Activatable transmembrane constructs and degraders

Abstract

The present application relates to an activatable cell-penetrating construct comprising a cell-penetrating moiety, a cleavable moiety and a masking moiety, wherein the cell-penetrating moiety is selected from the group consisting of a cell-penetrating peptide, an oligosaccharide peptide and any combination thereof, and / or the masking moiety is selected from a masking peptide. The activatable cell-penetrating construct forms an activatable degrader when linked to a target molecule-binding moiety. After the cleavable moiety is cleaved by an enzyme, the cell-penetrating moiety masked by the masking moiety is activated, thereby enabling the target molecule-binding moiety linked thereto to enter intracellular degradation. After being linked to the activatable cell-penetrating construct of the present application, whether it is a blocking antibody or a non-blocking antibody, the effect of activating T cells and killing tumor cells can be achieved, which has additional benefits.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically, to an activatable transmembrane construct for membrane protein degradation. Background Technology

[0002] Membrane proteins are key participants in intercellular interactions, playing crucial roles in vital processes such as cell signal transduction, differentiation and proliferation, and stress response. They directly influence the development and progression of many diseases, including malignant tumors and neuropathic pain, making them important drug targets. However, traditional drugs exert their effects by blocking the interaction between the extracellular domain and ligands of membrane proteins or inhibiting the activity of their intracellular domains, often resulting in incomplete inhibition or inducing drug resistance. Emerging protein-targeted degradation technologies (such as PROTACs) offer a novel approach to drug development, directly eliminating the protein machinery that causes abnormal phenotypes by specifically degrading intracellular targets. This unique mechanism of action is also applicable to traditionally undruggable targets, greatly expanding their druggable scope. It is worth noting that PROTACs primarily target intracellular proteins, while the development of membrane protein-targeted degradation technologies is still in its early stages, with significant technological needs and room for expansion, especially for membrane protein degradation technologies applicable to living organisms. Summary of the Invention

[0003] To address the problems existing in the prior art, the present invention provides the following technical solution.

[0004] In a first aspect of the invention, an activatable membrane-penetrating construct is provided, comprising a cell-penetrating moiety (CPM), a cleavable moiety (CM), and a blocking moiety (BM).

[0005] In some embodiments, the cell-penetrating portion is selected from: membrane-penetrating peptides (CPP), oligosaccharide peptides, and any combination thereof.

[0006] In some embodiments, the cell-penetrating portion contains 1 to 30 positively charged amino acid residues.

[0007] In some embodiments, the cell-penetrating portion is selected from polyarginine or polylysine, wherein the polyarginine or polylysine contains at least two amino acid residues.

[0008] In some embodiments, the polymer monomer of the polyarginine comprises D-configured arginine and / or L-configured arginine.

[0009] In some embodiments, the polymeric monomer of the polylysine comprises D-configured lysine and / or L-configured lysine.

[0010] In some embodiments, the masking portion is selected from blocking peptides (BP).

[0011] In some embodiments, the shielding portion comprises 1 to 30 negatively charged amino acid residues.

[0012] In some embodiments, the masking portion is selected from polyglutamic acid or polyaspartic acid, which contains at least two amino acid residues.

[0013] In some embodiments, the polymeric monomer of the polyglutamic acid comprises D-configured glutamic acid and / or L-configured glutamic acid.

[0014] In some embodiments, the polymeric monomer of the polyaspartic acid comprises D-configured aspartic acid and / or L-configured aspartic acid.

[0015] In some embodiments, the cleavable portion is a protease substrate peptide, that is, a peptide containing the cleavage site of the protease.

[0016] In some embodiments, the protease is selected from fibroblast activating proteins, urokinase-type plasminogen activator, matrix proteases, legumain, and matrix metalloprotease (MMP), preferably MMP2, MMP3, MMP9, or uPA.

[0017] In some embodiments, the cleavable portion has an amino acid sequence selected from SEQ ID NO.33-57 and 79-81.

[0018] In some embodiments, the various parts of the activatable membrane-penetrating construct are connected as follows: CPM-CM-BM.

[0019] In some embodiments, the free end of the cell-penetrating portion in the activatable transmembrane construct (i.e., the end opposite to the end connected to the cleavable portion) is connected to a sequence (G)n, where n is an integer selected from 1 to 10, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5.

[0020] In some embodiments, the activatable transmembrane construct further includes an Fc domain selected from the Fc domains of IgG, IgM, IgE, IgA, or IgD.

[0021] In some embodiments, the Fc domain is the Fc domain of IgG, such as the Fc domain of at least one of IgG1, IgG2, IgG3 or IgG4.

[0022] In some implementations, the Fc domain is derived from a human.

[0023] In some embodiments, the activatable membrane-penetrating construct comprises Fc-CPM-CM-BM from the N-terminus to the C-terminus.

[0024] In some embodiments, the activatable membrane-penetrating construct comprises Fc-LPXT(G)n-CPM-CM-BM from the N-end to the C-end, where n is an integer selected from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5.

[0025] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetration portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO.58), where n is an integer selected from 1 to 10, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and X is any amino acid, preferably E, K, N, Q, A.

[0026] In some embodiments, the activatable transmembrane construct further comprises a target-binding moiety (TBM). The TBM specifically binds to membrane proteins such as PD-L1 (programmed cell death ligand 1), PD-1 (programmed cell death receptor 1), EGFR (epidermal growth factor receptor), HER-2 (human epidermal growth factor receptor-2), or functional fragments thereof.

[0027] In some embodiments, the target molecule is selected from peptides, nucleic acids, small molecules, polysaccharides, lipids, nanoparticles, and any combination thereof.

[0028] In some embodiments, the target molecule binding portion comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the target molecule binding portion is linked to the N-terminus of the activatable transmembrane construct.

[0029] In some embodiments, the antigen-binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH, and any combination thereof.

[0030] In some embodiments, the target molecule binding portion comprises a plurality of (e.g., 2, 3, or 4) VHHs in tandem, preferably, each of the plurality of tandem VHHs targets a different binding epitope.

[0031] In a second aspect of the invention, an antibody or antigen-binding fragment thereof that specifically binds to PD-L1 or a fragment thereof is provided.

[0032] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, the VH comprising CDR1, CDR2, and CDR3, wherein the amino acid sequence of CDR1 is as shown in SEQ ID NO. 6, 12, 15, or 18, and / or the amino acid sequence of CDR2 is as shown in SEQ ID NO. 7, 13, 16, or 19, and / or the amino acid sequence of CDR3 is as shown in SEQ ID NO. 8, 9, 10, 11, 14, 17, or 20.

[0033] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, the amino acid sequences of which are shown in SEQ ID NO.6, 7 and 8, respectively (P43).

[0034] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, the amino acid sequences of which are shown in SEQ ID NO.6, 7 and 9, respectively (P15).

[0035] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, the amino acid sequences of which are shown in SEQ ID NO.6, 7 and 10, respectively (P28).

[0036] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, the amino acid sequences of which are shown in SEQ ID NO.6, 7 and 11, respectively (P24).

[0037] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, the amino acid sequences of which are shown in SEQ ID NO. 12, 13 and 14, respectively (P69).

[0038] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, the amino acid sequences of which are shown in SEQ ID NO.15, 16 and 17, respectively (P60).

[0039] In some embodiments, the antibody or its antigen-binding fragment contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2 and CDR3, the amino acid sequences of which are shown in SEQ ID NO.18, 19 and 20, respectively (P14).

[0040] In some embodiments, these CDRs may contain amino acid mutations that maintain the antibody's ability to specifically bind to PD-L1. Preferably, the amino acid mutation is an amino acid substitution, and the number of amino acid substitutions may be 1-3.

[0041] In some embodiments, the antibody or its antigen-binding fragment contains a VH comprising an amino acid sequence as shown in any of SEQ ID NO. 21-27 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% similarity to it.

[0042] In some embodiments, the antibody or its antigen-binding fragment contains a VH having an amino acid sequence as shown in any of SEQ ID NO. 21-27.

[0043] In some embodiments, the antibody or its antigen-binding fragment further includes an Fc domain, such as an Fc domain derived from IgG, IgM, IgE, IgA, or IgD.

[0044] In some embodiments, the Fc domain is the Fc domain of IgG, such as the Fc domain of at least one of IgG1, IgG2, IgG3 or IgG4.

[0045] In some implementations, the Fc is the Fc of human IgG.

[0046] In some implementations, the Fc contains N297A and / or N297G mutations.

[0047] In some embodiments, the C-terminus of the Fc has or is connected to an amino acid sequence LPXTGGGHHHHHH as shown in SEQ ID NO.28, where X is any amino acid, preferably E, K, N, Q, or A.

[0048] In a third aspect of the invention, a heavy chain antibody that specifically binds to PD-L1 or a fragment thereof is provided.

[0049] In some embodiments, the heavy chain antibody comprises at least two domains selected from cluster 1 heavy chain antigen-binding domains (VHH). 1 Cluster 2 heavy chain antigen-binding domain (VHH) 2 Cluster 3 heavy chain antigen-binding domain (VHH) 3 ), and cluster 4 heavy chain antigen-binding domain (VHH) 4 The antigen-binding domain of ) wherein:

[0050] The cluster 1 heavy chain antigen-binding domain (VHH) 1 It contains a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NO.6, 7 and 8 respectively (P43);

[0051] The cluster 1 heavy chain antigen-binding domain (VHH) 1 It contains a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NO.6, 7 and 9 respectively (P15);

[0052] The cluster 1 heavy chain antigen-binding domain (VHH) 1 It contains a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NO.6, 7 and 10 respectively (P28);

[0053] The cluster 1 heavy chain antigen-binding domain (VHH) 1 It contains a first CDR1, a first CDR2 and a first CDR3, whose amino acid sequences are shown in SEQ ID NO.6, 7 and 11 respectively (P24);

[0054] The cluster 2 heavy chain antigen-binding domain (VHH) 2 It contains a second CDR1, a second CDR2, and a second CDR3, whose amino acid sequences are shown in SEQ ID NO.12, 13, and 14, respectively (P69).

[0055] The cluster 3 heavy chain antigen-binding domain (VHH) 3 It contains third CDR1, third CDR2 and third CDR3, whose amino acid sequences are shown in SEQ ID NO.15, 16 and 17 respectively (P60);

[0056] The cluster 4 heavy chain antigen-binding domain (VHH) 4 It contains fourth CDR1, fourth CDR2 and fourth CDR3, whose amino acid sequences are shown in SEQ ID NO.18, 19 and 20 respectively (P14).

[0057] In some implementations, VHH 1It comprises, or is composed of, an amino acid sequence as shown in any of SEQ ID NO.21-24 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% similarity to such sequence.

[0058] In some implementations, VHH 2 It contains, or is composed of, an amino acid sequence as shown in SEQ ID NO.25 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% similarity to it.

[0059] In some implementations, VHH 3 It contains, or is composed of, an amino acid sequence as shown in SEQ ID NO.26 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% similarity to it.

[0060] In some implementations, VHH 4 It contains, or is composed of, an amino acid sequence as shown in SEQ ID NO.27 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% similarity to it.

[0061] In some embodiments, the heavy chain antibody comprises (1) cluster 1 and cluster 2 heavy chain antigen-binding domains; (2) cluster 1 and cluster 3 heavy chain antigen-binding domains; (3) cluster 1 and cluster 4 heavy chain antigen-binding domains; (4) cluster 2 and cluster 3 heavy chain antigen-binding domains; (5) cluster 2 and cluster 4 heavy chain antigen-binding domains; or (6) cluster 3 and cluster 4 heavy chain antigen-binding domains; or any combination thereof.

[0062] In some embodiments, the heavy chain antibody includes cluster 1 and cluster 2 heavy chain antigen-binding domains.

[0063] In some embodiments, the heavy chain antibody is a dimer comprising two peptide chains, wherein at least one peptide chain includes, from the N-terminus to the C-terminus, a first heavy chain antigen-binding domain (VHH1)-L1-a second heavy chain antigen-binding domain (VHH2)-Fc, wherein the first heavy chain antigen-binding domain (VHH1) and the second heavy chain antigen-binding domain (VHH2) are each independently selected from the group consisting of: cluster 1 heavy chain antigen-binding domain (VHH1)-L1-Fc. 1 Cluster 2 heavy chain antigen-binding domain (VHH) 2 Cluster 3 heavy chain antigen-binding domain (VHH) 3 ), and cluster 4 heavy chain antigen-binding domain (VHH) 4(), where L1 represents the connector. Preferably, VHH1 and VHH2 are selected from different clusters.

[0064] In some embodiments, the at least one peptide chain may further include a third heavy chain antigen-binding domain (VHH3), said third heavy chain antigen-binding domain (VHH3) selected from the group consisting of: cluster 1 heavy chain antigen-binding domain (VHH). 1 Cluster 2 heavy chain antigen-binding domain (VHH) 2 Cluster 3 heavy chain antigen-binding domain (VHH) 3 ), and cluster 4 heavy chain antigen-binding domain (VHH) 4 Preferably, VHH3 is selected from a different cluster than VHH1 and VHH2.

[0065] In some embodiments, the heavy chain antibody is a homodimer. In still other embodiments, the heavy chain antibody is a heterodimer, meaning that at least one of the at least two VHHs contained in one peptide chain is different from any of the at least two VHHs contained in the other peptide chain (e.g., selected from different clusters or having different sequences), or the arrangement or tandem sequence of the at least two VHHs contained in one peptide chain is different from the arrangement or tandem sequence of the at least two VHHs contained in the other peptide chain. In some embodiments, the VHHs in both peptide chains of the heterodimer are each independently selected from the cluster 1 heavy chain antigen-binding domain and the cluster 2 heavy chain antigen-binding domain.

[0066] In some embodiments, the heavy chain antibody further comprises an Fc domain, such as an Fc domain derived from IgG, IgM, IgE, IgA, or IgD. Preferably, the Fc domain is an Fc domain of IgG, such as an Fc domain of at least one of IgG1, IgG2, IgG3, or IgG4.

[0067] In some implementations, the Fc is the Fc of human IgG.

[0068] In some implementations, the Fc contains the N297A mutation and / or N297G.

[0069] In some embodiments, the C-terminus of the Fc is connected to the amino acid sequence LPXTGGGHHHHHH as shown in SEQ ID NO.28, where X is any amino acid, preferably E, K, N, Q, or A.

[0070] In a fourth aspect of the invention, an activatable degrader is provided for degrading membrane proteins, the activatable degrader comprising (1) a target molecule binding moiety (TBM) that specifically binds to membrane proteins, and (2) an activatable transmembrane construct according to a first aspect of the invention.

[0071] In some embodiments, the target molecule binding portion comprises an antibody or an antigen-binding fragment thereof, preferably, the antigen-binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH and any combination thereof.

[0072] In some embodiments, the membrane protein is selected from PD-L1, PD-1, EGFR, HER-2, or functional fragments thereof.

[0073] In some embodiments, the target molecule binding portion comprises a plurality of VHHs in tandem.

[0074] In some embodiments, the target molecule binding portion is connected to the N-terminus of the activatable transmembrane construct.

[0075] In some embodiments, the antibody or its antigen-binding fragment has an Fc domain. In some embodiments, the C-terminus of the Fc domain is linked to the cell-penetrating portion (CPM) of the activatable transmembrane construct.

[0076] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetration portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO. 58), where n is an integer selected from 1 to 10, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and where X is any amino acid, preferably E, K, N, Q, A.

[0077] In a fifth aspect of the invention, an activatable degrader for degrading PD-L1 is provided, the activatable degrader comprising (1) an antibody or an antigen-binding fragment thereof according to a second aspect of the invention, or a heavy chain antibody according to a third aspect of the invention, and (2) an activatable membrane-penetrating construct according to a first aspect of the invention.

[0078] In some embodiments, the antibody or its antigen-binding fragment, or the heavy chain antibody, has an Fc domain. In some embodiments, the C-terminus of the Fc domain is linked to the cell-penetrating portion (CPM) of the activatable transmembrane construct.

[0079] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetration portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO. 58), where n is an integer selected from 1 to 10, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and where X is any amino acid, preferably E, K, N, Q, A.

[0080] In a sixth aspect of the invention, a nucleic acid molecule is provided that encodes an activatable membrane-penetrating construct according to the first aspect, an antibody or antigen-binding fragment thereof according to the second aspect of the invention, a heavy chain antibody according to the third aspect of the invention, or an activatable degrader according to the fourth or fifth aspect of the invention.

[0081] In a seventh aspect of the invention, a carrier is provided that comprises a nucleic acid molecule according to a sixth aspect of the invention.

[0082] In an eighth aspect of the invention, a cell is provided that comprises a nucleic acid molecule according to a sixth aspect of the invention or a carrier according to a seventh aspect of the invention.

[0083] In a ninth aspect of the invention, a composition is provided comprising an activatable membrane-penetrating construct according to a first aspect of the invention, an antibody or antigen-binding fragment thereof according to a second aspect of the invention, a heavy chain antibody according to a third aspect of the invention, an activatable degrader according to a fourth or fifth aspect of the invention, a nucleic acid molecule according to a sixth aspect of the invention, a vector according to a seventh aspect of the invention, and / or a cell according to an eighth aspect of the invention, and a pharmaceutically acceptable carrier.

[0084] In a tenth aspect of the invention, a kit is provided comprising an activatable membrane-penetrating construct according to a first aspect of the invention, an antibody or antigen-binding fragment thereof according to a second aspect of the invention, a heavy chain antibody according to a third aspect of the invention, an activatable degrader according to a fourth or fifth aspect of the invention, a nucleic acid molecule according to a sixth aspect of the invention, a vector according to a seventh aspect of the invention, and / or a cell according to an eighth aspect of the invention.

[0085] In an eleventh aspect of the invention, a method for treating a disease is provided, the method comprising administering to a subject in need a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to a second aspect of the invention, a heavy chain antibody according to a third aspect of the invention, an activatable degradable component according to a fourth or fifth aspect of the invention, a nucleic acid molecule according to a sixth aspect of the invention, a carrier according to a seventh aspect of the invention, or a composition according to a ninth aspect of the invention.

[0086] In some embodiments, the disease is associated with the expression or overexpression of the membrane protein. In some embodiments, the disease is cancer. In some embodiments, the cancer is selected from squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), lung cancer (including small cell lung cancer, non-small cell lung cancer, adenocarcinoma, and squamous cell carcinoma of the lung), peritoneal cancer, hepatocellular carcinoma, gastric cancer (including gastrointestinal cancer and gastrointestinal stromal carcinoma), bone cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or cervical cancer, salivary gland cancer, kidney cancer or ureteral cancer, prostate cancer, vaginal cancer, vulvar cancer, thyroid cancer, anal cancer, penile cancer, melanoma, bile duct cancer, central nervous system (CNS) tumors, spinal axis tumors, brainstem glioma, glioblastoma multiforme, astrocytoma. Cytomas, schwannomas, ependymomas, myeloma, meningiomas, squamous cell carcinomas, pituitary adenomas and Ewing's sarcomas, superficial diffuse melanomas, malignant lentigines melanomas, acral melanomas, nodular melanomas, multiple myeloma and B-cell lymphomas, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myeloid leukemia and post-transplant lymphoproliferative disorders (PTLD), as well as abnormal angiogenesis associated with phakomatoses, edema (such as that associated with brain tumors) and Meigs syndrome, brain tumors and brain cancers, and head or neck cancers and associated metastatic cancers.

[0087] In a twelfth aspect of the invention, a method for activating T cells is provided, the method comprising using an anti-PD-L1 antibody or an antigen-binding fragment thereof linked to an activatable transmembrane construct of the first aspect.

[0088] In some embodiments, the antigen-binding fragment is selected from Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH, and any combination thereof.

[0089] In some embodiments, the antibody is a blocking antibody. In still other embodiments, the antibody is a non-blocking antibody.

[0090] In some embodiments, the antibody or its antigen-binding fragment has an Fc domain. In some embodiments, the C-terminus of the Fc domain is linked to the cell-penetrating portion (CPM) of the activatable transmembrane construct.

[0091] In some embodiments, the C-terminus of the Fc domain is connected to the cell penetration portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO. 58), where n is an integer selected from 1 to 10, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and where X is any amino acid, preferably E, K, N, Q, A.

[0092] In some embodiments, the antibody is selected from antibodies or antigen-binding fragments thereof according to the second aspect of the present invention, or heavy chain antibodies according to the third aspect of the present invention.

[0093] In a thirteenth aspect of the invention, a method is provided for preparing an activatable membrane-penetrating construct according to a first aspect, an antibody or antigen-binding fragment thereof according to a second aspect of the invention, a heavy chain antibody according to a third aspect of the invention, or an activatable degrader according to a fourth or fifth aspect of the invention.

[0094] In some embodiments, the method includes using a transpeptidase to cleave and ligate the C-terminal LPTG sequence (SEQ ID NO. 62) (where X is any amino acid sequence) of a first peptide chain to the N-terminal GGG sequence of a second peptide chain to form a ligation product containing the LPTGGG sequence (SEQ ID NO. 30). The first peptide chain may be, for example, the cell-penetrating portion of the activatable membrane-penetrating construct, or the Fc domain of the activatable degrader; correspondingly, the second peptide chain may be, for example, the shielding portion of the activatable membrane-penetrating construct, or the activatable membrane-penetrating construct within the activatable degrader. Attached Figure Description

[0095] Figure 1 The structure of the activatable degradant according to the present invention is illustrated schematically.

[0096] Figure 2 The schematic diagram illustrates the working principle of the activatable degradants according to the present invention.

[0097] Figure 3 This shows an SDS-PAGE electrophoresis image of a human Fc single-domain antibody.

[0098] Figure 4 This demonstrates the binding activity of the hPD-L1 heavy chain antibody against cell surface antigens.

[0099] Figure 5 The bar chart shows the blocking efficiency of the hPD-L1 antibody.

[0100] Figure 6 The graph shows the blocking efficiency of hPD-L1 antibody versus log10 (concentration / nM).

[0101] Figure 7 A Western blot analysis showing the effect of hPD-L1 heavy chain antibody degrader on protein cleavage.

[0102] Figure 8 SDS-PAGE analysis of bispecific antibodies against hPD-L1 dual epitope heavy chain antibody degraders is shown.

[0103] Figure 9A and 9B The mass spectra of high-purity hPD-L1 biepisode antibody P69-P43-hFc and its degradation derivative P69-P43-hFc TAC are shown respectively.

[0104] Figure 10 This image shows the effect of cleaving PD-L1 by a degrader based on an hPD-L1 dual epitope antibody.

[0105] Figure 11 A bar chart showing the degree of T cell activation by the hPD-L1 dual epitope antibody-based degraders in PD-1 / PD-L1 BlockadeBioassays.

[0106] Figure 12 This shows how degraders formed by linking the same biepisode antibody with different transmembrane peptides degrade PD-L1 on the cell surface.

[0107] Figure 13 A bar chart showing the degree of T cell activation in PD-1 / PD-L1 Blockade Bioassays, where the degradation products formed by linking the same biepisode antibody to different transmembrane peptides are displayed.

[0108] Figure 14A and 14B The mass spectrometry peaks of the conditionally activated degrader CAMBOTAC and its release of the masking peptide under the action of MMP-9 are shown respectively.

[0109] Figure 15 This demonstrates the release of the conditionally activated degrader under the action of MMP-9 to degrade PD-L1 on the cell surface.

[0110] Figure 16 This is a bar chart showing the fold increase in T cell activation by the conditionally activated degrader CAMBOTAC in PD-1 / PD-L1 Blockade Bioassays.

[0111] Figures 17A to 17E The results were displayed separately in the negative control HBSS (injection). Figure 17A ), positive control Envida ( Figure 17B ),CAMBOTAC1 ( Figure 17C ),CAMBOTAC2 ( Figure 17D ) and CAMBOTAC3 ( Figure 17E The curve showing the change in tumor volume over time. Detailed Implementation

[0112] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0113] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0114] The term "about" as used herein is as understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is unfamiliar with the use of this term in the context in which it is used, "about" will mean a particular value plus or minus 10%.

[0115] An epitope is a portion of an antigen that is specifically bound by an antibody. Epitopes typically consist of chemically active (e.g., polar, nonpolar, or hydrophobic) surface groups, such as amino acids or polysaccharide side chains, and may possess specific three-dimensional structural features and charge characteristics. Epitopes can be composed of continuous and / or discontinuous amino acids forming conformational spatial units. For discontinuous epitopes, amino acids from different parts of the linear antigen sequence approach each other in three-dimensional space through protein folding. The identification of an antibody epitope depends on the method used.

[0116] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein and refer to a polymer of amino acids of any length, which may include coding and non-coding amino acids, chemically or biochemically modified or derived amino acids, and polypeptides having a modified peptide backbone. These terms also include polypeptides with co-translational modifications (e.g., signal peptide cleavage) and post-translational modifications, such as disulfide bond formation, glycosylation, acetylation, phosphorylation, proteolytic cleavage, etc.

[0117] The term "antibody" generally refers to a polypeptide or polypeptide complex that specifically recognizes and binds to an antigen, including but not limited to polyclonal, monoclonal, single-specific, multi-specific, non-specific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutated, and transplanted antibodies. Antibodies can be complete antibodies or any antigen-binding fragments or single chains. A basic 4-chain antibody unit can be a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. Each L chain can be linked to an H chain via a covalent disulfide bond, while two H chains can be linked to each other via one or more disulfide bonds. Each H chain typically includes an N-terminal heavy chain variable region and a subsequent heavy chain constant region. The heavy chain variable region may include a variable domain (VH), and the heavy chain constant region typically includes three to four constant domains (CH). Each L chain also includes a variable region containing a variable domain (VL) and a constant region containing a constant domain (CL). VL corresponds to VH, and CL may correspond to the first constant domain (CH1) of the heavy chain. Antibodies typically consist of six CDRs: three heavy chain CDRs in VH and three light chain CDRs in VL.

[0118] The term "heavy chain antibody" or "HCAb" refers to a functional antibody that does not have a light chain, and the heavy chain constant region sequence of the heavy chain antibody does not contain the CH1 sequence. Heavy chain antibodies with high specificity and affinity against a variety of antigens can be generated through immunization (van der Linden, RH, et al. Biochim. Biophys. Acta. 1431, 37-46 (1999)).

[0119] When used in this application, "VH domain" refers to the variable domain of the H chain of the antibody.

[0120] When used in this application, "VHH domain" refers to the variable domain of the H chain of an HCAb. The terms "single-domain antibody," "nanobody," and "VHH" have the same meaning.

[0121] The term "antibody fragment" or "antigen-binding fragment" refers to a portion of an antibody, such as Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affibody, dAb, VHH, and / or other antibody fragments that maintain antigen-binding function. Typically, such fragments may include an antigen-binding domain.

[0122] The term "heavy chain constant region" encompasses the amino acid sequence derived from the immunoglobulin heavy chain, in the order CH1-hinge region-CH2-CH3. According to the EU Index, the hinge region of IgG is generally defined as including Glu216 of human IgG1 and terminating at Pro230. However, functionally, the flexible portion of this chain can be considered to include additional residues called the upper hinge region and the lower hinge region, such as from Glu216 to Gly237, while the lower hinge region typically refers to residues 233 to 239 of the Fc region, which is usually associated with FcyR binding. Hinge regions of other IgG isotypes can be aligned with the IgG1 sequence by placing the first and last cysteine ​​residues to form an inter-heavy chain SS bond. The CH1 domain is adjacent to the Vn domain and the N-terminus of the hinge region and includes the first (N-terminal) constant region of the immunoglobulin heavy chain, for example, approximately EU positions 118-215. The Fc domain extends from amino acid 231 to amino acid 447; the CH2 domain extends from Ala231 to Lys340 or Gly341; and the CH3 domain extends from Gly341 or Gln342 to Lys447. The residues of the IgG heavy chain region in the CH1 region terminate at Lys. Molecules containing the Fc domain include at least the antibody constant regions CH2 and CH3, and therefore at least the IgG heavy chain constant region from approximately Ala231 to Eys447. Molecules containing the Fc domain may optionally include at least a portion of the hinge region.

[0123] The CH2 domain in this paper may be a native CH2 domain or a variant CH2 domain. The CH3 domain in this paper may be a native CH3 domain or a variant CH3 domain. The CH2 domain may contain one or more mutations that reduce or eliminate the binding of the CH2 domain to one or more Fcγ receptors (e.g., FcγRI, FcγRIIa, FcγRIIb, FcγRIII) and / or complement. It is presumed that reducing or eliminating binding to Fc receptor γ will reduce or eliminate antibody-mediated ADCC. Similarly, reducing or eliminating binding to complement is expected to reduce or eliminate antibody-mediated CDC. Mutations that reduce or eliminate the binding of the CH2 domain to one or more Fcγ receptors and / or complement are known in the art.

[0124] The term "chimeric antibody" typically refers to an antibody in which the variable region originates from one species and the constant region originates from another species. Typically, the variable region may be derived from antibodies from laboratory animals such as rodents ("parental antibodies"), and the constant region from human antibodies, making the resulting chimeric antibody less likely to elicit an adverse immune response in human individuals compared to parental (e.g., mouse-derived) antibodies.

[0125] The term "humanized antibody" generally refers to an antibody in which some or all of the amino acids outside the CDR region of a non-human antibody (e.g., a mouse antibody) are replaced by corresponding amino acids derived from human immunoglobulins. Small additions, deletions, insertions, substitutions, or modifications of amino acids within the CDR region are also permissible, as long as they retain the antibody's ability to bind to a specific antigen. Humanized antibodies may optionally contain at least a portion of the constant region of human immunoglobulins. "Humanized antibodies" may retain antigen specificity similar to the original antibody. The "humanized" form of a non-human (e.g., mouse) antibody may contain, to a minimum, chimeric antibody with a sequence derived from a non-human immunoglobulin. In some cases, CDR region residues in a human immunoglobulin (receptor antibody) may be replaced with CDR region residues from a non-human species (donor antibody) (such as a mouse, rat, rabbit, or non-human primate) having the desired properties, affinity, and / or capabilities. In some cases, FR region residues in a human immunoglobulin may be replaced with corresponding non-human residues. Furthermore, humanized antibodies may contain amino acid modifications not present in the recipient antibody or the donor antibody. These modifications can be made to further improve antibody performance, such as binding affinity.

[0126] The terms “polynucleotide,” “oligonucleotide,” “nucleic acid,” and “nucleic acid molecule” are used interchangeably in this document to refer to polymeric forms of nucleotides (ribonucleotides or deoxyribonucleotides).

[0127] The term "vector" refers to a polynucleotide capable of replicating within or moving between biological systems. Vector polynucleotides typically contain elements such as origins of replication, polyadenylation signals, or selection markers, which facilitate the replication or maintenance of these polynucleotides within biological systems (such as cells, viruses, animals, plants, and recombinant organisms) using biological components capable of replicating the vector. Vector polynucleotides can be single-stranded or double-stranded DNA or RNA molecules, cDNA, or hybrids thereof.

[0128] The term "expression vector" refers to a vector that can be used to guide the translation of a polypeptide encoded by a polynucleotide sequence present in the expression vector, either in a biological system or in a recombinant biological system.

[0129] The term "specific binding" refers to the greater affinity of an antibody for a specific antigen compared to other antigens. Typically, this affinity is higher when the antibody's equilibrium dissociation constant (K0) is greater. D Approximately 1×10 -8 When M is smaller, it is considered that the antibody "specifically binds", for example, at approximately 1 × 10⁻⁶. -9 M or smaller, approximately 1×10 -10 M or smaller, approximately 1×10 -11 M or smaller, or approximately 1×10 -12 M or smaller, usually KD At least compared to its binding to non-specific antigens (such as BSA, casein) K D 100 times smaller. K D It can be measured using standard procedures.

[0130] The term “treatment” refers to achieving the desired pharmacological and / or physiological effect. An effect is preventative if it can completely or partially prevent a disease or its symptoms, and therapeutic if it can partially or completely cure a disease and / or adverse effects caused by that disease. As used herein, “treatment” covers any treatment of a disease in mammals (e.g., humans) and includes (a) preventing the disease from occurring in a subject who may be susceptible but has not yet been diagnosed with it; (b) suppressing the disease, i.e., preventing its development; and (c) alleviating the disease, even if it subsides.

[0131] The terms “individual,” “subject,” “host,” and “patient” are used interchangeably in this document and refer to mammals, including but not limited to mice (e.g., rats, mice), raccoons (e.g., rabbits), non-human primates, humans, canines, felines, ungulates (e.g., horses, cattle, sheep, pigs, goats), etc.

[0132] The three-letter or single-letter abbreviations for amino acids used in this article are shown in Table 1 below.

[0133] Table 1

[0134] amino acids Three letters single letter alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C glutamine Gln Q glutamic acid Glu E glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F proline Pro P Serine Ser S threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V

[0135] Before further describing this disclosure, it should be understood that this disclosure is not limited to the specific embodiments described, as they may vary. It should also be understood that the terminology used herein is for descriptive purposes only and is not intended to be restrictive.

[0136] Activable membrane-penetrating constructs

[0137] In one aspect of the invention, an activable membrane-penetrating construct is provided, comprising a cell penetrating moiety (CPM), a cleavable moiety (CM), and a blocking moiety (BM).

[0138] In some implementations, the portions of the activatable transmembrane construct are connected as follows: CPM-CM-BM. Unless explicitly stated otherwise, this connection is not directional, meaning it can represent a connection from the N-end to the C-end or from the C-end to the N-end.

[0139] In some embodiments, the activatable membrane-penetrating construct further comprises an Fc domain of an antibody, including but not limited to IgG, IgM, IgE, IgA, and IgD.

[0140] In some embodiments, the activatable membrane-penetrating construct further includes a target molecule binding portion.

[0141] In some embodiments, the target molecule binding portion or the Fc domain is connected to the N-terminus of the activatable membrane-penetrating construct, in which case the activatable membrane-penetrating construct includes either the target molecule binding portion -CPM-CM-BM or Fc-CPM-CM-BM from the N-terminus to the C-terminus.

[0142] In some embodiments, the target molecule binding portion is connected to the C-terminus of the activatable membrane-penetrating construct, in which case the activatable membrane-penetrating construct includes the BM-CM-CPM-target molecule binding portion from the N-terminus to the C-terminus.

[0143] In some embodiments, the activatable transmembrane construct contains a target molecule binding portion only at the N-terminus or C-terminus. That is, the activatable transmembrane construct does not contain target molecule binding portions at both ends simultaneously. For example, if the N-terminus contains a target molecule binding portion, then the C-terminus does not contain an additional target molecule binding portion. The additional target molecule binding portion may target lysosomes or proteasomes, or be capable of binding to cell surface receptors that promote endocytosis, such as the mannose-6-phosphate receptor (M6PR) or desialyl glycoprotein receptor.

[0144] Cell Penetrating Moiety (CPM)

[0145] In this application, "penetration" (e.g., membrane penetration, cell penetration) includes the movement of a molecule from the extracellular space into the cell by any means, such as into the cytosol, nucleus, or other subcellular compartments. Cell penetration may also include endosome uptake (e.g., via macropinocytosis, clathrin-mediated endocytosis, cell membrane pit-mediated endocytosis, or other endocytosis), followed by endosome expulsion, causing the molecule to leave the endosome and enter the cytosol.

[0146] In some embodiments, the cell-penetrating portion is a cell-penetrating peptide (or membrane-penetrating peptide, the two terms are interchangeable). Membrane-penetrating peptides include any peptide capable of penetrating cell layers (e.g., penetrating the cell membrane, nuclear envelope, intercellular space, paracellular space, endosomal membrane, lysosomal membrane, or other subcellular compartment membranes). Membrane-penetrating peptides can enter the cytosol or the cell nucleus. In some embodiments, the cell-penetrating peptides of this application, in an activated state, can penetrate or enter target cells, such as diseased cells like tumor cells, or healthy cells such as hepatocytes, lung cells, breast cells, pancreatic cells, and colon cells.

[0147] In some embodiments, the cell-penetrating peptide of this application may comprise one or more positively charged amino acid residues (e.g., lysine or arginine). The positively charged amino acid residues can mediate the interaction between the cell-penetrating peptide and negatively charged cell layers (e.g., cell membrane, nuclear envelope, intercellular space, paracellular space, endosomal membrane, lysosomal membrane, or other subcellular compartment membranes). In some embodiments, the cell-penetrating peptide used in this application comprises 1 to 30 positively charged amino acid residues, such as 2 to 30, 3 to 30, 4 to 30, 5 to 30, 1 to 20, 2 to 20, 3 to 20, 4 to 20, 5 to 20, 1 to 15, 2 to 15, 3 to 15, 4 to 15, 5 to 15, 6 to 15, 7 to 15, or 8 to 15. In some embodiments, the cell-penetrating peptide used in this application comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 positively charged amino acid residues. In some embodiments, the cell-penetrating peptide used in this application comprises no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, no more than 11, no more than 12, no more than 13, no more than 14, no more than 15, no more than 16, no more than 17, no more than 18, no more than 19, no more than 20, no more than 21, no more than 22, no more than 23, no more than 24, no more than 25, no more than 26, no more than 27, no more than 28, no more than 29, or no more than 30 positively charged amino acid residues.

[0148] In some embodiments, the cell-penetrating peptide used in this application may contain one or more lysine residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15, or 8-15 lysine residues. In some embodiments, the cell-penetrating peptide used in this application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 lysine residues. In some embodiments, the cell-penetrating peptide used in this application contains no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 lysine residues.

[0149] In some embodiments, the cell-penetrating peptide used in this application may contain one or more arginine residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15, or 8-15 arginine residues. In some embodiments, the cell-penetrating peptide used in this application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 arginine residues. In some embodiments, the cell-penetrating peptide used in this application contains no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 arginine residues.

[0150] In some embodiments, the cell-penetrating peptide of this application may contain at least one negatively charged amino acid residue (e.g., aspartic acid or glutamic acid). In some embodiments, the cell-penetrating peptide used in this application may contain no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 negatively charged amino acid residues.

[0151] In some embodiments, the cell-penetrating peptide of this application may contain at least one aspartic acid residue. In some embodiments, the cell-penetrating peptide used in this application may contain no more than 2, 3, 4, 5, 6, 7, or 8 aspartic acid residues.

[0152] In some embodiments, the cell-penetrating peptide of this application may contain at least one glutamic acid residue. In some embodiments, the cell-penetrating peptide used in this application may contain no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 glutamic acid residues.

[0153] In all embodiments, the cell-penetrating peptide of this application contains a higher number of positively charged amino acid residues than negatively charged amino acid residues.

[0154] Blocking Moiety (BM)

[0155] A shielding portion is a part that, when present, reduces or inhibits the interaction between the cell-penetrating portion and the cell membrane. This shielding portion may interfere with, inhibit, or reduce the interaction between the cell-penetrating portion and the cell membrane through steric hindrance; it may also interfere with, inhibit, or reduce the interaction between the cell-penetrating portion and the cell membrane through affinity interactions that specifically bind to the cell-penetrating portion.

[0156] In some embodiments, the masking portion is a masking peptide. In some embodiments, the masking peptide may comprise one or more negatively charged amino acid residues (e.g., glutamic acid or aspartic acid). In some embodiments, the masking peptide used in this application comprises 1 to 30 positively charged amino acid residues, such as 2 to 30, 3 to 30, 4 to 30, 5 to 30, 1 to 20, 2 to 20, 3 to 20, 4 to 20, 5 to 20, 1 to 15, 2 to 15, 3 to 15, 4 to 15, 5 to 15, 6 to 15, 7 to 15, or 8 to 15. In some embodiments, the masking peptide used in this application comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 negatively charged amino acid residues. In some embodiments, the masking peptide used in this application comprises no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 negatively charged amino acid residues.

[0157] In some embodiments, the masking peptide used in this application may contain one or more glutamic acid residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15, or 8-15 glutamic acid residues. In some embodiments, the masking peptide used in this application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 glutamic acid residues. In some embodiments, the masking peptide used in this application contains no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 glutamic acid residues.

[0158] In some embodiments, the masking peptide used in this application may contain one or more aspartic acid residues, such as 1-30, 2-30, 3-30, 4-30, 5-30, 1-20, 2-20, 3-20, 4-20, 5-20, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15, or 8-15 aspartic acid residues. In some embodiments, the masking peptide used in this application includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 aspartic acid residues. In some embodiments, the masking peptide used in this application contains no more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 aspartic acid residues.

[0159] In some embodiments, the masking peptide of this application may contain at least one uncharged amino acid residue (e.g., glycine, threonine, or serine). In some embodiments, the masking peptide used in this application may contain no more than 2, 3, 4, 5, 6, 7, or 8 uncharged amino acid residues.

[0160] In some embodiments, the masking peptide of this application may contain at least one glycine residue. In some embodiments, the masking peptide used in this application may contain no more than 2, 3, 4, 5, 6, 7, or 8 glycine residues.

[0161] In some embodiments, the masking peptide of this application may contain at least one threonine residue. In some embodiments, the masking peptide used in this application may contain no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 threonine residues.

[0162] In some embodiments, the masking peptide of this application may contain at least one serine residue. In some embodiments, the masking peptide used in this application may contain no more than 2, no more than 3, no more than 4, no more than 5, no more than 6, no more than 7, or no more than 8 serine residues.

[0163] In all embodiments, the masking peptide of this application contains a higher number of negatively charged amino acid residues than the number of uncharged amino acid residues.

[0164] Cleavable Moiety (CM)

[0165] A "cleavable moiety" is a peptide substrate that can be cleaved by an enzyme. When used in this application, the cleavable moiety and the cleavable linker are used interchangeably. After enzymatic cleavage, the cleavable moiety activates the cell-penetrating portion that was previously blocked by the masked portion. Preferably, the cleavable moiety is selected so that activation occurs at a desired site of action, which may be a site within or near a target cell (e.g., a cancer cell) or tissue (e.g., tumor tissue). For example, the cleavable moiety may be a specific peptide substrate of an enzyme that is specifically or highly expressed at the site of action, thereby causing the cleavable moiety to cleave at the target site at a higher rate than at sites other than the target site.

[0166] In an activated state (e.g., when the construct is exposed to a protease capable of cleaving the cleavable portion), the masking portion can separate from the cell-penetrating portion, thereby producing a product with transmembrane activity. The activatable transmembrane construct can be designed to selectively activate upon exposure to diseased tissue, rather than in normal tissue. For example, the activatable transmembrane construct may be designed to have one or more cleavable membrane fragments (CMs). The protease that cleaves one or more CMs may be overexpressed in diseased tissue relative to healthy tissue. The activatable transmembrane construct can be activated upon cleavage of the cleavable portion, such that the cell-penetrating portion therein can exert its activity in diseased tissue (e.g., in the tumor microenvironment), but not in the environment of healthy tissue.

[0167] Preferably, the enzyme is present in the extracellular environment of the diseased tissue or organ. Examples of such proteases include: aspartic proteases (e.g., renin), fibroblast activating proteins (FAP), aspartic cathepsins (e.g., cathepsin D, caspase 1, caspase 2, etc.), cysteine ​​cathepsins (e.g., cathepsin B), cysteine ​​proteases (e.g., Legumin), integrin / metalloproteinases (ADAMS, e.g., ADAM8, ADAM9), integrin / metalloproteinases with platelet-reactive protein motifs (ADAMTS, e.g., ADAMTS1), integrated membrane serine proteases (e.g., matrix proteases 2, MT-SPL / matrix proteases, TMPRSS2, TMPRSS3, TMPRSS4), kallikrein-related peptidases (KLK, e.g., KLK4, KLK5), matrix metalloproteinases (e.g., MMP-1, MMP-2, MMP-9), and serine proteases (e.g., cathepsin A, coagulation factor proteases such as elastase, plasmin, thrombin, PSA, uPA, factor Vila, factor Xa, and HCV NS3 / 4).

[0168] Preferably, the enzyme is fibroblast activation protein (FAP), urokinase-type plasminogen activator (UPA, urokinase), MT-SPL / matrix protease, Legumain, or matrix metalloproteinase (especially MMP-1, MMP-2, and MMP-9). Those skilled in the art will understand that the selection of the enzyme and the corresponding cleavable moiety will depend on the disease to be treated and the protease (one or more) expressed by the affected tissue or organ.

[0169] The cuttable connectors applicable to this invention are shown in Table 2.

[0170] Table 2

[0171]

[0172]

[0173] Target Binding Moiety (TBM)

[0174] The target molecule binding portion suitable for this invention is preferably an antibody or its antigen-binding fragment, such as a heavy chain antibody or its antigen-binding portion.

[0175] The target molecules are selected from polypeptides, nucleic acids, small molecules, polysaccharides, lipids, nanoparticles, and any combination thereof.

[0176] In some embodiments, the target molecule is a membrane protein, particularly a membrane-bound membrane protein. In some embodiments, the membrane protein is selected from members of the B7 family, members of the tumor necrosis factor receptor superfamily, members of the TNF receptor superfamily, members of the CD28 family, members of the ATP binding cassette transporter (ABC), members of the serine / threonine kinase receptor family, members of the receptor tyrosine kinase family, and CD38 extracellular enzymes.

[0177] In some embodiments, the membrane protein is a member of the B7 family, preferably PD-1, PD-L1, or PD-L2, with PD-L1 being the most preferred.

[0178] In some embodiments, the membrane protein is a member of the EGF receptor family; VEGF receptor family; FGF receptor family; IGF receptor family; HGF receptor family; or AXL receptor family. In some embodiments, the membrane protein is a member of the EGF receptor family, preferably EGFR; ErbB-2 or ErbB-3, preferably ErbB-2.

[0179] In some embodiments, the membrane protein is a member of the TNF receptor superfamily, preferably CD137, OX40, CD40 or CD30.

[0180] In some embodiments, the target molecule binding portion of the present invention is an antibody or antigen-binding fragment thereof that specifically binds to PD-L1 or a fragment thereof but does not activate T cells. In some embodiments, the antibody or antigen-binding fragment thereof is a heavy chain antibody or an antigen-binding fragment thereof.

[0181] In some embodiments, the antibody is a dimer comprising two peptide chains, and can be a homodimer or a heterodimer. In some embodiments, each heavy chain of the antibody contains only one heavy chain variable region (VH), such as VHH. In some embodiments, each heavy chain of the antibody contains two or more heavy chain variable regions (VH), such as VHH. Preferably, the two or more heavy chain variable regions target different antigenic determinants, i.e., different epitope regions of the same or different molecules. Different antigenic determinants may correspond to independent or different amino acid sequences, or may have partial overlap in amino acid sequences.

[0182] Activable Degrader

[0183] The activatable degrader of the present invention can be obtained by linking the activatable membrane-penetrating construct of the present invention to the target molecule binding portion, particularly to an antibody or antigen-binding fragment thereof (especially a heavy chain antibody or antigen-binding fragment thereof) according to the present invention. In some embodiments, the C-terminus of the activatable membrane-penetrating construct is linked to the N-terminus of the antibody. In some embodiments, the N-terminus of the activatable membrane-penetrating construct is linked to the C-terminus of the Fc domain of the antibody. This linking can be achieved by any conventional peptide linking method in the art, such as chemical linking or enzyme-catalyzed linking.

[0184] In some embodiments, click chemistry is used to link an activatable membrane-penetrating construct to the Fc domain of a corresponding antibody. For example, the linking can be performed by contacting an activatable membrane-penetrating construct and an antibody, respectively coupled with a first and a second click chemical handle, under suitable conditions. Exemplary click chemical handles include azide coupling agents, including 3-azidopropionic acid sulfonyl-NHS ester, azidoacetic acid-NHS ester, azido-PEG-NHS ester, azidopropylamine, azido-PEG-amine, azido-PEG-maleimide, disulfone-PEG-azido, or derivatives thereof. In some embodiments, the azide coupling agent comprises an azidoalkyl moiety, an azidoaryl moiety, or an azidoheteroaryl moiety. Other click chemistry handles are described in McKay and Finn (2014) Chem. Biol. 21(9): 1075–101, and Lahann, J. (ed.) Click Chemistry for Biotechnology and Materials Science, John Wiley & Sons, West Sussex, 2009, which are incorporated herein by reference in their entirety.

[0185] In some implementations, a bifunctional cross-linking agent (e.g., an NHS ester-maleimide heterobifunctional cross-linking agent) is used to link the membrane-penetrating construct to the Fc domain of the corresponding antibody.

[0186] In some implementations, transpeptidase, isopeptidase, transglutaminase (see, for example, Steffen et al. (2017) J. Biol. Chem. 292(38):15622-35), sorting enzyme (e.g., sorting enzyme A or sorting enzyme B) or cyclase (e.g., cyclase 1) are used to link the activatable transmembrane construct to the Fc domain of the corresponding antibody.

[0187] In one specific embodiment, the ligation is achieved via a transpeptidase. Transpeptidase (SrtA) is a polypeptide ligase that recognizes and cleaves the LPXTG sequence (SEQ ID NO. 62) or LPXT sequence (SEQ ID NO. 63) (where X is any amino acid sequence, preferably E, K, N, Q, A) (e.g., LPETG (SEQ ID NO. 64) or LPET (SEQ ID NO. 65)) at the C-terminus of one protein or polypeptide and the GGG sequence at the N-terminus of another protein or polypeptide, ultimately forming a ligation product containing the LPXTGGG sequence (SEQ ID NO. 30). Therefore, in some embodiments, the C-terminus of the Fc domain of the antibody is linked to the cell penetration portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n (SEQ ID NO. 58), where n is an integer selected from 1 to 10, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably 1 to 5, and where X is any amino acid, preferably E, K, N, Q, A.

[0188] Figure 1 An activatable degradable peptide according to one embodiment of the invention is shown, which is a dimer comprising two peptide chains, wherein each peptide chain comprises, from the N-terminus to the C-terminus, a first heavy chain antigen-binding domain (VHH1)-L1-a second heavy chain antigen-binding domain (VHH2)-CH2-CH3-cell-penetrating peptide-cleavable linker L2-masking peptide.

[0189] Figure 2 The mechanism of action of the activatable degrader according to the invention is illustrated, wherein the target molecule binding portion binds to the target antigen, such as a membrane protein on the surface of cancer cells, while simultaneously, for example in the tumor microenvironment, the cleavable linker L2 is cleaved, releasing a masking peptide, thereby activating the activatable transmembrane construct of the invention. In the absence of the masking peptide, the cell-penetrating peptide functions, promoting the endocytosis and degradation of the target antigen through interaction with the cell membrane.

[0190] Therefore, compared to traditional therapies, the activatable degradants provided by this invention can provide reduced toxicity and reduce the on-target / off-tumor situation.

[0191] Heavy chain variable zone connector L1

[0192] In the antibody or antigen-binding fragment thereof of the present invention, or in an activatable degrader containing said antibody or antigen-binding fragment, when it contains multiple heavy chain variable regions VH or VHH, said multiple heavy chain variable regions can be linked by conventional peptide linkers or linking peptides or linkers. Linkers are typically peptides containing 2 to 20 amino acids; preferably, the linkers used to link different heavy chain variable regions are stable linkers, i.e., linkers that do not contain restriction enzyme sites.

[0193] Those skilled in the art can readily select suitable connectors, exemplary connectors including but not limited to polyglycine (G)y, poly(glycine-serine) (including, for example, (GS)y, (GSGGS)y (SEQ ID NO. 66), (GGGS)y (SEQ ID NO. 67), (GGGGS)y (SEQ ID NO. 68), where y is an integer selected from 1 to 20, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20), poly(glycine-alanine), poly(alanine-serine), and poly(alanine-proline).

[0194] In some embodiments, the connector is poly(glycine-serine), such as (GSGGS)7 (SEQ ID NO. 69), (GGGS)7 (SEQ ID NO. 70), and (GGGGS)7 (SEQ ID NO. 71).

[0195] In some embodiments, the linker is a glycine polymer. Exemplary linkers may comprise amino acid sequences, including but not limited to: GGS; GGSG (SEQ ID NO. 72); GGSGG (SEQ ID NO. 73); GGGGS (SEQ ID NO. 74); GGSSG (SEQ ID NO. 75); GGSGG (SEQ ID NO. 76); GGGSG (SEQ ID NO. 77); GSSSG (SEQ ID NO. 78), etc.

[0196] In some embodiments, the linker is an alanine-proline polymer. Exemplary linkers may comprise an amino acid sequence, including but not limited to (AP)n, where n is an integer selected from 1 to 20, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20.

[0197] Nucleic acid

[0198] The present invention also provides a nucleic acid encoding the activatable transmembrane construct of the present invention, or an antibody or its antigen-binding fragment, or a heavy chain antibody, or an activatable degrader. The present invention also provides a vector comprising said nucleic acid, and cells comprising said nucleic acid or said vector.

[0199] As used herein, the term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers inserted nucleic acid molecules into host cells and / or between host cells. The vector may include vectors primarily for inserting DNA or RNA into cells, vectors primarily for replicating DNA or RNA, and expression vectors primarily for transcription and / or translation of DNA or RNA. The vector also includes vectors having a variety of the functions described above. The vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, by culturing suitable host cells containing the vector, the vector can produce the desired expression product.

[0200] Methods for constructing suitable vectors comprising any of the nucleic acids described in this application and suitable for transforming cells (e.g., mammalian cells) are well known in the art, and can be seen, for example, in *Molecular Cloning: A Laboratory Manual*, 2nd edition, Cold Spring Harbor Publishing, 1989, edited by Sambrook et al., and *Current Protocols in Molecular Biology*, Current Protocols, 1993, edited by Ausubel et al. Non-limiting examples of vectors include plasmids, transposons, colloids, and viral vectors (e.g., any adenovirus vector (e.g., pSV or pCMV vectors), adeno-associated virus (AAV) vectors, lentiviral vectors, and retroviral vectors) and any Carrier.

[0201] Nucleic acids and vectors can be introduced into suitable hosts using any method known in the art, and the transformed host cells can be cultured and selected in vitro, such as calcium chloride-mediated transformation, transduction, and coupling; triparental mating; DEAE; dextran-mediated transfection and infection; liposome membrane fusion; gene gun method; direct microinjection into single cells; and electroporation. After the nucleic acid or vector of the present invention is introduced into cells, the cells are cultured under conditions suitable for expressing the encoded sequence, and then antibodies or their antigen-binding fragments or portions can be isolated from the cells.

[0202] Pharmaceutical composition or kit

[0203] The present invention provides pharmaceutical compositions comprising the activatable membrane-penetrating construct of the present invention, or an antibody or an antigen-binding fragment thereof, or a heavy chain antibody, or an activatable degrader, or a nucleic acid, or a carrier, or a cell.

[0204] Pharmaceutical compositions typically contain therapeutically or preventively effective amounts of the active ingredient as described above, which is usually formulated into the desired composition after adequate purification, together with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include excipients, diluents, antioxidants, preservatives, colorants, flavoring agents, emulsifiers, suspending agents, solvents, fillers, buffers, delivery media, tension agents, co-solvents, wetting agents, complexing agents, antimicrobial agents, and surfactants, etc.

[0205] The composition may be in liquid, powder, or lyophilized form, and may include one or more lyophilization protectants, excipients, surfactants, or fillers. The compositions of the present invention are suitable for parenteral administration, for example, by injection or infusion into animals via any of the following routes: intra-articular, subcutaneous, intravenous, intramuscular, intraperitoneal, intracranial (within brain parenchyma), intraventricular, intramuscular, intraocular, intra-arterial, intralesional, rectal, percutaneous, oral, and inhalation routes.

[0206] In some embodiments, the activatable membrane-penetrating constructs of the present invention, or antibodies or their antigen-binding fragments, or heavy chain antibodies, or activatable degradants, or nucleic acids, or vectors or cells may also be formulated as kits.

[0207] Treatment methods and applications

[0208] The present invention provides a method for treating a disease, the method comprising administering to a subject in need a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to the invention, a heavy chain antibody, an activatable degrader, a nucleic acid molecule, a carrier, or a pharmaceutical composition.

[0209] In some embodiments, the disease is associated with the expression or overexpression of the membrane protein. In some embodiments, the disease is cancer. In some embodiments, the cancer is selected from squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), lung cancer (including small cell lung cancer, non-small cell lung cancer, adenocarcinoma, and squamous cell carcinoma of the lung), peritoneal cancer, hepatocellular carcinoma, gastric cancer (including gastrointestinal cancer and gastrointestinal stromal carcinoma), bone cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or cervical cancer, salivary gland cancer, kidney cancer or ureteral cancer, prostate cancer, vaginal cancer, vulvar cancer, thyroid cancer, anal cancer, penile cancer, melanoma, bile duct cancer, central nervous system (CNS) tumors, spinal axis tumors, brainstem glioma, glioblastoma multiforme, astrocytoma. Cytomas, schwannomas, ependymomas, myeloma, meningiomas, squamous cell carcinomas, pituitary adenomas and Ewing's sarcomas, superficial diffuse melanomas, malignant lentigines melanomas, acral melanomas, nodular melanomas, multiple myeloma and B-cell lymphomas, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myeloid leukemia and post-transplant lymphoproliferative disorders (PTLD), as well as abnormal angiogenesis associated with phakomatoses, edema (such as that associated with brain tumors) and Meigs syndrome, brain tumors and brain cancers, and head or neck cancers and associated metastatic cancers.

[0210] The present invention also provides a method for activating T cells, the method comprising using an anti-PD-L1 antibody or an antigen-binding fragment thereof linked to an activatable transmembrane construct of the present invention, such as Fab, Fab', F(ab)2, F(ab')2, Fv, scFv, Fd, affinity antibody, dAb, VHH, and any combination thereof.

[0211] The antibodies applicable to this invention can be either blocking antibodies or non-blocking antibodies.

[0212] Traditional anti-PD-L1 antibodies require rigorous screening targeting specific binding epitopes and are often difficult to obtain. These antibodies, upon binding to the target, block the binding of PD-1 and PD-L1, activating T cells; hence, they are called blocking antibodies. Conversely, non-blocking antibodies, upon binding to the target, do not block the binding of PD-1 and PD-L1 or activate T cells; therefore, they are usually candidates to be screened out in the selection of therapeutic anti-PD-L1 antibodies.

[0213] This invention connects anti-PD-L1 antibodies or their antigen-binding fragments to conditionally activatable membrane-penetrating constructs, enabling both blocking and non-blocking antibodies to activate T cells and kill tumor cells, thus providing additional benefits.

[0214] Example

[0215] The following embodiments and accompanying drawings are provided to aid in understanding the present invention. However, it should be understood that these embodiments and drawings are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0216] Example 1: Obtaining anti-hPD-L1 single-domain antibody:

[0217] 1.1 Alpaca Immunity

[0218] A new Chilean alpaca (Lama alpacos) was selected, and 0.8 mg of antigen protein was thoroughly mixed with adjuvant and immunized at multiple sites once a week. The first and second immunizations used PD-L1 (ECD) fused with human Fc antigen, and the third, fourth and fifth immunizations used PD-L1 (ECD) fused with 6×His tag antigen to stimulate B lymphocytes to produce single-domain antibodies that specifically target PD-L1 (ECD).

[0219] One week after each immunization, blood was collected from alpacas, and the antibody titer in the serum was measured using enzyme-linked immunosorbent assay (ELISA). The coating protein was PD-L1 (ECD) fused with a 6×His tag antigen, and the detection antibody was Goat anti-llama IgG (HRP) (Abcam, Cat#ab112786). The antibody titer in the serum was significantly increased after 5 rounds of immunization, which was then used for subsequent library construction and screening experiments.

[0220] 1.2 Construction of phage display library

[0221] After five immunizations, lymphocytes were extracted from 50 ml of peripheral blood from alpacas, and total mRNA was extracted using an RNA extraction kit provided by Thermo Fisher Scientific. The extracted mRNA was then reverse transcribed into cDNA using the Novizan HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Cat#R312-02). Nested PCR was used to amplify the variable region nucleic acid fragment of the heavy chain antibody.

[0222] First round of PCR:

[0223] Primer F1: CTTGGTGGTCCTGGCTGC (SEQ ID NO:1);

[0224] Primer R1: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO:2);

[0225] The second round of PCR was performed using the products from the first round of PCR as templates.

[0226] Primer F2: ACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC (SEQ ID NO: 3);

[0227] Primer R2-1: CTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG (SEQ ID NO: 4);

[0228] Primer R2-2: CTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG (SEQ ID NO: 5);

[0229] The variable region fragment of the target heavy chain antibody was recovered via gel extraction. The VHH fragment and the phage display vector pComb3XSS were digested with the restriction endonuclease Sfi I. The digested VHH fragment and the vector were then ligated at a 1:3 molar ratio at 16°C for 16 h. The ligation product was electroporated into E. coli TG1 competent cells to construct a PD-L1 single-domain antibody phage display library, and the library quality was evaluated. The library size was determined to be 6.72 × 10⁻⁶. 8 To test the insertion rate of the library, 20 colony clones were randomly selected for sequencing and identification. The results showed that the correct insertion rate was 100%, indicating that the constructed phage display library was of high quality and could be used for screening PD-L1 single-domain antibodies.

[0230] 1.3 Screening of PD-L1 single-domain antibodies:

[0231] Take 100 μg of PD-L1(ECD)-LPETG-6His fusion protein and label it with GGGK (biotin) using a sortase-mediated labeling reaction (custom-synthesized by Hangzhou Zhuntai Biotechnology). Then, bind it to 100 μl of SA magnetic beads (Beaver, Cat#22307-1). Take 10 μl of the antigen-loaded magnetic beads and combine them with 100 μl of bacteriophage (1x10⁻¹) obtained in the previous step. 11The cells were co-incubated with PBS (pH 7.4, 0.05% Tween 20) at room temperature for 1 hour. Then, they were washed five times with PBST (PBS pH 7.4, 0.05% Tween 20) to remove phage display single-domain antibodies that did not bind to the PD-L1 (ECD) antigen. The phages specifically targeting the PD-L1 single-domain antibody were then eluted with 100 mM triethylamine and used to infect *E. coli* TG1 cells in logarithmic growth phase. The cells were infected at 37°C for 1 hour, cultured overnight, and the phages were collected for the next round of screening. This screening process was repeated four times to gradually enrich the phages specifically targeting the PD-L1 single-domain antibody.

[0232] 1.4 Screening for PD-L1-specific positive clones using phage enzyme-linked immunosorbent assay (ELISA):

[0233] After four rounds of biological panning, the PD-L1-6HIS fusion protein was plated, and E. coli were infected with phages. 128 single colonies were picked and cultured separately to purify the corresponding M13 phage displaying single-domain antibodies. These were added to the wells of an ELISA plate coated with PD-L1(ECD)hFc overnight and incubated at 37°C for 1 hour. The plates were washed five times with PBST to remove non-specifically bound single-domain antibodies. Mouse Anti-M13 Antibody (HRP) (Sino Biological, Cat#11973-MM05T-H) was added, and the plates were incubated at 37°C for 1 hour. The plates were washed five times with PBST to remove unbound primary antibodies. A luminescent substrate was added, and the luminescence value was read on a microplate reader. A positive clone was defined as one whose luminescence value was three times or more than that of the control well. The bacteria corresponding to the positive clones were transferred to LB broth for sequencing. Amino acid sequence alignment analysis of the sequencing results yielded three sequence-specific single-domain antibodies, the amino acid sequences of which are shown in Table 3.

[0234] Table 3. Sequence-specific single-domain antibody amino acid sequences

[0235]

[0236] 1.5 Expression and purification of heavy chain antibody variable region in Escherichia coli

[0237] Seven single-domain antibody-encoding nucleic acid sequences were synthesized and sequenced, cloned into the expression vector pET-21a(+)(Novagen, Cat#69740) and tagged with His. The clones were then transformed into *E. coli* expression strain BL21(DE3) and plated on LB agar containing 100 μg / mL kanamycin, incubated overnight at 37°C. Single clones were inoculated into 2 mL of LB liquid agar containing kanamycin and cultured at 37°C for 8–12 h until the plateau phase. The clones were then transferred 1:100 to fresh medium and cultured at 37°C until the OD value reached 0.6–0.9. IPTG inducer at a final concentration of 0.1 mM was added, and expression was induced at 28°C for 12–16 h. The bacterial cells were collected by centrifugation, and the lysate was obtained by sonication. The supernatant was collected by high-speed centrifugation, and the His-tagged single-domain antibodies were purified using a nickel column.

[0238] 1.6 Fortebio assay for the affinity of single-domain antibodies for PD-L1

[0239] The assay used a Fortebio Octet Red 96 instrument and a matching streptavidin probe (Fortebio, CAT#18-5020). The purified single-domain antibody from *E. coli* was diluted to 500 nM, 125 nM, 31 nM, 7.8 nM, and 1.95 nM with equilibration buffer (PBS, 0.05% Tween-20, 0.5% BSA). The BLI assay was performed as follows: (1) Sensor check: Immerse the sensor in equilibration buffer for 60 s. (2) PD-L1 immobilization: Immerse the sensor in 5 μg / ml Biotylated-PD-L1 (Sino biological, CAT#50010-M08H-B) solution for 200 s. (3) Baseline: Immerse the sensor in equilibration buffer for 60 s. (4) Correlation: Immerse the sensor in different concentrations of the test sample for 200 s. (5) Dissociation: Immerse the sensor in equilibration buffer for 200 s. (6) Washing: The sensor was immersed in washing buffer 1 (0.1M glycine-HCl, pH 2.2) for 5 s, then immersed in washing buffer 2 (PBS, 0.05% Tween-20-20, 0.5% BSA) for 5 s, for a total of 3 cycles. Curve fitting was performed using Fortebio Octet data analysis software, and the binding forces were measured as shown in Table 2.

[0240] Table 4. Binding affinity of antibody strains

[0241] Serial Number Antibody strain KD(nM) 1 P43 6.71 2 P15 9.97 3 P28 NA 4 P24 NA 5 P69 16.92 6 P60 18.74 7 P14 28.71

[0242] Example 2: Identification of non-blocking hPD-L1 heavy chain antibodies

[0243] 2.1 Preparation of hPD-L1 heavy chain antibody

[0244] The PD-L1 antibody nucleic acid sequence was codon-optimized, and the human IgG1 constant region Fc and LPETGGGHHHHHH sequences (SEQ ID NO:29) were added to its C-terminus. The sequence was then cloned into a pEF vector and synthesized by Anshengda Gene Technology Co., Ltd. The obtained plasmid-derived glycerol bacteria were first selected and transferred to 2 mL of ampicillin-resistant LB broth. After the bacteria reached the plateau phase, they were amplified by 1:100 transfer and cultured at 37°C for 12–18 h. The bacteria were then collected by centrifugation, and endotoxin-free plasmids were extracted.

[0245] After plasmid extraction, it was transfected into HEK293 cells for expression, as follows: HEK 293 cells were cultured to a height of 2.0 × 10⁶ cells / year. 6 At a cell density of [number] cells / mL, viability was determined to be 95% using trypan blue staining. Prepare 100 mL of cells, dissolve 100 μg of endotoxin-free plasmid in 1.5 mL of serum-free medium (Yonglian Biotechnology (Shanghai) Co., Ltd.), then take another 1.5 mL of serum-free medium and add 400 μL of 1 mg / mL PEI transfection reagent (Ploysciences, Inc., CAT#23966-2). Let stand for 5 minutes. Add the PEI mixture to the plasmid mixture and incubate at room temperature for 10 minutes. Then add the mixture to HEK 293 cells and incubate at 37°C in an 8% CO2 shaker for 4 days. Collect the cell culture supernatant, centrifuge at 4000g for 10 minutes, and then centrifuge the supernatant at high speed to remove impurities. Purify the hPD-L1 heavy chain antibody using a pre-packed Protein A column, ultrafilter to concentrate the replacement buffer, add 10% glycerol to PBS solution, store at -30°C, and aliquot for use. SDS-PAGE electrophoresis was used to detect the eukaryotic expression and purification of the antibody containing the human Fc single domain. The detection results are as follows: Figure 3 As shown.

[0246] 2.2 FACS characterization of the binding activity of hPD-L1 heavy chain antibody to cell surface antigens

[0247] Take 1×10 from each sample 6 One MDA-MB-231PD-L1 EGFP cell line (a stable cell line established by transfecting the PD-L1 / EGFP gene with lentivirus into MDA-MB-231 cells) was resuspended in HBSS buffer. The aforementioned hPD-L1 heavy chain antibody containing the Fc fragment and anti-human Fc fluorescent secondary antibody were added to a final concentration of 100 nM. The cells were incubated at 4°C in the dark for 1 h. After washing three times with HBBS, the cells were analyzed using an Invitrogen Attune NXT analyzer. The results are as follows: Figure 4 As shown.

[0248] The results showed that the hPD-L1 heavy chain antibodies P43-Fc and P69-Fc described in this application can bind to MDA-MB-231PD-L1 EGFP cells overexpressing hPD-L1.

[0249] 2.3 The effect of PD-L1 heavy chain antibody on T cell activation in PD-1 / PD-L1 Blockade Bioassays

[0250] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium supplemented with 10% FBS, 1% Penn-Strep, 1% Penn-Strep, and 200 μg / mL wet mycotoxin B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin, and 500 μg / mL wet mycotoxin B (growth medium). PD-L1 aAPC / CHO-K1 cells were seeded at 100 μL per well, for a total of 1.5 million cells, in white 96-well microplates (Corning, CAT#3917). After overnight (16–18 h) culture and cell attachment, the culture supernatant was discarded, and 50 μL of 100 nM hPD-L1 antibody was added. KN035-Fc (Kangning Biotech, Envita) was used as a positive control. The cells were incubated for 30 min, and then 50 μL of 1.8 million PD-1NFAT-Luc / Jurkat cells were added and incubated for 6 hours. After cooling to room temperature for 10 min, 100 μL of luciferase reporter assay reagent (Yeasen, CAT#11404ES80) was added to the reaction wells for bioluminescence assay. The bioluminescence intensity was measured using a TECAN microplate reader, and the bioluminescence intensity of the sample group divided by the bioluminescence intensity of the blank control was used as the fold increase in T cell activation.

[0251] See results Figure 5 and Figure 6 Analysis of four hPD-L1 antibodies revealed that P43-Fc, P69-Fc, and P14-Fc did not show significant blocking effects. Although P60-Fc showed some blocking effect, its IC50 was more than 50 times lower than that of the positive control KN035-Fc.

[0252] Example 3: Construction of hPD-L1 heavy chain antibody degrader

[0253] 3.1 Transpeptidase links the transmembrane peptide to the C-terminus of the hPD-L1 single-domain antibody Fc.

[0254] SrtA is a polypeptide ligase that recognizes the C-terminal LPXTG sequence (SEQ ID NO. 62) or LPXT sequence (SEQ ID NO. 63) of a protein (where X is any amino acid sequence) (e.g., LPETG (SEQ ID NO. 64) or LPET (SEQ ID NO. 65)) and the N-terminal GGG sequence of another protein or polypeptide, and performs cleavage and ligation to form a ligation product containing the LXTGGG sequence (SEQ ID NO: 30). In this example, the target antibody is a monoclonal antibody that specifically binds to hPD-L1, and the transmembrane peptide sequence is GGG-(D-Arg)9-NH2 (SEQ ID NO: 31) (where all Arg are in the D configuration and synthesized by Hangzhou Zhuntai Biotechnology). In this ligation reaction system, the molar ratio of each component is hPD-L1 antibody: GGG-(D-Arg)9-NH2: SrtA = 1:20:0.2. Finally, CaCl₂ is added to the reaction system to a final concentration of 5 mM. 2， The reaction system was maintained at pH 8.0 and incubated at 37°C for 2 hours. The reaction was terminated by adding the SrtA terminator MTSET (Bairdi, CAT#BN15003) and incubating at room temperature for 5–10 minutes. Desalting column treatment was then performed to remove unreacted small molecules, yielding high-purity anti-hPD-L1 degradation molecules.

[0255] Characterization of PD-L1 degradation on the surface of MDA-MB-231PD-L1 / EGFP cells by 3.2h PD-L1 heavy chain antibody degraders

[0256] In this example, the cell line used to evaluate the degradation effect of PD-L1 was MDA-MB-231PD-L1 / EGFP (a stable cell line established by transfecting the PD-L1 / EGFP gene into MDA-MB-231 cells using lentivirus). The growth medium for MDA-MB-231PD-L1 / EGFP was high-glucose DMEM + 10% FBS + 1% PS. The cells were seeded in 24-well plates, approximately 100,000 cells per well, and 100 nM of anti-hPD-L1 heavy chain antibody degrader was added. The plates were incubated at 37°C in a 5% CO2 incubator for 12 h. After incubation, the cell culture supernatant was discarded, and Western blotting and IP lysis buffer (Beyotime, cat#P0013) were added. The plates were lysed on ice for 10 min, and the lysates were collected. The total protein content in the lysates was quantitatively analyzed using a BCA kit (Yayou Biotech, cat#ZJ102). The total protein content was kept consistent across wells for Western blot analysis.

[0257] See results Figure 7HBSS served as the blank control group. Anti-hPD-L1 degraders showed varying degrees of degradation effects, and the degradation levels all need to be improved.

[0258] Example 4: Construction of hPD-L1 dual-epitope heavy chain antibody degrader

[0259] 4.1 Preparation of Fc fusion protein of hPD-L1 dual epitope antibody

[0260] The construction of the hPD-L1-targeting biepisode antibody involved tandemly linking two hPD-L1-specific nanobody sequences with seven repeating GGGGS sequences (SEQ ID NO:32), along with an Fc fragment and an LPETGGGHHHHHH sequence (SEQ ID NO:29). An N297A mutation was designed into the Fc fragment. The designed sequences were synthesized by Anshengda Gene Technology Co., Ltd. The biepisode hPD-L1 antibody expression and purification process followed the steps in 2.1 of Example 2 without discrimination. SDS-PAGE analysis of the purified bispecific antibody is shown below. Figure 8 As shown.

[0261] 4.2 Peptidase ligates the transmembrane peptide to the C-terminus of the hPD-L1 dual epitope antibody Fc.

[0262] Following the steps in 3.1 of Example 3, a non-discriminatory operation was performed to obtain high-purity degradation products based on hPD-L1 dual epitope antibodies.

[0263] 4.3 Mass spectrometry confirmed successful transmembrane peptide ligation.

[0264] High-purity hPD-L1 biepisode antibody-based degraders were analyzed by replacing the buffer with 50 mM ammonium acetate solution using an ultrafiltration tube, followed by centrifugation at 12000 rpm for 5 min. Molecular weight was analyzed using deconvolution software. Figure 9A and 9B As shown, the connection efficiency reached 100%.

[0265] Characterization of PD-L1 degradation on cell surface by 4.4hPD-L1 dual epitope antibody-based degraders

[0266] Following the steps in 3.2 of Example 3, a non-discriminatory operation was performed to obtain the degradation status of hPD-L1 on the surface of MDA-MB-231PD-L1 / EGFP cells by the degrader based on the hPD-L1 dual epitope antibody.

[0267] like Figure 10 As shown, the degradation ability of the hPD-L1 dual epitope antibody-based degrader for PD-L1 was significantly improved compared with that of the hPD-L1 single epitope antibody-based degrader.

[0268] 4.5h PD-L1 biepisode antibody-based degraders on T cell activation in PD-1 / PD-L1 Blockade Bioassays

[0269] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium supplemented with 10% FBS, 1% Penn-strep, 1% Penn-strep, and 200 μg / mL wet mycotoxin B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin, and 500 μg / mL wet mycotoxin B (growth medium). PD-L1 aAPC / CHO-K1 cells were seeded at 50 μL per well, for a total of 1.5 weeks, in white 96-well microplates (Corning, cat#3917), followed by 50 μL of 100 nM degrader dilution buffer. KN035-Fc (Corning, Envita) was used as a positive control. After overnight (16-18 hours) cell attachment, the culture supernatant was discarded, and the cells were washed three times with PBS or DPBS buffer. Then, 100 μL of 1.8w PD-1NFAT-Luc / Jurkat cells were added and incubated for 6 hours. The cells were then removed from the incubator and cooled to room temperature for 10 minutes. 100 μL of luciferase reporter gene assay reagent (Yeasen, CAT#11404ES80) was added to each well for luminescence assay. The luminescence intensity was measured using a TECAN microplate reader. The results are as follows: Figure 11 As shown.

[0270] The results showed that the degrader prepared from the P69-P43-Fc-based dual epitope antibody exhibited the highest activation effect, and P69-P43-Fc was selected as the dual epitope antibody for hPD-L1 binding in subsequent studies.

[0271] Example 5: Comparison of the degradation abilities of degraders of the target antigen hPD-L1 by C-terminal L-configuration membrane-penetrating peptide degraders and D-configuration membrane-penetrating peptide degraders of dual-epitope heavy chain antibodies.

[0272] 5.1 Preparation of Fc fusion protein of hPD-L1 dual epitope antibody

[0273] The construction of the hPD-L1-targeting dual epitope antibody involved tandemly linking two hPD-L1-specific nanobody sequences with seven repeating GGGGS sequences (SEQ ID NO:32), along with an Fc fragment and an LPETGGGHHHHHH sequence (SEQ ID NO:29). An N297A mutation was designed into the Fc fragment. The designed sequences were synthesized by Anshengda Gene Technology Co., Ltd. The expression and purification process of the P43-P69-Fc antibody was performed without differentiation according to the steps in 2.1 of Example 2.

[0274] 5.2 Transpeptidase links the L-configuration and D-configuration transmembrane peptides to the C-terminus of the P43-P69-Fc antibody Fc.

[0275] Following the steps in 3.1 of Example 3, the same procedure was performed using transpeptidase to ligate the L-configuration and D-configuration transmembrane peptides (GGG-(Arg)9-NH2 (SEQ ID NO:31), wherein the Arg molecules were either entirely L-configuration or D-configuration (synthesized by Hangzhou Zhuntai Biotechnology)) to the C-terminus of the P43-P69-Fc antibody Fc. In this ligation reaction system, the molar ratio of each component was hPD-L1 antibody: transmembrane peptide: SrtA = 1:20:0.2. Finally, 5 mM CaCl2 was added to the reaction system to maintain the pH at approximately 8.0. The reaction was incubated at 37°C for 2 hours, and the SrtA termination reagent MTSET (Bayerdi, CAT#BN15003) was added, followed by incubation at room temperature for 5–10 minutes to terminate the reaction. Desalting column treatment was performed to remove unreacted small molecules, yielding high-purity anti-hPD-L1 degradation peptides.

[0276] 5.3 Characterization of PD-L1 degradation on cell surface by P43-P69-Fc antibody-based degraders

[0277] Following the steps in 3.2 of Example 3, a non-discriminatory operation was performed to obtain the degradation status of hPD-L1 on the surface of MDA-MB-231PD-L1 / EGFP cells by the degrader based on the hPD-L1 dual epitope antibody linked to the L-configuration membrane-penetrating peptide and the D-configuration membrane-penetrating peptide.

[0278] like Figure 12 As shown, the degraders based on hPD-L1 dual epitope antibodies linked to L-configuration membrane-penetrating peptides have limited ability to degrade PD-L1. Therefore, in subsequent studies, degraders based on hPD-L1 dual epitope antibodies linked to D-configuration membrane-penetrating peptides were selected.

[0279] 5.4 The effect of P43-P69-Fc antibody-linked L-configuration transmembrane peptide-based degraders on T cell activation in PD-1 / PD-L1 BlockadeBioassays

[0280] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium supplemented with 10% FBS, 1% Penn-strep, 1% Penn-strep, and 200 μg / mL wet mycotoxin B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin, and 500 μg / mL wet mycotoxin B (growth medium). PD-L1 aAPC / CHO-K1 cells were seeded at 50 μL per well, for a total of 1.5 weeks, into white 96-well microplates (Corning, cat#3917), followed by 50 μL of 100 nM and 10 nM degrader dilution buffer. KN035-Fc (Kangning Jerry, Envita) was used as a positive control. After overnight (16-18 hours) cell attachment, the culture supernatant was discarded, and the cells were washed three times with PBS or DPBS buffer. Then, 100 μL of 1.8w PD-1NFAT-Luc / Jurkat cells were added and incubated for 6 hours. The cells were then removed from the incubator and cooled to room temperature for 10 minutes. 100 μL of luciferase reporter gene assay reagent (Yeasen, CAT#11404ES80) was added to each well for luminescence assay. The luminescence intensity was measured using a TECAN microplate reader. The results are as follows: Figure 13 As shown.

[0281] The results showed that the degraders prepared by linking the D-configuration membrane-penetrating peptide with the P43-P69-Fc-based dual epitope antibody exhibited excellent activation effects. In subsequent studies, the D-configuration membrane-penetrating peptide linked with the dual epitope PD-L1 heavy chain antibody was selected as the degrader.

[0282] Example 6: Construction of hPD-L1 binding dual epitope antibody tumor in situ activator and degrader

[0283] 6.1 Peptidase ligates conditionally activated degradative peptides to the C-terminus of the hPD-L1 biepisode antibody Fc.

[0284] Based on the fact that the C-terminus of the biepitaxy hPD-L1 antibody ends with the sequence LPETGGGHHHHHH (SEQ ID NO:29), the transpeptidase links the activatable degrader to the C-terminus of the biepitaxy antibody. In this embodiment, the target antibody is a biepisode antibody P69-P43-Fc that specifically binds to hPD-L1 (where the C-terminus of Fc ends with the sequence LPETGGGHHHHHH (SEQ ID NO:29)), which is respectively linked to the following membrane-penetrating constructs: 1: NH2-GGG-(D-Arg)9-PLGLAG-(D-Glu)9-COOH (SEQ ID NO:59), 2: NH2-GGG-(D-Arg)9-SGGISSGLLSGRSDNHGGS-(D-Glu)9-COOH (SEQ ID NO:60), and 3: NH2-GGG-(D-Arg)9-GGSGRSAGGGGSPLGLAGSGGS-(D-Glu)9-COOH (SEQ ID NO:61) (synthesized by Hangzhou Zhuntai Biotechnology). The activatable membrane-penetrating construct consists of three parts: a membrane-penetrating peptide, a cleavable linker that can be cleaved by enzymes in the tumor microenvironment, and a masking peptide that blocks the function of the membrane-penetrating peptide. The reaction system and conditions were performed identically according to the steps in 3.1 of Example 3 to obtain high-purity activatable degradants.

[0285] 6.2 Mass spectrometry confirms that activated degraders release masking peptides under the action of MMP-9.

[0286] The activatable degrader COMBOTAC: P69-P43-Fc-LPET-activatable transmembrane construct 1 was replaced with the test buffer (250 mM Tris, 50 mM CaCl2, 750 mM NaCl, 0.25% Brij-35 (w / v), pH 7.5 (TCNB)), and rhMMP-9 (Synthetic Oxygenase, cat#10327-H08H matrix metalloproteinase 9, working final concentration 1 ng / μL) was added. The mixture was thoroughly mixed and incubated at 37°C for 30 min. Sample processing was performed according to step 4.3 of Example 4, and MS analysis was performed as follows. Figure 14A and 14B As shown, the conditionally activated degraders achieve a shear efficiency of 100% under the action of MMP-9.

[0287] 6.3 Conditional activation of the degrader releases its activity under the action of MMP-9 to degrade PD-L1 on the cell surface.

[0288] Following the steps in 3.1 of Example 3, a non-discriminatory operation was performed. The sample groups were P69-P43-Fc, the bipara NbTAC degrader of the bipara heavy chain antibody, the conditionally activated bipara NbTAC degrader of the bipara heavy chain antibody, and the conditionally activated degrader with MMP-9 added. The final working concentration of MMP-9 was maintained at 1 ng / μL. The degradation of hPD-L1 on the surface of MDA-MB-231PD-L1 / EGFP cells was obtained. Figure 15 As shown.

[0289] Adding matrix metalloproteinase MMP-9 from the tumor microenvironment to the sample culture medium of the conditionally activated degrader of the dual epitope heavy chain antibody can release its degradation ability to reach the same degradation level as the dual epitope heavy chain antibody degrader.

[0290] 6.4 Activation of T cells by conditionally activating degraders in PD-1 / PD-L1 Blockade Bioassays

[0291] PD-1NFAT-Luc / Jurkat cells (Promega) were cultured in RPMI 1640 medium containing 10% FBS, 1% Penn-Strep, 1% Penn-Strep, and 200 μg / mL wet mycoplasma B (growth medium). PD-L1 aAPC / CHO-K1 cells were cultured in F12 medium supplemented with 10% FBS, 1% Penn-Strep, 1 mg / mL neomycin, and 500 μg / mL wet mycoplasma B (growth medium). PD-L1 15,000 aAPC / CHO-K1 cells were seeded at 100 μL per well in white 96-well microplates (Corning, cat#3917). After overnight (16–18 h) culture and cell attachment, the culture supernatant was discarded, and 50 μL of P69-P43-Fc (100 nM), the bipara NbTAC (100 nM) degrader of the bipara NbTAC heavy chain antibody, the CAMBOTAC (100 nM) conditionally activated degrader of the bipara NbTAC heavy chain antibody, and the conditionally activated degrader (100 nM) were added. MMP-9 was added to the solution (nM), with the working final concentration of MMP-9 maintained at 1 ng / μL. KN035-Fc (Kangningjere, Envita) was set as a positive control. After incubation for 30 min, 50 μL of PD-1NFAT-Luc / Jurkat cells (1.8w) was added and co-incubated for 6 hours. After cooling to room temperature for 10 min, 100 μL of luciferase reporter gene assay reagent (Yeasen, CAT#11404ES80) was added to the reaction wells for luminescence assay. The luminescence intensity was measured using a TECAN microplate reader. The fold change in T cell activation was calculated by dividing the bioluminescence intensity of the sample group by the luminescence intensity of the blank control.

[0292] like Figure 16 As shown, adding MMP-9 to the sample culture medium of the conditionally activated degrader of the dual epitope heavy chain antibody can release its degradation ability to reach the same T cell activation level as the dual epitope heavy chain antibody degrader, and achieve the same T cell activation level as the positive blocking antibody Envida.

[0293] 6.5 Inhibitory activity of conditionally activated degraders on tumor growth

[0294] 2x10 mg of hPD-L1 / C57 mice were injected under the armpit. 5 hPD-L1 / MC38 cells were used, and after one week, the tumor volume reached ~50 mm. 3 (Measured with vernier calipers, tumor volume = length × width × width / 2). The tumor was administered via tail vein to mice at a dose of 5 mg / kg, injected every three days. The HBSS group served as a negative control, and Envida antibody served as a positive control. Tumor formation was observed at each administration, and the long and wide diameters of the tumor were measured with vernier calipers. The tumor volume was calculated, and a tumor growth curve was plotted. The results are as follows: Figure 15 As shown. In the tumor suppression experiment, three conditionally activating degraders with different sequences were screened. The difference between them lies in the different cleavable linkers connecting the membrane-penetrating peptide and the masking peptide. The sequence of cleavable linker 1 is: PLGLAG (SEQ ID NO:35); the sequence of cleavable linker 2 is: SGGISSGLLSGRSDNHGGS (SEQ ID NO:44); and the sequence of cleavable linker 3 is: GGSGRSAGGGGSPLGLAGSGGS (SEQ ID NO:45).

[0295] The results are as follows Figures 17A to 17E As shown, a transmembrane peptide and a masking peptide are linked by a cleavable linker 3 sequence, wherein two enzyme cleavage sites uPA and MMP-9, which are specific to the tumor microenvironment, exhibit tumor-suppressive activity comparable to that of the commercial antibody Envida.

[0296] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0297] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0298] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. An activatable membrane-penetrating construct comprising, from N-terminus to C-terminus, a cell-penetrating portion (CPM), a cleavable portion (CM), and a shielding portion (BM), wherein, The CPM consists of nine positively charged arginine residues, which are selected from D-configuration arginine residues. The sequence of the CM is shown in SEQ ID NO: 35, SEQ ID NO: 44 or SEQ ID NO: 45; The BM consists of nine negatively charged glutamate residues, which are selected from D-configuration glutamate residues.

2. An activatable transmembrane construct having the sequence shown in SEQ ID NO: 59, SEQ ID NO: 60 or SEQ ID NO:

61.

3. An activatable transmembrane construct comprising Fc-CPM-CM-BM from N-terminus to C-terminus, wherein the CPM comprises nine positively charged arginine residues selected from D-configuration arginine residues; The sequence of the CM is shown in SEQ ID NO: 35, SEQ ID NO: 44 or SEQ ID NO: 45; The BM consists of nine negatively charged glutamate residues, which are selected from D-configuration glutamate residues. The Fc domain is selected from the Fc domains of IgG, IgM, IgE, IgA, or IgD.

4. The activatable transmembrane construct according to claim 3, wherein the Fc domain is derived from human.

5. The activatable transmembrane construct according to claim 3 or 4, wherein the C-terminus of the Fc domain is connected to the CPM via the sequence LPXT(G)n, where n is an integer selected from 1 to 10; and X is any amino acid.

6. The activatable membrane-penetrating construct according to claim 5, wherein n is an integer selected from 1 to 5.

7. The activatable membrane-penetrating construct according to claim 5, wherein X is E, K, N, Q or A.

8. An activatable degrader for degrading PD-L1, said activatable degrader comprising, from the N-terminus to the C-terminus, an antibody that specifically binds to PD-L1 or its antigen-binding fragment or a heavy chain antibody that specifically binds to PD-L1, and the activatable membrane-penetrating construct of claim 1. The heavy chain antibody is a dimer containing two peptide chains, wherein at least one peptide chain consists of a first heavy chain antigen-binding domain VHH1-L1-a second heavy chain antigen-binding domain VHH2-Fc from the N-terminus to the C-terminus, where L1 represents a linker. The first heavy chain antigen-binding domain VHH1 comprises a first CDR1, a first CDR2, and a first CDR3, the amino acid sequences of which are shown in SEQ ID NO. 6, 7, and 8, respectively; the second heavy chain antigen-binding domain VHH2 comprises a second CDR1, a second CDR2, and a second CDR3, the amino acid sequences of which are shown in SEQ ID NO. 12, 13, and 14, respectively; or The first heavy chain antigen-binding domain VHH1 comprises a second CDR1, a second CDR2, and a second CDR3, the amino acid sequences of which are shown in SEQ ID NO. 12, 13, and 14, respectively; the second heavy chain antigen-binding domain VHH2 comprises a first CDR1, a first CDR2, and a first CDR3, the amino acid sequences of which are shown in SEQ ID NO. 6, 7, and 8, respectively; or The first heavy chain antigen-binding domain VHH1 comprises a first CDR1, a first CDR2, and a first CDR3, the amino acid sequences of which are shown in SEQ ID NO. 6, 7, and 8, respectively; the second heavy chain antigen-binding domain VHH2 comprises a third CDR1, a third CDR2, and a third CDR3, the amino acid sequences of which are shown in SEQ ID NO. 15, 16, and 17, respectively; or The first heavy chain antigen-binding domain VHH1 comprises third CDR1, third CDR2, and third CDR3, with amino acid sequences as shown in SEQ ID NO. 15, 16, and 17, respectively; the second heavy chain antigen-binding domain VHH2 comprises first CDR1, first CDR2, and first CDR3, with amino acid sequences as shown in SEQ ID NO. 6, 7, and 8, respectively; or The first heavy chain antigen-binding domain VHH1 comprises a second CDR1, a second CDR2, and a second CDR3, the amino acid sequences of which are shown in SEQ ID NO. 12, 13, and 14, respectively; the second heavy chain antigen-binding domain VHH2 comprises a third CDR1, a third CDR2, and a third CDR3, the amino acid sequences of which are shown in SEQ ID NO. 15, 16, and 17, respectively; or The first heavy chain antigen-binding domain VHH1 comprises a third CDR1, a third CDR2, and a third CDR3, the amino acid sequences of which are shown in SEQ ID NO. 15, 16, and 17, respectively. The second heavy chain antigen-binding domain VHH2 comprises a second CDR1, a second CDR2, and a second CDR3, the amino acid sequences of which are shown in SEQ ID NO. 12, 13, and 14, respectively. The antibody or its antigen-binding fragment consists of a VHH and an Fc domain from the N-terminus to the C-terminus, and contains a heavy chain variable region VH, wherein the VH comprises CDR1, CDR2, and CDR3: CDR1, CDR2, and CDR3 are shown as SEQ ID NO. 6, 7, and 8, respectively; or CDR1, CDR2, and CDR3 are shown in SEQ ID NO. 12, 13, and 14, respectively; or CDR1, CDR2, and CDR3 are shown in SEQ ID NO. 15, 16, and 17, respectively; or CDR1, CDR2 and CDR3 are shown in SEQ ID NO. 18, 19 and 20, respectively.

9. The activatable degrader according to claim 8, wherein, The first heavy chain antigen-binding domain VHH1 contains the amino acid sequence shown in SEQ ID NO. 21, and the second heavy chain antigen-binding domain VHH2 contains the amino acid sequence shown in SEQ ID NO. 25; or The first heavy chain antigen-binding domain VHH1 contains the amino acid sequence shown in SEQ ID NO. 25, and the second heavy chain antigen-binding domain VHH2 contains the amino acid sequence shown in SEQ ID NO. 21; or The first heavy chain antigen-binding domain VHH1 contains the amino acid sequence shown in SEQ ID NO. 21, and the second heavy chain antigen-binding domain VHH2 contains the amino acid sequence shown in SEQ ID NO. 26; or The first heavy chain antigen-binding domain VHH1 contains the amino acid sequence shown in SEQ ID NO. 26, and the second heavy chain antigen-binding domain VHH2 contains the amino acid sequence shown in SEQ ID NO. 21; or The first heavy chain antigen-binding domain VHH1 contains the amino acid sequence shown in SEQ ID NO. 25, and the second heavy chain antigen-binding domain VHH2 contains the amino acid sequence shown in SEQ ID NO. 26; or The first heavy chain antigen-binding domain VHH1 contains the amino acid sequence shown in SEQ ID NO. 26, and the second heavy chain antigen-binding domain VHH2 contains the amino acid sequence shown in SEQ ID NO. 25; or The VH comprises an amino acid sequence that is at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% identical to the amino acid sequence shown in any of SEQ ID NO. 21, 25-27.

10. The activatable degrader according to claim 8 or 9, wherein the VH has an amino acid sequence as shown in any one of SEQ ID NO. 21, 25-27.

11. The activatable degradable component according to claim 8 or 9, wherein the heavy chain antibody is a homodimer.

12. The activatable degrader according to claim 8 or 9, wherein the Fc domain of the antibody or its antigen-binding fragment or heavy chain antibody is derived from IgG, IgM, IgE, IgA or IgD.

13. The activatable degradable sub according to claim 12, wherein, The Fc domain is an Fc domain of at least one of IgG1, IgG2, IgG3 or IgG4.

14. The activatable degradable sub according to claim 12, wherein, The Fc domain is the Fc domain of human IgG.

15. The activatable degradable sub according to claim 14, wherein, The Fc domain contains N297A and / or N297G mutations.

16. The activatable degrader according to claim 15, wherein the C-terminus of the Fc domain has or is connected to the amino acid sequence LPXTGGGHHHHHH as shown in SEQ ID NO. 28, where X is any amino acid.

17. The activatable degradable component according to claim 16, wherein X is E, K, N, Q, or A.

18. The activatable degrader according to claim 8 or 9, wherein the C-terminus of the Fc domain is connected to the cell penetration portion (CPM) of the activatable transmembrane construct.

19. The activatable degrader of claim 18, wherein the C-terminus of the Fc domain is connected to the cell penetration portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n, wherein n is an integer selected from 1 to 10, and wherein X is any amino acid.

20. The activatable degradable component according to claim 19, wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

21. The activatable degrader according to claim 20, wherein n is an integer selected from 1 to 5.

22. The activatable degrader according to claim 19, wherein X is E, K, N, Q or A.

23. A nucleic acid molecule encoding an activatable membrane-penetrating construct as described in any one of claims 1 to 7, or an activatable degradable construct as described in any one of claims 8 to 22.

24. A carrier comprising the nucleic acid molecule of claim 23.

25. A cell comprising the nucleic acid molecule of claim 23 or the vector of claim 24.

26. A composition comprising the activatable transmembrane construct of any one of claims 1 to 7, the activatable degrader of any one of claims 8 to 22, the nucleic acid molecule of claim 23, the vector of claim 24, and / or the cell of claim 25, and a pharmaceutically acceptable vector.

27. Use of the activatable degrader of any one of claims 8 to 22, the nucleic acid molecule of claim 23, the carrier of claim 24, or the composition of claim 26 in the preparation of a medicament for treating diseases associated with the expression or overexpression of membrane proteins; The disease mentioned is cancer; The cancers mentioned are selected from squamous cell carcinoma, lung cancer, peritoneal cancer, gastric cancer, bone cancer, pancreatic cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colorectal cancer, endometrial cancer, kidney cancer, ureteral cancer, prostate cancer, thyroid cancer, melanoma, central nervous system tumors, and head or neck cancers and related metastatic cancers.

28. The use according to claim 27, wherein the cancer is selected from epithelial squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma, squamous cell carcinoma of the lung, gastrointestinal cancer, and gastrointestinal stromal carcinoma.

29. The use according to claim 27, wherein the cancer is selected from hepatocellular carcinoma and cholangiocarcinoma.

30. The use according to claim 27, wherein the cancer is selected from cervical cancer, vaginal cancer, vulvar cancer, anal cancer, and penile cancer.

31. The use according to claim 27, wherein the cancer is selected from colon cancer and rectal cancer.

32. The use according to claim 27, wherein the cancer is selected from superficial diffuse melanoma, malignant lentigines melanoma, acral melanoma, and nodular melanoma.

33. The use according to claim 27, wherein the cancer is selected from glioblastoma, brain tumor, spinal axis tumor, brainstem glioma, astrocytoma, schwannoma, ependymoma, myeloma, and pituitary adenoma.

34. The use according to claim 27, wherein the cancer is selected from glioblastoma multiforme and brain cancer.

35. The use according to claim 27, wherein the cancer is selected from meningioma.

36. The use according to claim 27, wherein the cancer is selected from salivary gland cancer.

37. The use according to claim 27, wherein the cancer is selected from cervical cancer.

38. The use according to claim 27, wherein the cancer is selected from Ewing's sarcoma.

39. Use of the anti-PD-L1 antibody or its antigen-binding fragment linked to the membrane-penetrating construct of claim 1 in the preparation of a medicament for treating a disease; The disease mentioned is cancer; The cancers mentioned are selected from squamous cell carcinoma, lung cancer, peritoneal cancer, gastric cancer, bone cancer, pancreatic cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colorectal cancer, endometrial cancer, kidney cancer, ureteral cancer, prostate cancer, thyroid cancer, melanoma, central nervous system tumors, and head or neck cancers and related metastatic cancers. The anti-PD-L1 antibody or its antigen-binding fragment thereof is the antibody that specifically binds to PD-L1 or its antigen-binding fragment thereof, or the heavy chain antibody that specifically binds to PD-L1, as described in any one of claims 8 to 22.

40. The use according to claim 39, wherein the antibody is a blocking antibody or a non-blocking antibody.

41. The use according to claim 39, wherein the cancer is selected from epithelial squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma, squamous cell carcinoma of the lung, gastrointestinal cancer, and gastrointestinal stromal carcinoma.

42. The use according to claim 39, wherein the cancer is selected from hepatocellular carcinoma and cholangiocarcinoma.

43. The use according to claim 39, wherein the cancer is selected from cervical cancer, vaginal cancer, vulvar cancer, anal cancer, and penile cancer.

44. The use according to claim 39, wherein the cancer is selected from colon cancer and rectal cancer.

45. The use according to claim 39, wherein the cancer is selected from superficial diffuse melanoma, malignant lentigines melanoma, acral melanoma, and nodular melanoma.

46. ​​The use according to claim 39, wherein the cancer is selected from glioblastoma, brain tumor, spinal axis tumor, brainstem glioma, astrocytoma, schwannoma, ependymoma, myeloma, and pituitary adenoma.

47. The use according to claim 39, wherein the cancer is selected from glioblastoma multiforme and brain cancer.

48. The use according to claim 39, wherein the cancer is selected from meningioma.

49. The use according to claim 39, wherein the cancer is selected from salivary gland cancer.

50. The use according to claim 39, wherein the cancer is selected from cervical cancer.

51. The use according to claim 39, wherein the cancer is selected from Ewing's sarcoma.

52. The use according to any one of claims 39-51, wherein the C-terminus of the Fc domain of the antibody or its antigen-binding fragment or heavy chain antibody is linked to the cell penetration portion (CPM) of the activatable transmembrane construct.

53. The use according to claim 52, wherein the C-terminus of the Fc domain of the antibody or its antigen-binding fragment or heavy chain antibody is linked to the cell penetration portion (CPM) of the activatable transmembrane construct via the sequence LPXT(G)n, wherein n is an integer selected from 1 to 10, and wherein X is any amino acid.

54. The use according to claim 53, wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

55. The use according to claim 54, wherein n is an integer selected from 1 to 5.

56. The use according to claim 53, wherein X is E, K, N, Q or A.

Images