parent SD3, while the [GTGTCTCAACGGAAGC] sequence is missing in the blue stem phenotype progeny (Table 2). The nucleotide sequence of SEQ ID No. 1 can be amplified using the upstream primer CTTAGCCCATCTACCCGCTCTT and the downstream primer TTGAGTGACCAAAAAACAAATAC. The amplified products were then verified by polyacrylamide gel electrophoresis. When the target band is 361 bp, it indicates a homozygous individual with normal anthocyanin accumulation; when the target band is 345 bp, it indicates a homozygous individual with a deficiency in anthocyanin accumulation; when there are two target bands, with lengths of 361 bp and 345 bp respectively, it indicates a heterozygous individual with a deficiency in anthocyanin accumulation in cotton.

[0043]

[0044]

[0045] SEQ ID No. 2: GTGTCTCAACGGAAGC.

[0046] Table 2. Base types of InDel marker sites in light red stem phenotype offspring and blue stem offspring.

[0047] InDel site Light red stem phenotype offspring / red stem paternal parent Green stems InDel SEQ ID No.2:GTGTCTCAACGGAAGC Missing

[0048] Example 2

[0049] Upland cotton green-stemmed mutant material rsl was used as the female parent and upland cotton red-stemmed material SD3 was used as the male parent for hybridization to obtain the hybrid F1 generation. The F1 generation was self-pollinated to obtain an F2 self-pollinated population of 906 plants, and continuous self-pollination yielded an F2:3 family of 1136 plants for DNA extraction. Amplification was performed using primers corresponding to InDel markers, and the target bands were statistically analyzed by polyacrylamide gel electrophoresis based on the amplification products. The results showed that among 2042 individual plants, 507 plants amplified to the target band of 361 bp using InDel marker primers, 1048 plants amplified to the target band of 345 bp, and 488 plants amplified to the target bands of both 361 bp and 345 bp. This indicates that, among the 2042 individual plants, 507 exhibited a red stem phenotype, 1048 exhibited a light red stem phenotype, and 488 exhibited a bluish stem phenotype, consistent with the results of the field cotton fertility survey (Table 3). These results demonstrate the significant role of the InDel marker in identifying cotton fertility.

[0050] Table 3. Identification of the InDel marker in the F2 self-crossed population and the F2:3 family population.

[0051] InDel marker site Number of individual plants with red stems Light red stems per plant Number of green stems per plant Marker identification status 507 1048 488 Field statistics 507 1048 488

[0052] Example 3

[0053] Weigh 0.10g of fresh stem tissue from individuals corresponding to the genotype of the Indel locus in the F2 population and place it in a 2ml centrifuge tube. Add two steel balls and quickly place the tube in liquid nitrogen. Use a high-speed shaker (CryoMill, USA) at 30r / s for 40s to break up the sample. Quickly add 1ml of methanol extraction buffer (containing 0.5% HCl), shake vigorously for 30s, remove the steel balls from the centrifuge tube with a magnet, and incubate at 4℃ in the dark for 48h. Mix the sample every 12h, centrifuge at 5000g for 10 minutes at 25℃, collect the supernatant, and dilute it with the extraction buffer at ratios of 1:10, 1:50, 1:100, 1:500, and 1:000. Measure the absorbance using a UV spectrophotometer, using the extraction buffer as a control. Measure the absorbance at 530nm, 620nm, and 650nm, and calculate the total anthocyanin content using the following formula:

[0054] Anthocyanin optical density value: ODλ=(OD530-OD620)-0.1x(OD650-OD620)

[0055] Anthocyanin content (μmol / g) = 106·ODλxV / (ε·M).

[0056] ODλ: Optical density of anthocyanin at 530 nm wavelength; ε: Molar extinction coefficient of anthocyanin 4.62×10⁶; V: Total volume of anthocyanin extract (ml); M: Mass of cotton leaf 0.10 g; 10⁶: Multiple of the calculation result to μmol.

[0057] In summary, in cotton breeding and practical production based on the upland cotton green stalk mutant material rsl, detecting whether cotton seeds or seedlings possess the InDel molecular marker allows for accurate, rapid, and efficient identification of whether anthocyanin transport-related genes in a cotton variety are functioning normally at an early stage. The molecular marker of this invention is closely related to anthocyanin accumulation in cotton and can be effectively used for marker-assisted breeding of cotton, which is of great significance for accelerating the breeding of high-quality new cotton varieties and improving the economic benefits of cotton.

[0058] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a reagent for detecting InDel molecular markers in marker-assisted breeding of cotton anthocyanin accumulation traits, characterized in that, The InDel molecular marker is located at positions 58-73 of the nucleotide sequence shown in SEQ ID No.

1. The sequence in this position is GTGTCTCAACGGAAGC in the light red stem phenotype progeny and parents, while this sequence is missing in the blue stem phenotype.

2. A method for identifying cotton varieties related to anthocyanin accumulation, characterized in that, Includes the following steps: 1) Extract genomic DNA from cotton seedlings to be tested; 2) Using the DNA extracted in step 1) as a template, PCR amplification was performed using a primer pair consisting of the upstream primer SEQ ID NO.1F and the downstream primer SEQ ID NO.1R; the nucleotide sequence of SEQ ID No.1F is: CTTAGCCCATCTACCCGCTCTT; the nucleotide sequence of SEQ ID No.1R is: TTGAGTGACCAAAAAACAAATAC; 3) When the amplification band is 361bp, it is a homozygous individual with normal anthocyanin accumulation; when the amplification band is 345bp, it is a homozygous individual with a deficiency in anthocyanin accumulation; when there are two amplification bands with lengths of 361bp and 345bp respectively, it is a heterozygous individual with a deficiency in anthocyanin accumulation in cotton.

3. The identification method as described in claim 2, characterized in that, In step 3), the PCR products amplified in step 2) are detected by polypropylene gel electrophoresis.

4. The application of the identification method as described in claim 2 or 3 in marker-assisted breeding of cotton involving anthocyanin accumulation traits.