Compositions and methods for improving genome editing efficiency

Abstract

Compositions and methods for improving gene editing efficiency in plants are provided. Also provided are methods and compositions for producing modifications using the novel Cas12a nuclease variants. Also provided are modified plant cells and plants comprising DNA and protein compositions of the novel Cas12a nuclease variants.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 330,106, filed on April 12, 2022, and U.S. Provisional Application No. 63 / 386,452, filed on December 7, 2022, the entire contents of which are incorporated herein by reference.

[0003] Incorporation of Sequence Listing

[0004] The sequence listing contains a file named "AGOE008US_ST26.xml" which is 94 kilobytes in size ( Measured in ) and created on April 6, 2023, and contains 58 sequences, which sequence listing is incorporated herein by reference in its entirety. Technical Field

[0005] The present disclosure relates to the fields of plant molecular biology and plant genetic engineering, and to methods and compositions for genome editing in plants. Specifically, the present invention relates to novel Cas12a nuclease variants and methods for improving gene editing efficiency. Plant genetic engineering methods are used to modify Cas12a DNA and encoded proteins, and to transfer these molecules to plants of agricultural importance. More specifically, the present invention comprises DNA and protein compositions of novel LbCas12a nuclease variants, and plants comprising these compositions. Background Art

[0006] Precision genome editing technology is a powerful tool for engineering gene expression and regulating protein function, and has the potential to improve important agricultural traits. Specifically, the clustered regularly spaced short palindromic repeats (CRISPR)-Cas9 system has revolutionized the field of genome editing. However, the editing efficiency of this powerful tool is still very low in some plant species. Therefore, the art still needs to develop new compositions and methods to improve the efficiency of genome editing in plants. Summary of the invention

[0007] In one aspect, the present disclosure provides a recombinant DNA molecule comprising a polynucleotide sequence selected from the group consisting of: (a) a sequence having at least 85% identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 8; (b) a sequence comprising SEQ ID NOs: 1, 3, 5, 7, and 8; (c) a fragment of any one of SEQ ID NOs: 1, 3, 5, 7, and 8; and (d) a sequence encoding a protein having at least 85% identity to any one of SEQ ID NOs: 2, 4, 6, and 9. In some embodiments, the protein encoded by the polynucleotide sequence comprises a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO: 46. For example, the recombinant DNA molecule has at least 90% identity or at least 95% identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 8, and encodes a protein having a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO: 46. In some embodiments, the recombinant DNA molecule provided herein comprises any one of SEQ ID NOs: 1, 3, 5, 7, and 8. In certain instances, the modification at amino acid position 156 relative to SEQ ID NO: 46 is further defined as a substitution of aspartic acid to arginine.

[0008] In another aspect, the present disclosure provides a recombinant DNA molecule comprising a polynucleotide sequence selected from the group consisting of: a) a sequence having at least 85% identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 8; b) a sequence comprising SEQ ID NOs: 1, 3, 5, 7, and 8; c) a fragment of any one of SEQ ID NOs: 1, 3, 5, 7, and 8; and d) a sequence encoding a protein having at least 85% identity to any one of SEQ ID NOs: 2, 4, 6, and 9, and further comprising at least one intron sequence having a sequence of any one of SEQ ID NOs: 10-17. In some embodiments, the polynucleotides provided herein comprise one or more intron sequences of any one of SEQ ID NOs: 10-17.

[0009] In yet another aspect, transgenic plant cells comprising the recombinant DNA molecules provided herein are described. The transgenic plant cells provided can be monocotyledonous plant cells, including but not limited to barley, cabbage (B.oleracea), wheat and corn cells. The transgenic plant cells provided can also be dicotyledonous plant cells. Transgenic plants or parts thereof are also provided, which comprise the recombinant DNA molecules described herein. Progeny plants comprising the DNA molecules provided herein are further described. The disclosure also provides transgenic seeds comprising the recombinant DNA molecules described herein.

[0010] The recombinant DNA molecules described herein can be expressed in plant cells to produce genome modifications and can also be operably linked to a vector selected from the group consisting of a plasmid, a phagemid, a bacmid, a cosmid, and a bacterial or yeast artificial chromosome.

[0011] The recombinant DNA molecules provided herein can be present in a host cell, wherein the host cell is a cell of any type. The host cell considered in the present disclosure includes a cell selected from the group consisting of bacterial cells, animal cells, plant cells, yeast cells, fungal cells and insect cells. For example, the bacterial host cell can be from the genus of the bacterium selected from the group consisting of Agrobacterium, Rhizobium, Bacillus, Brevibacillus, Escherichia, Pseudomonas, Klebsiella, Pantoea and Erwinia.

[0012] The animal host cell may include a mammalian host cell, such as a fibroblast, an epithelial cell, a lymphocyte or a macrophage. The animal host cell according to the present disclosure may be an immortalized animal cell line, a primary cell or a stem cell.

[0013] In another example, the plant cell can be a dicot or monocot cell, such as a plant cell selected from the group consisting of legume, sunflower, safflower, sesame, tobacco, potato, cotton, sweet potato, cassava, coffee, tea, apple, pear, fig, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, beet, grape, tomato, cucumber, shepherd's purse, Brassica, pea, alfalfa, alfalfa truncatula, pigeon pea, guar, carob, fenugreek, soybean, bean, cowpea, mung bean, lima bean, broad bean, lentil, peanut, licorice, chickpea, oil palm, coconut, banana, corn, barley, sorghum, rice and wheat cells.

[0014] In another aspect, the present disclosure provides a method for producing a plant comprising a genome modification, the method comprising: (a) expressing a recombinant DNA molecule according to claim 1 and a guide RNA compatible with a protein encoded by the recombinant DNA molecule in a plant cell; (b) introducing a modification into at least one target site in the genome of the plant cell; (c) identifying and selecting one or more plant cells of step (b) comprising the modification in the plant genome; and (d) regenerating at least one plant from at least one or more cells selected in step (c). In some instances, the modification may be a substitution, insertion, inversion, deletion, duplication, and combinations thereof. In some embodiments, the plant used in the provided method may be a monocot, such as a barley, cabbage, wheat, or corn plant.

[0015] In another aspect, the present disclosure provides a method for improving gene targeting in crops using CRISPR-Cas12a gene editing, comprising the following steps: expressing in a plant cell a recombinant DNA molecule comprising a polynucleotide sequence selected from the group consisting of: a sequence having at least 85% identity with any one of SEQ ID NOs: 1, 3, 5, 7 and 8; a sequence comprising SEQ ID NOs: 1, 3, 5, 7 and 8; a fragment of any one of SEQ ID NOs: 1, 3, 5, 7 and 8; and / or a sequence encoding a protein having at least 85% identity with any one of SEQ ID NOs: 2, 4, 6 and 9; and a guide RNA compatible with the protein encoded by the recombinant DNA molecule; and / or introducing modifications into at least one target site in the genome of the plant cell; wherein the modifications are introduced at a higher rate when compared to the rate of introducing the modifications using a method comprising expressing a DNA molecule encoding an amino acid of SEQ ID NO: 46. In some embodiments, the sequence has at least 90% identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 8, and encodes a protein having a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO: 46. In some embodiments, the sequence has at least 95% identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 8, and encodes a protein having a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO: 46. In some embodiments, the sequence comprises any one of SEQ ID NOs: 1, 3, 5, 7, and 8. In some embodiments, the modification at amino acid position 156 is further defined as a substitution of aspartic acid to arginine. In some embodiments, the polynucleotide sequence further comprises an intron sequence of SEQ ID NOs: 10-17.

[0016] Also provided is a method for producing progeny seeds comprising the recombinant DNA molecules described herein, the method comprising: (a) planting a first seed comprising the recombinant DNA molecule of claim 1; (b) growing a plant from the seed of step (a); and (c) harvesting progeny seeds from the plant, wherein the harvested seeds comprise the recombinant DNA molecule.

[0017] In yet another aspect, the present disclosure provides a method for introducing a genome modification in a plant, the method comprising: (a) expressing in a plant a protein or a fragment thereof encoded by a DNA molecule provided herein; and (b) expressing in a plant cell a guide RNA compatible with the protein or fragment thereof having nuclease activity.

[0018] The present disclosure also provides a method for detecting the presence of the recombinant DNA molecule provided herein in a sample comprising plant genomic DNA, comprising: (a) contacting the sample with a DNA probe, which hybridizes to genomic DNA from a plant comprising the recombinant nucleic acid DNA under stringent hybridization conditions and does not hybridize to genomic DNA from other isogenic plants that do not comprise the recombinant DNA molecule under such hybridization conditions, wherein the probe is homologous or complementary to a fragment of any one of SEQ ID NOs: 1, 3, 5, 7, 8, or a sequence encoding a protein comprising an amino acid sequence having at least 85%, or 90%, or 95%, or 98%, or 99%, or about 100% amino acid sequence identity with any one of SEQ ID NOs: 2, 4, 6, and 9; (b) subjecting the sample and the probe to stringent hybridization conditions; and (c) detecting hybridization of the DNA probe to the recombinant DNA molecule.

[0019] In another aspect, the present disclosure provides a method for detecting the presence of a nuclease protein or a fragment thereof in a sample comprising a protein, wherein the protein comprises the amino acid sequence of any one of SEQ ID NOs: 2, 4, 6 and 9; or the protein comprises an amino acid sequence having at least 85%, or 90%, or 95%, or 98% or 99%, or about 100% amino acid sequence identity with any one of SEQ ID NOs: 2, 4, 6 and 9; the method comprising: (a) contacting the sample with an immunoreactive antibody; and (b) detecting the presence of the protein or a fragment thereof.

[0020] In another embodiment, a method for modifying a polynucleotide fragment encoding a Cas12a protein or a fragment thereof having nuclease activity is provided, the method comprising: (a) obtaining a polynucleotide sequence of any one of SEQ ID NOs: 1, 3, 5, 7 and 8; and (b) introducing a modification into at least one target site in the polynucleotide sequence, so that the protein encoded by the polynucleotide sequence comprises a modification at the 156th amino acid compared to a protein comprising an amino acid sequence of SEQ ID NO: 46. In these methods, the protein encoded by the modified polynucleotide sequence comprises a substitution of aspartic acid to arginine at the 156th amino acid compared to a polynucleotide fragment lacking the modification. The modified polynucleotide sequence also comprises at least one intron sequence of any one of SEQ ID NOs: 10-17, or may comprise one or more intron sequences of any one of SEQ ID NOs: 10-17. In other examples, the modified polynucleotide sequence comprises an aspartic acid to arginine modification at the 156th amino acid, and further comprises at least one intron sequence of SEQ ID NOs: 10-17. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The following drawings form part of this specification and are included to further demonstrate certain aspects of the present disclosure. The present disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments provided herein.

[0022] Figure 1 A schematic diagram of the editing construct structure tested in barley is shown. Briefly, P-ZmUbi refers to the maize ubiquitin promoter; Cas12a refers to the LbCas12a CDS; T-Nos refers to the nopaline synthase terminator; TaU6 refers to the wheat U6 promoter; TaU3 refers to the wheat U3 promoter; DR refers to the direct repeat crRNA; HH / HDV refers to the ribozyme sequence; t refers to the poly-T terminator; V1 refers to the V1 array. V2 refers to the V2 array. The thick black arrow indicates the direction of transcription.

[0023] Figure 2 The efficiency of targeting the HORVU.MOREX.r31HG0069960 gene using the V1 guide array with different LbCas12a constructs is shown. Os refers to OsCas12a; Hs refers to HsCas12a; ttHs refers to ttHsCas12a; ttAt refers to ttAtCas12a; ttAt+int refers to ttAtCas12a+int. The blue column indicates the number of T0 lines. The orange column indicates the number of T0 lines containing the target mutation.

[0024] Figure 3Results for five barley genes each targeted with ttHsCas12a using the V1 array compared to the V2 array are shown. The blue column indicates the %T0 V1 lines containing the target mutation. The orange column indicates the %T0 V2 lines containing the target mutation. The x-axis indicates the array guide order. Gene identifiers are shown.

[0025] Figure 4 Shown is a representative phenotypic comparison of Golden promise having a wild-type 2-row phenotype compared to Golden promise T0 plants mutated in HORVU.MOREX.r3.2HG0184740 showing a 6-row phenotype.

[0026] Figure 5 Sequencing analysis of the HORVU.MOREX.r3.1HG0069960 gene in a representative barley line is shown. Upper panel: Amplicon sequencing shows the presence of two alleles in the native T0 generation (-3bp; TTTGGTGCTGCACAATGAAAGCAGACGGC; SEQ ID NO: 50; and -10bp; TTTGGTGCTGCACAACAACAACTGAAAGCAGACGGC; SEQ ID NO: 51). Lower panel: In the T1 progeny without T-DNA, the same two alleles were identified, establishing the inheritance of the mutation. The lower left panel shows the unedited sequence (TTTGGTGCTGCACAATGTCAACAACTGAAAGCAGACGGC; SEQ ID NO: 52) along the top compared to the sequence of the T1 homozygous 3bp deletion (SEQ ID NO: 50). The lower middle panel shows the unedited sequence (SEQ ID NO: 52) along the top compared to the T1 homozygous 10bp deletion (SEQ ID NO: 51). The lower right panel shows the unedited sequence (SEQ ID NO:53) compared along the top to the sequence of the T1 heterozygote (GTTGATGGTTGGTGTTGGGCAATGCCCAATGAAAGCAGACGGC).

[0027] Figure 6A shows a schematic diagram of the editing construct structure tested in cabbage. Briefly, Nos refers to the nopaline synthase terminator; Npt refers to neomycin phosphotransferase (which confers kanamycin resistance for bacterial selection of plasmids); 35S refers to the cauliflower mosaic virus-35S promoter; E9 refers to the rbc-E9 terminator (derived from pea); ttAtCas12a refers to the Arabidopsis thaliana codon-optimized LbCas12a carrying the D156R "high temperature resistance" mutation; ttHsCas12a refers to the Homo sapiens codon-optimized Cas12a carrying the "high temperature resistance" D156R mutation. The expression of ttAtCas12a+int in the table refers to the LbCas12a coding sequence optimized for Arabidopsis thaliana; ttAtCas12a+int refers to the Arabidopsis thaliana codon-optimized LbCas12a carrying the D156R “high temperature resistance” mutation and eight Arabidopsis thaliana introns; Ubi10 refers to the Arabidopsis thaliana ubiquitin 10 promoter; U6 refers to the Arabidopsis thaliana U626 promoter; HH / HDV refers to the ribozyme sequence; DR refers to the direct repeat crRNA; G_A, _B, _C and _D refer to the protospacer sequences A, B, C and D; and T refers to the poly-T terminator.

[0028] Figure 6 B shows a comparison of the mutagenesis efficiencies of LbCas12a constructs S5, S6, S7, and S8 targeting Bo2g016480. Comparison of S5, S6, S7, and S8 is possible at target site C, where the respective efficiencies are 3%, 50%, 50%, and 68%.

[0029] Figure 7 Sequencing analysis of the Bo2g016480 gene in T1 cabbage without T-DNA is shown. -3bp, -9bp and -12bp alleles are shown, establishing the inheritance of the mutation. The left figure shows that the unedited sequence GAGTTTTGGTATGCAGATCAACATTATAAGAATGTACC (SEQ ID NO: 54) is compared with the sequence of the T1 homozygote 3bp deletion along the top (GAGTTTTGGTATGCAGATCAACATAAGAATGTACC; SEQ ID NO: 55). The middle figure shows that the unedited sequence (SEQ ID NO: 54) is compared with the sequence of the T1 homozygote 9bp deletion along the top (GAGTTTTGGTATGCAGATCAACATGTACC; SEQ ID NO: 56). The right figure shows that the unedited sequence (SEQ ID NO: 54) is compared with the T1 homozygote 12bp deletion along the top (GAGTTTTGGTATGCAGATCAACATGTACC; SEQ ID NO: 57).

[0030] Figure 8A table of the universal genetic code is shown, showing all possible mRNA triplet codons (where T in the DNA molecule is replaced by U in the RNA molecule) and the amino acid encoded by each codon.

[0031] Fig. 9 The structures of constructs used to evaluate the gene editing efficiency of ttHsCas12a and ttAtCas12a+8 intronic nucleases in wheat are shown.

[0032] Fig.10 The structure of the construct used to evaluate the gene editing efficiency of the ttAtCas12a+8 intronic nuclease in wheat is shown.

[0033] Fig.11 Shown are the structures of constructs used to evaluate the gene editing efficiency of ttAtCas12a nucleases with and without introns in Arabidopsis.

[0034] Fig.12 Additional construct structures used to evaluate the gene editing efficiency of Cas12a variants in barley are shown.

[0035] Fig.13 The construct structures of 12 LbCas12a coding sequence variants are shown.

[0036] A brief description of the sequence

[0037] SEQ ID NO: 1 is a polynucleotide sequence of the Cas12a gene of Lachnospiraceae bacteria in which codons are optimized for expression in rice (OsCas12a).

[0038] SEQ ID NO: 2 is the amino acid sequence of the Lachnospiraceae bacteria Cas12a protein encoded by SEQ ID NO: 1 (OsCas12a).

[0039] SEQ ID NO: 3 is a polynucleotide sequence of the Cas12a gene of Lachnospiraceae bacteria in which codons are optimized for expression in Homo sapiens (HsCas12a).

[0040] SEQ ID NO: 4 is the amino acid sequence of the Lachnospiraceae bacteria Cas12a protein encoded by SEQ ID NO: 3 (HsCas12a).

[0041] SEQ ID NO: 5 is a polynucleotide sequence (ttHsCas12a) of the Lachnospiraceae bacterial Cas12a gene in which codons are optimized for expression in Homo sapiens and encode a protein having a D156R mutation compared to the wild-type Cas12a protein.

[0042] SEQ ID NO:6 is the amino acid sequence of the Lachnospiraceae bacteria Cas12a protein encoded by SEQ ID NO:5 (ttHsCas12a).

[0043] SEQ ID NO: 7 is a polynucleotide sequence (ttAtCas12a) of the Lachnospiraceae bacterial Cas12a gene in which codons are optimized for expression in Arabidopsis thaliana and encodes a protein having a D156R mutation compared to the wild-type Cas12a protein.

[0044] SEQ ID NO: 8 is a polynucleotide sequence (ttAtCas12a+int) of the Lachnospiraceae bacterial Cas12a gene in which codons are optimized for expression in Arabidopsis thaliana and encode a protein having a D156R mutation compared to the wild-type Cas12a protein, and further comprising 8 intron sequences.

[0045] SEQ ID NO:9 is the amino acid sequence of the Cas12a protein of the Lachnospiraceae family encoded by SEQ ID NO:7 and 8 (ttAtCas12a and ttAtCas12a+int, respectively).

[0046] SEQ ID NOs:10-17 are polynucleotide sequences of introns in SEQ ID NO:8.

[0047] SEQ ID NO: 18 is the polynucleotide sequence of the polynucleotide sequence of the V1 guide RNA array construct.

[0048] SEQ ID NO: 19 is the polynucleotide sequence of the polynucleotide sequence of the V2 guide RNA array construct.

[0049] SEQ ID NO: 20 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.1HG0069960.

[0050] SEQ ID NO: 21 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.1HG0069960.

[0051] SEQ ID NO: 22 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.1HG0069960.

[0052] SEQ ID NO: 23 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.1HG0069960.

[0053] SEQ ID NO: 24 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0184740.

[0054] SEQ ID NO: 25 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0184740.

[0055] SEQ ID NO: 26 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0184740.

[0056] SEQ ID NO: 27 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0184740.

[0057] SEQ ID NO: 28 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.6HG0611290.

[0058] SEQ ID NO: 29 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.6HG0611290.

[0059] SEQ ID NO: 30 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.6HG0611290.

[0060] SEQ ID NO: 31 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.6HG0611290.

[0061] SEQ ID NO: 32 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.7HG0640970.

[0062] SEQ ID NO: 33 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.7HG0640970.

[0063] SEQ ID NO: 34 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.7HG0640970.

[0064] SEQ ID NO: 35 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.7HG0640970.

[0065] SEQ ID NO: 36 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0133680.

[0066] SEQ ID NO: 37 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0133680.

[0067] SEQ ID NO: 38 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0133680.

[0068] SEQ ID NO: 39 is a polynucleotide sequence encoding a guide RNA targeting the barley gene HORVU.MOREX.r3.2HG0133680.

[0069] SEQ ID NO: 40 is a polynucleotide sequence encoding an N-terminal nuclear localization signal.

[0070] SEQ ID NO:41 is the amino acid sequence of the N-terminal nuclear localization signal encoded by SEQ ID NO:40.

[0071] SEQ ID NO: 42 is a polynucleotide sequence encoding a C-terminal nuclear localization signal, which is codon optimized for expression in rice.

[0072] SEQ ID NO:43 is the amino acid sequence of the C-terminal nuclear localization signal encoded by SEQ ID NOs:42, 44 and 45.

[0073] SEQ ID NO:44 is a polynucleotide sequence encoding a C-terminal nuclear localization signal, which is codon optimized for expression in Homo sapiens.

[0074] SEQ ID NO:45 is a polynucleotide sequence encoding a C-terminal nuclear localization signal, which is codon optimized for expression in Arabidopsis thaliana.

[0075] SEQ ID NO: 46 is the amino acid sequence of the wild-type Lachnospiraceae Cas12a protein.

[0076] SEQ ID NO:47 is the DNMT1 guide RNA sequence.

[0077] SEQ ID NO:48 is the EMX1 guide RNA sequence.

[0078] SEQ ID NO:49 is the FANCF guide RNA sequence.

[0079] SEQ ID NO:50 is a 3 bp deletion allele in the HORVU.MOREX.r3.1HG0069960 gene.

[0080] SEQ ID NO:51 is a 10 bp deletion allele in the HORVU.MOREX.r3.1HG0069960 gene.

[0081] SEQ ID NO:52 is the unedited allele in the HORVU.MOREX.r3.1HG0069960 gene.

[0082] SEQ ID NO:53 is the sequence of the HORVU.MOREX.r3.1HG0069960 gene in the T1 heterozygote.

[0083] SEQ ID NO:54 is the unedited allele in the Bo2g016480 gene.

[0084] SEQ ID NO:55 is a 3 bp deletion allele in the Bo2g016480 gene.

[0085] SEQ ID NO:56 is a 9 bp deletion allele in the Bo2g016480 gene.

[0086] SEQ ID NO:57 is a 12 bp deletion allele in the Bo2g016480 gene.

[0087] SEQ ID NO: 58 is a polynucleotide sequence encoding a Cas12a variant, whose codons are optimized for expression in rice and comprises 12 introns (OsCas12a+12 introns). Specific implementation plan

[0088] The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 system represents the most widely used genome editing platform for targeted genome modification in plants. For genome editing applications, the CRISPR / Cas9 system consists of two basic components: the Cas9 effector protein, which induces a blunt-ended (i.e., two DNA strands have equal length) double-strand break (DSB) and a single guide RNA (sgRNA), which contains a targeting sequence of about 20nt. DSBs are mainly repaired by non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathways. Functional loss mutations are generated by short insertions and deletions (indels) introduced during the NHEJ-mediated repair pathway, while specific sequence modifications can be achieved by the HDR pathway in the presence of an appropriate repair template, although with much lower efficiency.

[0089] Although the CRISPR-Cas9 system remains the most popular plant genome editing tool, the Lachnospiraceae bacterial CRISPR-Cas12a (LbCas12a) nuclease (originally identified as Cpf1) has also been shown to be able to target genome modification in plants. Compared with Streptococcus pyogenes Cas9 (SpCas9), LbCas12a has different requirements and results. First, LbCas12a has a "TTTV" PAM sequence requirement that makes it available for AT-rich regions, while SpCas9 requires "NGG" that makes it available for GC-rich sequences. Secondly, SpCas9 typically causes insertions and deletions of about 1-3bp, while LbCas12a typically produces deletions of about 3-12bp. Third, SpCas9 cuts at the PAM proximal end of the target to produce blunt ends, while LbCas12a cuts at the PAM distal region to produce sticky ends (i.e., one chain is longer than the other chain). LbCas12a's unique PAM requirements, mutation spectrum, and DNA chain structure at the cleavage site all represent potential advantages in the field of precise genome editing and engineering in plants.

[0090] However, editing with SpCas9 and LbCas12a nucleases is not interchangeable; and when Cas12a is modified accordingly, modifications that improve Cas9 editing efficiency do not necessarily improve efficiency. In addition, the current efficiency of editing with LbCas12a in various plant species such as barley, cabbage, wheat, and corn is still extremely low (e.g., <10%). Therefore, there is still a need to discover and develop new strategies for improving the efficiency of precise genome editing.

[0091] The present disclosure overcomes the limitations of the prior art by providing engineered Cas12a proteins and novel recombinant DNA molecules encoding them, as well as compositions and methods using them. The novel Cas12a variant is a protein with nuclease activity in plant cells. Compared with the control Cas12a protein, when used in combination with various guide RNA structures, the novel Cas12a variant produces significantly improved editing efficiency in plants. One or more guide RNAs can be used. Guide RNAs known in the art can be selected by testing the mutagenesis of the target gene (see, e.g., Wang, 2021). Transgenic plants expressing novel Cas12a sequences show improved genome editing efficiency, which can be applied to plant species widely known to use CRISPR-Cas9 and Cas12a editing techniques to show low editing efficiency. Therefore, provided herein are methods and compositions for targeted genome editing in plants, which can be used to achieve beneficial results, including, for example, the reliability of the improvement of the edited plant, the significant increase in the number of edited T0 plants, the increase in the number of T0 plants homozygous for targeted editing, or a combination thereof. In addition, the ability to produce these desired characteristics with high efficiency in T0 plants provides unique advantages that cannot be obtained in the art.

[0092] In order to produce such plants, in certain embodiments, the present disclosure provides methods and compositions for creating targeted genome modifications via novel Cas12a sequences described herein. For example, as disclosed herein, a recombinant DNA molecule comprising a combination of a polynucleotide sequence encoding Cas12a protein and one or more guide RNAs is used to edit a plant genome. For example, exemplary genes from two plant species (i.e., barley and cabbage) known to show low editing efficiency are targeted for mutagenesis. T0 plants transformed with novel Cas12a sequences are selected and their editing efficiency and fidelity are evaluated. The results show that, compared with currently available methods, alleles edited at the target gene can be produced with significantly improved efficiency. Homozygous and heterozygous T0 plants of the edited alleles are produced, and the inheritance of the edited alleles is further identified in offspring plants (T1 plants). As described herein, the novel Cas12a sequences using various gRNA structures show a significant increase in editing efficiency in plant species known to use CRISPR-Cas genome editing technology to show low editing efficiency. Therefore, the present disclosure represents a significant improvement in the art because it allows the production of engineered alleles at high frequency in plants.

[0093] I. Engineered Proteins and Recombinant DNA Molecules

[0094] Provided herein are novel engineered proteins and recombinant DNA molecules encoding them. As used herein, "Cas12a sequences", "Cas12a variants" or proteins with "nuclease activity" refer to proteins, particularly Cas12a nucleases. As used herein, the term "engineering" refers to non-natural DNA, proteins, cells or organisms, which are not usually found in nature and produced by human intervention. "Engineered protein", "engineered enzyme" or "engineered nuclease" refers to proteins, enzymes or Cas12a nucleases whose amino acid sequence is conceived and produced in the laboratory using one or more techniques of biotechnology, protein design or protein engineering, such as molecular biology, protein biochemistry, bacterial transformation, plant transformation, site-directed mutagenesis, directed evolution using random mutagenesis, genome editing, gene editing, gene cloning, DNA connection, DNA synthesis, protein synthesis and DNA shuffling. For example, relative to the coding sequence of wild-type protein, engineered protein may have one or more deletions, insertions or substitutions, and each deletion, insertion or substitution may be composed of one or more amino acids. Genetic engineering can be used to generate DNA molecules encoding engineered proteins, e.g., engineered Cas12a proteins or Cas12a variants, and comprising at least a first amino acid substitution relative to a wild-type Cas12a protein as described herein.

[0095] An example of an engineered protein provided herein is an RNA-guided Cas12a nuclease (referred to herein as a "Cas12a protein" or "Cas12a variant") comprising at least 70% sequence identity to an amino acid sequence of SEQ ID NO: 46, wherein the protein comprises at least one amino acid substitution compared to SEQ ID NO: 46. For example, wherein the protein comprises arginine (R) at a position corresponding to position 156 of SEQ ID NO: 46. In specific embodiments, the engineered proteins provided herein comprise one, two, three, four, five, six, seven, eight, nine, ten or more substitutions.

[0096] Engineered proteins are enzymes with nuclease activity. As used herein, "nuclease activity" refers to the ability of a protein in the nucleic acid backbone of a polynucleotide sequence and / or its complementary DNA chain introduced into a double-strand break (DSB) or a single-strand nick in a plant genome. Examples of proteins with nuclease activity include RNA-guided nucleases, such as Cas12a. The enzymatic activity of RNA-guided nucleases can be measured by any method known in the art, for example, by expressing the nuclease and at least gRNA in a plant cell, sequencing the genomic DNA in the target region of the RNA-guided nuclease. In particular, RNA-guided nuclease activity can be identified based on the generation of about 1-3bp or 3-12bp deletions in the target genomic region.

[0097] The present disclosure provides a polynucleotide sequence encoding a protein with nuclease activity, which comprises at least 70% sequence identity to the amino acid sequence of SEQ ID NO: 46, wherein the encoded protein comprises at least one amino acid substitution compared to SEQ ID NO: 46. For example, wherein the encoded protein comprises arginine (R) at the position corresponding to the 156th position of SEQ ID NO: 46. In a specific embodiment, the engineered protein provided herein comprises one, two, three, four, five, six, seven, eight, nine, ten or more substitutions. In addition, the present disclosure provides a polynucleotide sequence encoding a protein with nuclease activity, which comprises at least 85% sequence identity to the polynucleotide sequence of SEQ ID NO: 46, wherein the protein encoded by the polynucleotide sequence comprises a modification at the 156th amino acid compared to the protein comprising the amino acid sequence of SEQ ID NO: 46. For example, wherein the protein comprises: arginine (R) at the position corresponding to the 156th position of SEQ ID NO: 46. The present disclosure also provides a polynucleotide sequence encoding a protein with nuclease activity, comprising at least 70% sequence identity to an amino acid sequence of SEQ ID NO: 46, wherein the polynucleotide sequence further comprises at least one intron sequence of any one of SEQ ID NO: 10-17. In some examples, the polynucleotides of the present disclosure include at least one intron taken from an Arabidopsis gene. The splicing efficiency of introns from Arabidopsis genes introduced into the polynucleotides of the present invention can be assessed using bioinformatics methods (e.g., Netgene splicing tools (Hebsgaard, 1996)) or alternatively by in vitro or in vivo assays, and one or more introns introduced into the polynucleotides of the present disclosure can be selected based on such methods. Methods for identifying introns in Arabidopsis have been described (see, e.g., Cheng, 2018). In certain embodiments, the polynucleotide sequence encoding a protein with nuclease activity comprises at least 70% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:46, comprises arginine (R) at a position corresponding to position 156 of SEQ ID NO:46, and the polynucleotide sequence further comprises at least one intron sequence for a plant (e.g., Arabidopsis), or any one of SEQ ID NOs:10-17, or a combination thereof.

[0098] As used herein, the term "protein-coding DNA molecule" or "protein-coding sequence" refers to a DNA molecule comprising a DNA sequence encoding a protein. As used herein, the term "protein" refers to an amino acid chain connected by peptide (amide) bonds, and includes polypeptide chains that are folded or arranged in a biologically functional manner and polypeptide chains that are not folded or arranged in a biologically functional manner. "Protein coding sequence" as used herein refers to a DNA sequence encoding a protein. "Sequence" as used herein refers to the sequential arrangement of nucleotides or amino acids. "DNA sequence" may refer to a nucleotide sequence or a DNA molecule comprising a nucleotide sequence; "protein sequence" may refer to an amino acid sequence or a protein comprising an amino acid sequence. The boundaries of a protein coding sequence are usually determined by a translation start codon at the 5' end and a translation stop codon at the 3' end.

[0099] Engineered proteins can be produced by altering or modifying wild-type protein sequences to produce novel proteins with modified characteristics or new combinations of useful protein characteristics, such as altered Vmax, Km, Ki, IC 50 , substrate specificity, substrate selectivity, the ability to interact with other components in the cell, such as chaperones or membranes, and protein stability, etc. Modification can be performed at a specific amino acid position in the protein, and can be performed by replacing the typical amino acids found at the same position in the natural (i.e., wild-type protein) with alternative amino acids. Amino acid modification can be performed as a single amino acid substitution in the protein sequence or in combination with one or more other modifications (such as one or more other amino acid substitutions, deletions or additions). In some embodiments, the engineered protein has a changed protein feature, such as compared to the wild-type protein with the same gRNA sequence, resulting in those with improved editing efficiency in the presence of one or more gRNA sequences. In other embodiments, the present disclosure therefore provides an engineered protein, such as a Cas12a variant, and a recombinant DNA molecule encoding the engineered protein, which has one or more amino acid substitutions, such as D156R, wherein the position of the amino acid substitution is relative to the amino acid position shown in SEQ ID NO:46. In specific embodiments, the engineered proteins provided herein comprise one, two, three, four, five, six, seven, eight, nine, ten or more of any combination of such substitutions, wherein the modification is made at a position functionally equivalent to a position in the amino acid sequence provided in SEQ ID NO: 46. Similar modifications can be made at similar positions of any RNA-guided nuclease by comparing the amino acid sequence of the RNA-guided nuclease to be mutated with the amino acid sequence of a target RNA-guided nuclease having nuclease activity (e.g., Cas12a).

[0100] Many methods well known to those skilled in the art can be used to separate and manipulate DNA molecules disclosed herein or its fragments. For example, polymerase chain reaction (PCR) technology can be used to amplify specific starting DNA molecules or to produce variants of the original molecule. DNA molecules or its fragments can also be obtained by other techniques, such as by chemical methods directly synthesizing fragments, such as usually by using an automated oligonucleotide synthesizer.

[0101] Due to the degeneracy of the genetic code, a variety of different DNA sequences can encode proteins, such as the altered or engineered proteins disclosed herein. For example, Figure 8 A universal genetic code table showing all possible mRNA triplet codons (in which T in a DNA molecule is replaced by U in an RNA molecule) and the amino acid encoded by each codon is provided. The DNA sequence encoding the Cas12a protein with amino acid substitutions described herein can be prepared by using methods known in the art and Figure 8 The information provided introduces mutations into the DNA sequence encoding wild-type Cas12a protein to produce. Those skilled in the art can produce alternative DNA sequences encoding the same, or substantially the same, changed or engineered proteins described herein. These variants or alternative DNA sequences are within the scope of the embodiments described herein. As used herein, the sequence referred to as "substantially the same" refers to the amino acid substitution, deletion, addition or insertion sequence that does not substantially change the functional activity (i.e., change function) of the protein encoded by the DNA molecule of the embodiments described herein. The allelic variants of the nucleotide sequence encoding wild-type or engineered proteins are also included in the scope of the embodiments described herein. While maintaining the functional activity of the protein encoded by the DNA molecule, this type of allelic variant can produce beneficial effects when expressed in certain plant cells. For example, the results described herein confirm that the Cas12a protein and its variants that are codon-optimized for distantly related plant species or in species in different biological kingdoms surprisingly lead to the genome editing efficiency of the plant species (such as barley, cabbage, wheat and corn) known to be resistant to CRISPR-cas genome editing.

[0102] Amino acid substitutions other than those specifically exemplified or naturally occurring in wild-type or engineered Cas12a proteins are also included in the scope of the embodiments described herein, as long as the Cas12a proteins with the substitutions still retain substantially the same functional activity as described herein. The combination of these variants or alternative DNA sequences with such amino acid substitutions in proteins encoded by DNA sequences is also included in the scope of the embodiments described herein, including but not limited to SEQ ID NO: 1, 3, 5, 7 and 8. Similarly, variants or alternative DNA sequences encoding Cas12a proteins having nuclease activity and also comprising heterologous intron sequences are also included in the scope of the embodiments described herein. Introns do not contain information encoding proteins or polypeptides. Introns are first transcribed into RNA sequences and then spliced ​​out from mature RNA molecules. While maintaining the functional activity of proteins encoded by DNA molecules further comprising heterologous intron sequences, such allele variants comprising intron sequences can produce beneficial effects when expressed in certain plant cells.

[0103] For example, the results described herein demonstrate that Cas12a proteins comprising at least one intron sequence of any one of SEQ ID NOs: 10-17 and variants thereof result in improved genome editing efficiency in plant species (e.g., barley, cabbage, wheat, and corn) known to exhibit low editing efficiency using CRISPR-cas genome editing technology.

[0104] The polynucleotide sequence encoding Cas12a nuclease provided herein includes a polynucleotide sequence comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or more intron sequences. The intron sequence that can be inserted into the polynucleotide sequence encoding Cas12a nuclease includes but is not limited to any one of SEQ ID NO: 10-17 or multiple copies thereof. According to the present disclosure, one or more introns can be inserted at any position in the sequence encoding Cas12a nuclease, for example, at any position in any one of SEQ ID NO: 1, 3, 5, 7 and 8. Experiments that can measure the combined effects of D156R mutations and one or more introns can be performed (for example, comparing only the first intron in Cas12a with any other or all eight introns in Cas12a). Other experiments can determine the part of Cas12a containing introns that leads to improved editing efficiency.

[0105] The recombinant DNA molecules provided herein can be synthesized and modified in whole or in part by methods known in the art, where it is necessary to provide sequences that can be used for DNA manipulation (e.g., restriction enzyme recognition sites or recombination-based cloning sites), plant-preferred sequences (e.g., plant codon usage or Kozak consensus sequences), or sequences that can be used for DNA construct design (e.g., spacer or linker sequences). The present disclosure includes recombinant DNA molecules and engineered proteins that have at least 50% sequence identity, at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, and at least 99% sequence identity with any recombinant DNA molecule or amino acid sequence provided herein and have nuclease activity. As used herein, the term "percent sequence identity" or "% sequence identity" refers to the percentage of identical nucleotides or amino acids in a linear polynucleotide or amino acid sequence comparing a reference ("query") sequence (or its complementary strand) to a test ("subject") sequence (or its complementary strand) when the two sequences are optimally aligned (appropriate nucleotide or amino acid insertions, deletions or gaps totaling less than 20% of the reference sequence over the comparison window). Optimal alignment of sequences for alignment over a comparison window is well known to those skilled in the art and can be performed by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and by computerized implementations of these algorithms, such as GAP, BESTFIT, FASTA and TFASTA, which are available as software with default parameters. Wisconsin (Accelrys Inc., San Diego, CA), MEGAlign (DNAStar Inc., 1228 S. Park St., Madison, WI 53715) and part of the sequence analysis software package MUSCLE (version 3.6) (RC Edgar, "MUSCLE: multiple sequence alignment with high accuracy and high throughput" Nucleic Acids Research 32 (5): 1792-7 (2004)). The "identity score" for the aligned fragment of the test sequence and the reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the aligned reference sequence fragment portion (i.e., the entire reference sequence or a smaller defined portion of the reference sequence). The percentage of sequence identity is expressed as the identity score multiplied by 100. The comparison of one or more sequences can be to the full-length sequence or a portion thereof, or to a longer sequence.

[0106] II. Genome Editing

[0107] In certain embodiments, the disclosure provides plants, plant parts, plant cells and seeds produced by genome modification using site-specific integration or genome editing. Genome editing can be used to perform one or more edits or mutations at a desired target site in a plant genome, such as changing the expression and / or activity of one or more genes, or integrating an insertion sequence or a transgenic at a desired position in a plant genome. Any site or locus in a plant genome can potentially be selected for genome editing (or gene editing) or site-specific integration of a transgenic, construct or transcribable DNA sequence. As used herein, a "target site" for genome editing or site-specific integration refers to the position of a polynucleotide sequence in a plant genome, which is bound and cut by a site-specific nuclease to introduce a double-strand break (DSB) or a single-strand nick into the nucleic acid backbone of a polynucleotide sequence and / or its complementary DNA chain in the plant genome. The target site may comprise, for example, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 29, or at least 30 consecutive nucleotides. The "target site" of the RNA-guided nuclease may comprise any complementary strand of a double-stranded nucleic acid (DNA) molecule at the target site or a sequence of a chromosome. Site-specific nucleases may bind to the target site, for example, via a non-coding guide RNA (e.g., but not limited to, CRISPR RNA (crRNA) or a single guide RNA (sgRNA) as further described herein). The non-coding guide RNA provided herein may be complementary to the target site (e.g., complementary to any strand of a double-stranded nucleic acid molecule or a chromosome at the target site). It is understood that the non-coding guide RNA may not require complete identity or complementarity to bind or hybridize to the target site. For example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 (or more) mismatches between the target site and the non-coding RNA can be tolerated. "Target site" also refers to the position of a polynucleotide sequence in a plant genome, which is bound and cut by any other site-specific nuclease to introduce a DSB or a single-stranded nick into the polynucleotide sequence and / or its complementary DNA strand, and the site-specific nuclease may not be guided by a non-coding RNA molecule, such as zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), large-range nuclease, etc. As used herein, "target region" or "targeting region" refers to a polynucleotide sequence or region flanked by two or more target sites. Without limitation, in some embodiments, the target region may undergo mutation, deletion, insertion, substitution, inversion or duplication.As used herein, "flanked" when used to describe a target region of a polynucleotide sequence or molecule refers to two or more target sites surrounding the target region of the polynucleotide sequence or molecule, with one target site on each side of the target region.

[0108] As used herein, "targeted genome editing technology" refers to any method, protocol or technology that allows precise and / or targeted editing (i.e., editing that is mostly or completely non-random) at a specific location in a plant genome using site-specific nucleases (e.g., meganucleases, zinc finger nucleases (ZFNs), RNA-guided endonucleases (e.g., CRISPR / Cas9 or Cas12a systems), TALE (transcription activator-like effector)-endonucleases (TALENs), recombinases or transposases). In specific embodiments, "targeted genome editing technology" refers to an RNA-guided Cas12a system. As used herein, "editing" or "genome editing" refers to generating targeted mutations, deletions, insertions, substitutions, inversions or duplications of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000, at least 10,000 or at least 25,000 nucleotides of an endogenous plant genomic nucleic acid sequence. As used herein, "editing" or "genome editing" can also encompass the targeted insertion or site-directed integration of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000, at least 10,000, or at least 25,000 nucleotides into the endogenous genome of a plant. The singular form "edit" or "genome editing" refers to one such targeted mutation, deletion, insertion, substitution, inversion or duplication, while the plural form "edits" or "genome editing" refers to two or more targeted mutations, deletions, insertions, substitutions, inversions and / or duplications, wherein each "edit" is introduced by a targeted genome editing technology.

[0109] According to some embodiments, the site-specific nuclease can be co-delivered with a donor template molecule to serve as a template for making a desired edit, mutation, or insertion in the genome at a desired target site by repairing a double-strand break (DSB) or nick created by the site-specific nuclease. According to some embodiments, the site-specific nuclease can be co-delivered with a DNA molecule comprising a selectable or screenable marker gene.

[0110] The site-specific nuclease can be an RNA-guided nuclease. According to some embodiments, the RNA-guided endonuclease can be selected from the group consisting of Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl 7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, CasX, CasY, and any homologs or modified versions thereof, and Argonaute proteins (non-limiting examples of Argonaute proteins include thermophilic bacteria Argonaute (TtAgo), furious fireball Argonaute (PfAgo), Gray's Halophilic Bacteria Argonaute (Natronobacteriumgregoryi Argonaute) (NgAgo) and any homologs or modified versions thereof). According to some embodiments, the RNA-guided nuclease is a Cas9 or Cpf1 (also referred to herein as Cas12a) enzyme. In addition, in some embodiments, the RNA-guided nuclease is a Cas12a enzyme or variant. In a specific embodiment, the RNA-guided nuclease is a Lachnospiraceae bacterial Cas12a (LbCas12a) variant encoded by a sequence having at least 85% identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 8. The RNA-guided nuclease can be delivered as a protein with or without a guide RNA, or the guide RNA can be complexed with the RNA-guided nuclease and delivered as a ribonucleoprotein (RNP).

[0111] For RNA-guided endonucleases, guide RNA molecules can be further provided to guide endonucleases to target sites in plant genomes by base pairing or hybridization, thereby generating DSBs or nicks at or near target sites. As described herein, guide RNA can be used as gRNA molecules, or as recombinant DNA molecules, constructs or vectors comprising transcribable DNA sequences transformed or introduced into plant cells or tissues, wherein the transcribable DNA sequence encodes one or more guide RNAs operably connected to a single promoter or a single promoter. As understood in the art, guide RNA can include, for example, CRISPR RNA (crRNA), single-stranded guide RNA (sgRNA), or any other RNA molecule that can guide or direct endonucleases to a specific target site in a genome. A typical CRISPR-associated protein, Cas9 from Streptococcus pyogenes, naturally binds two RNAs, CRISPR RNA (crRNA) guides and trans-acting CRISPR RNA (tracrRNA), to assemble CRISPR ribonucleoproteins (crRNPs). In contrast, the CRISPR-Cas12a system does not require a trans-activated crispr RNA (tracrRNA) for the biogenesis of mature crRNA. On the contrary, the RuvC endonuclease domain of Cas12a directly processes its mature crRNA." Single-stranded guide RNA" (or "sgRNA") is an RNA molecule comprising a crRNA covalently linked to tracrRNA by a linker sequence, which can be expressed as a single RNA transcript or molecule. Guide RNA includes a guide or targeting sequence (also referred to herein as "spacer sequence") identical or complementary to a target site (such as at or near a gene) in a plant genome. Guide RNA is generally a non-coding RNA molecule that does not encode protein. The guide sequence of the guide RNA can be at least 10 nucleotides in length, such as 12-40 nucleotides, 12-30 nucleotides, 12-20 nucleotides, 12-35 nucleotides, 12-30 nucleotides, 15-30 nucleotides, 17-30 nucleotides, or 17-25 nucleotides in length, or about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides in length. The guide sequence can be at least 95%, at least 96%, at least 97%, at least 99%, or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, or more contiguous nucleotides of a DNA sequence at a genomic target site.

[0112] As mentioned above, the target gene for genome editing can be any target plant gene.For the knockout mutation of the target gene by genome editing, the RNA-guided endonuclease can be targeted to the upstream or downstream sequence of the gene, such as promoter and / or enhancer sequence or intron, 5'UTR and / or 3'UTR sequence, so that one or more promoters and / or regulatory sequences of the gene are mutated, thereby affecting or reducing its expression level.Similarly, by the target gene mutation of genome editing, the RNA-guided endonuclease can be targeted to the transcribable DNA sequence (that is, transcribable region) of the gene, such as the region of the gene comprising a coding sequence, a specific DNA sequence encoding a protein domain, an exon region, an intron region or a combination thereof.For example, in certain embodiments, the transcribable DNA sequence of the targeted genome editing can include exon / intron boundaries or can be adjacent to exon / intron boundaries.If the resulting modification spans exon / intron boundaries, the modification can be referred to as the modification in exon region and intron region. For genetic modification of a target gene, a guide RNA can be used that comprises a guide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25 or more consecutive nucleotides of the gene and its complementary sequence, although alternative splicing and different exon / intron boundaries may occur. As used herein, the term "continuous" in reference to a polynucleotide or protein sequence means that there are no deletions or gaps in the sequence.

[0113] As used herein, for a given sequence, "complement", "complementary sequence" and "reverse complementary sequence" are used interchangeably. All three terms refer to the reverse complementary sequence of a nucleotide sequence, that is, a sequence that is complementary to a given sequence in the reverse order of nucleotides.

[0114] "Ribosome binding site" or "ribosome binding site (RBS)" refers to the nucleotide sequence upstream of the start codon of the mRNA transcript responsible for ribosome recruitment during translation initiation. Typically, RBS refers to bacterial sequences, although internal ribosome entry sites (IRES) have been described in mRNAs of eukaryotic cells or viruses that infect eukaryotic organisms. Ribosome recruitment in eukaryotic organisms is typically mediated by the 5' cap present on eukaryotic mRNAs. Ribosome skipping sequences (e.g., 2A sequences such as furin-GSG-T2A) can be used in constructs to prevent covalent attachment of translated amino acid sequences.

[0115] The tRNA may also use an alternative guide structure that incorporates the tRNA sequence instead of the ribozyme. One or more tRNAs may be used.

[0116] As used herein, the term "antisense" refers to a DNA or RNA sequence that is complementary to a specific DNA or RNA sequence. Antisense RNA molecules are single-stranded nucleic acids that can be combined with sense RNA chains or sequences or mRNAs to form duplexes due to sequence complementarity. The term "antisense strand" refers to a nucleic acid strand that is complementary to the "sense" strand. The "sense strand" of a gene or locus is a strand of DNA or RNA that has the same sequence as an RNA molecule transcribed from the gene or locus (except uracil in RNA and thymine in DNA).

[0117] The protospacer sequence adjacent motif (PAM) may be present in the genome, immediately adjacent to and located upstream of the 5' end of the genomic target site sequence complementary to the targeting sequence of the guide RNA, i.e., immediately downstream (3') of the sense (+) strand of the genomic target site (relative to the targeting sequence of the guide RNA), as known in the art. See, e.g., Wu et al. (Quant Biol. 2(2): 59-70, 2014). The genomic PAM sequence on the sense (+) strand adjacent to the target site (relative to the targeting sequence of the guide RNA) may include 5'-NGG-3' of Cas9; or 5'-TTTN-3' of Cas12a. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the targeting sequence of the guide RNA) may not generally be complementary to the genomic PAM sequence.

[0118] As used herein, "donor molecules", "donor templates" or "donor template molecules" (collectively referred to as "donor templates") that can be recombinant polynucleotides, DNA or RNA donor templates or sequences are defined as nucleic acid molecules having homologous nucleic acid templates or sequences (e.g., homologous sequences) and / or insertion sequences, which are used to site-specifically, targeted insertion or recombination into the genome of a plant cell by repairing a nick or DSB in the genome of a plant cell. The donor template can be a separate DNA molecule comprising one or more homologous sequences and / or insertion sequences for targeted integration, or the donor template can be a sequence portion (i.e., a donor template region) of a DNA molecule that also comprises one or more other expression cassettes, genes / transgenes, and / or transcribable DNA sequences. For example, a "donor template" can be used for site-specific integration of a transgene or construct, or as a template for introducing mutations (such as insertions, deletions, substitutions, etc.) into a target site in a plant genome. The targeted genome editing techniques provided herein can include the use of one or more, two or more, three or more, four or more, or five or more donor molecules or templates. The donor templates provided herein may contain at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten genes or transgenes and / or transcribable DNA sequences. Alternatively, the donor template may not contain genes, transgenes, or transcribable DNA sequences.

[0119] Without being limited by the embodiments, the gene / transgene or transcribable DNA sequence of the donor template may include, for example, insecticide resistance genes, herbicide tolerance genes, nitrogen use efficiency genes, water use efficiency genes, yield improvement genes, nutritional quality genes, DNA binding genes, selection marker genes, RNAi or suppression constructs, site-specific genome modification enzyme genes, single guide RNAs of CRISPR / Cas9 systems, expression cassettes based on geminiviruses or plant virus expression vector systems. According to other embodiments, the insertion sequence of the donor template may include a protein-encoding sequence or a transcribable DNA sequence encoding a non-coding RNA molecule, which may target an endogenous gene for inhibition. The donor template may include a promoter operably connected to a coding sequence, a gene or a transcribable DNA sequence, such as a constitutive promoter, a tissue-specific or tissue-preferred promoter, a developmental stage promoter or an inducible promoter. The donor template may comprise a leader sequence, an enhancer, a promoter, a transcription start site, a 5'-UTR, one or more exons, one or more introns, a transcription termination site, region or sequence, a 3'-UTR, and / or a polyadenylation signal, each of which may be operably linked to a coding sequence, a gene (or transgene), or a transcribable DNA sequence encoding a non-coding RNA, a guide RNA, an mRNA, and / or a protein. The donor template may be a single-stranded or double-stranded DNA or RNA molecule or a plasmid.

[0120] The "insertion sequence" of the donor template is a sequence designed for targeted insertion into the genome of a plant cell and can be of any suitable length. For example, the length of the insertion sequence of the donor template can be 2 to 50,000, 2 to 10,000, 2 to 5000, 2 to 1000, 2 to 500, 2 to 250, 2 to 100, 2 to 50, 2 to 30, 15 to 50, 15 to 100, 15 to 500, 15 to 1000, 15 to 5000, 18 to 30, 18 to 26, 20 to 26, 20 to 50, 20 to 100, 20 to 250, 20 to 50 0, 20 to 1000, 20 to 5000, 20 to 10,000, 50 to 250, 50 to 500, 50 to 1000, 50 to 5000, 50 to 10,000, 100 to 250, 100 to 500, 100 to 1000, 100 to 5000, 100 to 10,000, 250 to 500, 250 to 1000, 250 to 5000, or 250 to 10,000 nucleotides or base pairs. The donor template may also have at least one homology sequence or homology arm, such as two homology arms, to direct integration of the mutation or insertion sequence into the target site in the plant genome by homologous recombination, wherein the homology sequence or homology arm is identical or complementary to a sequence at or near the target site in the plant genome, or has a percent identity or percent complementarity. When the donor template comprises homology arms and an insertion sequence, the homology arms will flank or surround the insertion sequence of the donor template. Each homology arm can be at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% identical or complementary to at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 2500 or at least 5000 consecutive nucleotides of a target DNA sequence within the plant genome.

[0121] Any method known in the art for site-specific integration can be used with the present disclosure. In the presence of a donor template molecule with an insertion sequence, the insertion sequence can be site-specifically integrated into the plant genome by homologous recombination between the homology arms of the donor template and the plant genome, or by repairing the DSB or nick by non-homologous end joining (NHEJ), to produce a targeted insertion event at the site of the DSB or nick. Therefore, if the transgenic transcribed DNA sequence, construct or sequence is located in the insertion sequence of the donor template, site-specific insertion or integration of the transgenic, transcribable DNA sequence, construct or sequence can be achieved.

[0122] The introducing of DSB or nick also can be used for introducing target sudden change in the genome of plant.According to this method, sudden change can be introduced in the target site by the incomplete repair of DSB or nick, for example disappearance, insertion, replacement, inversion and / or repetition, to produce genetic modification in gene.Even if donor template molecule is not used, this sudden change also can be produced by the incomplete repair of target gene seat.Can realize the modification of gene by inducing DSB or nick at the endogenous gene seat of gene or near, described DSB or nick cause non-functional protein, interfering protein or compare with the protein of the gene expression lacking described modification with the expression of the active protein of reduction, destruction or change.

[0123] Similarly, targeted mutations of this type of gene can be produced with donor template molecules to guide specific or required mutations at or near the target site by repairing DSB or nicks. The donor template molecule can comprise a homologous sequence with or without an insertion sequence, and comprises one or more mutations relative to the target genome sequence at or near the DSB or nick site, such as one or more deletions, insertions, substitutions, inversions and / or repetitions. For example, the targeted mutation of a gene can be achieved by deletion, insertion, substitution, inversion or repetition of at least a portion of the gene, such as by introducing a frameshift or premature termination codon into the coding sequence of the gene or by introducing modification into a transcribable DNA sequence. It is also possible to introduce a deletion of a part of a gene by producing DSB or nicks at two target sites and causing the deletion of the insertion target region flanking the target site. The modification of the target gene can result in non-functional protein, interfering protein or the expression of an active protein with a reduction, destruction or change compared to the protein expressed by the gene lacking the modification.

[0124] In one aspect, the present disclosure provides a plant, or a plant seed, plant part, or plant cell thereof, comprising a recombinant DNA molecule, wherein the recombinant DNA molecule comprises a sequence having at least 85% identity to any one of SEQ ID NOs: 1, 3, 5, 7, and 8; a sequence comprising any one of SEQ ID NOs: 1, 3, 5, 7, and 8; a fragment of any one of SEQ ID NOs: 1, 3, 5, 7, and 8; or a sequence encoding a protein having at least 85% identity to any one of SEQ ID NOs: 2, 4, 6, and 9. In certain embodiments, the protein encoded by the recombinant DNA molecule comprises (i) a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO: 46; (ii) further comprising one or more intron sequences of SEQ ID NOs: 10-17; or a combination thereof. When expressed in a plant cell in the presence of one or more guide RNA molecules, the protein encoded by the recombinant DNA molecule described herein can produce genomic modifications in a target region defined by the gRNA with high efficiency compared to a control protein, such as a protein comprising the amino acid sequence of SEQ ID NO: 46. The genomic modification can be a deletion of a region comprising at least 1, at least 2, at least 4, at least 6, at least 8, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, or at least 150 consecutive nucleotides within the target region. In one aspect, the genomic modification can also include a deletion and a nucleotide substitution, or a nucleotide insertion of at least 1, at least 2, at least 4, at least 6, at least 8, at least 10, or at least 20 consecutive nucleotides around the deletion.

[0125] In one aspect, the mutant allele of the target gene can comprise two or more modifications in the transcribable region of the endogenous gene. The present disclosure provides such mutant alleles, which can be produced, for example, using a construct comprising a sequence encoding two or more guide RNAs operably linked to a plant-expressible promoter; or a construct comprising two gRNA boxes, each of which is operably linked to a plant-expressible promoter.

[0126] III. Constructs for genome editing

[0127] Recombinant DNA constructs and vectors are provided, comprising polynucleotide sequences encoding site-specific nucleases, such as RNA-guided endonucleases, wherein the coding sequence is operably connected to a plant-expressible promoter. For RNA-guided endonucleases, recombinant DNA constructs and vectors are also provided, comprising polynucleotide sequences encoding one or more guide RNAs, wherein the guide RNA comprises a guide sequence of sufficient length, and the guide sequence has a percentage identity or complementarity with a target site in a plant genome (e.g., at or near a target target gene). The polynucleotide sequences of the recombinant DNA constructs and vectors encoding site-specific nucleases or guide RNAs can be operably connected to a plant-expressible promoter, such as an inducible promoter, a constitutive promoter, a tissue-specific promoter, etc.

[0128] As used herein, "gene" refers to a nucleic acid sequence that forms a genetic and functional unit and encodes one or more sequence-related RNA and / or polypeptide molecules. A gene generally comprises a coding region operably linked to an appropriate regulatory sequence that regulates the expression of a gene product (e.g., a polypeptide or functional RNA). A gene may have various sequence elements, including but not limited to promoters, untranslated regions (UTRs), exons, introns, and other upstream or downstream regulatory sequences.

[0129] As used herein, "allele" refers to an alternative nucleic acid sequence at a gene or a specific locus (e.g., a nucleic acid sequence of a gene or locus different from other alleles of the same gene or locus). Relative to a wild-type allele, if there are one or more mutations or edits in the nucleic acid sequence of a mutant allele, such alleles can be considered to be (i) wild-type or (ii) mutants. Relative to a wild-type allele, a mutation of a gene or an edited allele can have an activity that is reduced, destroyed, changed or eliminated, or a reduced or eliminated gene expression level. For example, in otherwise identical plants, a mutation of a target gene or an edited allele can have a deletion in a transcribable region of an endogenous gene that reduces, destroys or changes the activity of a protein encoded by a mutant allele compared to the activity of a protein encoded by a wild-type allele. For diploid organisms, such as corn, a first allele can appear on a chromosome, and a second allele can appear on the same locus on a second homologous chromosome. If one allele at a locus on a chromosome of a plant is a mutant or edited allele and the other corresponding allele on the homologous chromosome of the plant is wild type, the plant is described as heterozygous for the mutant or edited allele. However, if both alleles at a locus are mutant or edited alleles, the plant is described as homozygous for the mutant or edited allele. Plants homozygous for mutant or edited alleles at a locus may contain the same mutant or edited allele or different mutant or edited alleles if heteroallelic or biallelic.

[0130] As used herein, "wild-type gene" or "wild-type allele" refers to a gene or allele having the most common sequence or genotype in a particular plant species, or other sequences or genotypes that have only natural variations, polymorphisms, or other silent mutations relative to the most common sequence or genotype that do not significantly affect the expression and activity of the gene or allele. In fact, relative to the most common sequence or genotype, a "wild-type" gene or allele does not contain variations, polymorphisms, or any other type of mutation that significantly affects the normal function, activity, expression, or phenotypic outcome of the gene or allele. In general, the term "variant" refers to molecules that have some synthetic or naturally occurring differences in their nucleotide or amino acid sequences, respectively, compared to a reference (natural) polynucleotide or polypeptide. These differences include substitutions, insertions, deletions, inversions, duplications, or any desired combination of such changes in the natural polynucleotide or amino acid sequence.

[0131] As used herein, the term "expression" refers to the biosynthesis of a gene product in a cell, tissue, organ, or organism (such as a plant, plant part, or plant cell, tissue, or organ), and generally the transcription and / or translation of a nucleotide sequence (such as an endogenous gene, a heterologous gene, a transgene, or an RNA and / or protein coding sequence).

[0132] The term "recombinant" referring to polynucleotide (DNA or RNA) molecules, proteins, constructs, vectors, etc. refers to polynucleotide or protein molecules or sequences that are artificially manufactured and generally do not exist in nature and / or are present in a background that is generally not present in nature, including polynucleotide (DNA or RNA) molecules, proteins, constructs, etc., which include a combination of two or more polynucleotide or protein sequences, which will not naturally develop in the same way without human intervention, such as polynucleotide molecules, proteins, constructs, etc., which include at least two polynucleotide or protein sequences that are operably connected but heterologous to each other. For example, the term "recombinant" may refer to any combination of two or more DNA or protein sequences in the same molecule (e.g., plasmids, constructs, vectors, chromosomes, proteins, etc.), wherein such combinations are artificial and generally do not exist in nature. As used in this definition, the phrase "generally not present in nature" refers to not existing in nature without human introduction. Recombinant polynucleotide or protein molecules, constructs, etc. may include such polynucleotide or protein sequences, which (i) are separated from other polynucleotide or protein sequences that exist adjacent to each other in nature, and / or (ii) are adjacent (or adjacent) to other polynucleotide or protein sequences that are not adjacent to each other in nature. Such recombinant polynucleotide molecules, proteins, constructs, etc. may also refer to polynucleotide or protein molecules or sequences that have been genetically engineered and / or constructed outside the cell. For example, recombinant DNA molecules may include any engineered or artificial plasmids, vectors, etc., and may include linear or circular DNA molecules. Such plasmids, vectors, etc. may include various maintenance elements, including prokaryotic replication origins and selected markers, and one or more transgenics or expression cassettes that may be in addition to plant selection marker genes, etc. The term "operably connected" refers to the functional connection between a promoter or other regulatory element and a gene (or transgenic)-related transcribable DNA sequence or coding sequence, so that the promoter, etc., at least in certain cells, tissues, developmental stages, and / or conditions, operates or functions to start, assist, influence, initiate, and / or promote the transcription and expression of a related transcribable DNA sequence or coding sequence.

[0133] "Isolated DNA molecules" or "isolated polynucleotides" or equivalent terms or phrases mentioned in this application refer to DNA molecules or polynucleotides that exist alone or in combination with other compositions, but not in their natural environment. For example, nucleic acid elements (e.g., coding sequences, intron sequences, non-translated leader sequences, promoter sequences, transcription termination sequences, etc.) that occur naturally in the genomic DNA of an organism are not considered to be "isolated" as long as the element is in the genome of the organism and in the position where it naturally occurs in the genome. However, each of these elements and sub-portions of these elements will be "isolated" within the scope of this disclosure as long as the element is not in the genome of the organism and in the position within the genome where it is naturally found. Similarly, a nucleotide sequence encoding a protein or any naturally occurring variant of the protein will be an isolated nucleotide sequence as long as the nucleotide sequence is not in the DNA of the organism in which the sequence encoding the protein is naturally found. For the purposes of this disclosure, a synthetic nucleotide sequence encoding the amino acid sequence of a naturally occurring protein will be considered to be isolated. For the purposes of this disclosure, any transgenic nucleotide sequence, i.e., a nucleotide sequence of DNA that is inserted into the genome of a plant or bacterial cell or present in an extrachromosomal vector, will be considered an isolated nucleotide sequence, regardless of whether it is present in a plasmid or similar construct used to transform cells, in the genome of a plant or bacterium, or in a detectable amount in a tissue, progeny, biological sample, or commercial product derived from a plant or bacteria.

[0134] As generally understood in the art, the term "promoter" may generally refer to a DNA sequence that comprises an RNA polymerase binding site, a transcription start site and / or a TATA box and assists or promotes the transcription and expression of a related transcribable polynucleotide sequence and / or a gene (or transgenic). A promoter may be synthesized, altered or derived from a known or naturally occurring promoter sequence or other promoter sequence. A promoter may also include a chimeric promoter comprising a combination of two or more heterologous sequences. Therefore, a promoter of the present disclosure may include a variant or fragment of a promoter sequence that is similar but not identical to other promoter sequences known or provided herein in composition. A promoter or its variant or fragment provided herein may include a "minimal promoter" that provides a basal level of transcription and is composed of a TATA box or an equivalent DNA sequence for identifying and binding to initiate transcription RNA polymerase II complexes. A promoter may be classified according to a variety of standards related to the expression pattern of a related coding or transcribable sequence or gene (including a transgenic) that is operably connected to a promoter, such as constitutive, developmental, tissue-specific, inducible, etc. A promoter that drives expression in all or most tissues in a plant is referred to as a "constitutive" promoter. The promoter that drives expression at certain periods or stages of development is called "developmental" promoter. The promoter that drives enhanced expression in certain tissues of the plant is called "tissue-enhanced" or "tissue-preferred" promoter relative to other plant tissues. Therefore, "tissue-preferred" promoters cause relatively high or preferred expression in the specific tissues of the plant, but have lower levels of expression in other tissues of the plant. Promoters that are expressed in the specific tissues of the plant and rarely expressed or not expressed in other plant tissues are called "tissue-specific" promoters. "Inducible" promoters are promoters that initiate transcription in response to environmental stimuli (e.g., cold, drought, or light or other stimuli such as wounds or chemical applications). Promoters can also be classified according to their source, such as heterologous, homologous, chimeric, synthetic, etc.

[0135] As used herein, "plant expressible promoter" refers to a promoter that can initiate, assist, influence, trigger and / or promote the transcription and expression of its associated transcribable DNA sequence, coding sequence or gene in plant cells or tissues.

[0136] The term "heterologous" with respect to a promoter or other regulatory sequence associated with a related polynucleotide sequence (e.g., a transcribable DNA sequence or coding sequence or gene) refers to a promoter or regulatory sequence that is not operably connected to such a related polynucleotide sequence in nature without artificial introduction, for example, a promoter or regulatory sequence has a different origin relative to the related polynucleotide sequence, and / or a promoter or regulatory sequence does not naturally exist in a plant species to be transformed with the promoter or regulatory sequence. Similarly, "heterologous" with respect to a coding sequence can refer to the use of a recombinant DNA molecule optimized for codons of different organisms compared to the organism in which the DNA molecule is expressed, for example, the recombinant DNA sequence encoding Cas12a is codon-optimized for expression in humans, but expressed in plant cells.

[0137] As used herein, "endogenous gene" or "endogenous locus" refers to a gene or locus in its natural and original chromosomal location. As used herein, in the context of a protein-coding gene, "exon" refers to a segment of a DNA or RNA molecule that contains information encoding a protein or polypeptide sequence.

[0138] As used herein, an "intron" of a gene refers to a segment of a DNA or RNA molecule that does not contain information encoding a protein or polypeptide and which is first transcribed into an RNA sequence and then spliced ​​out from the mature RNA molecule.

[0139] As used herein, the "untranslated region (UTR)" of a gene refers to a fragment of an RNA molecule or sequence (e.g., an mRNA molecule) expressed by a gene (or transgene), excluding exon and intron sequences of an RNA molecule. "Untranslated region (UTR)" also refers to a DNA fragment or sequence encoding such a UTR fragment of an RNA molecule. An untranslated region can be a 5'-UTR or a 3'-UTR, depending on whether it is located at the 5' end or the 3' end of a DNA or RNA molecule or sequence relative to the coding region of the DNA or RNA molecule or sequence (i.e., upstream (5') or downstream (3') of exon and intron sequences, respectively).

[0140] As used herein, "transcribeable region" or "transcribeable DNA sequence" refers to a nucleic acid sequence that is expressed by a gene (or transgene).

[0141] As used herein, "transcription termination sequence" refers to a nucleic acid sequence that contains a signal that triggers the release of a newly synthesized transcribed RNA molecule from the RNA polymerase complex and marks the end of transcription of a gene or locus.

[0142] As used herein, the terms "percent identity", "% identity" or "percent identity" with respect to two or more nucleotide or protein sequences are calculated by (i) comparing two optimally aligned sequences (nucleotides or proteins) over a comparison window, (ii) determining the number of positions at which the same nucleic acid base (for nucleotide sequences) or amino acid residue (for proteins) occurs in the two sequences to produce the number of matched positions, (iii) dividing the number of matched positions by the total number of positions in the comparison window, and (iv) multiplying the quotient by 100% to produce the percent identity. If the "percent identity" is calculated relative to a reference sequence without specifying a particular comparison window, the percent identity is determined by dividing the number of matched positions over the alignment region by the total length of the reference sequence. Therefore, for the purposes of this application, when two sequences (query sequence and subject sequence) are optimally aligned (leaving gaps in their alignment), the "percent identity" of the query sequence is equal to the number of identical positions between the two sequences divided by the total number of positions in the query sequence over its length (or comparison window), then multiplied by 100%. When using percentage sequence identity for proteins, it is recognized that non-identical residue positions often differ by conservative amino acid substitutions, where an amino acid residue is substituted with another amino acid residue having similar chemical properties (e.g., charge or hydrophobicity), thereby not altering the functional properties of the molecule. When the conservative substitutions of a sequence differ, the percentage sequence identity may be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are referred to as having "sequence similarity" or "similarity." A sequence that has a percentage identity to a base sequence may exhibit the activity of the base sequence.

[0143] Homologs are inferred from sequence similarity by, for example, comparing protein sequences manually or using computer-based tools. In order to optimally align sequences to calculate their percent identity, various pairwise or multiple sequence alignment algorithms and programs are known in the art, such as ClustalW or Basic Local Alignment Search which can be used to compare sequence identity or similarity between two or more nucleic acid or protein sequences. (BLAST) etc. BLAST also can be used for example for the query protein sequence of the basic organism of the protein sequence database search of various organisms, to find similar sequences.The summary expected value (E value) produced can be used for measuring the level of sequence similarity.Because for a specific organism, the protein hit with the lowest E value may not necessarily be an ortholog or just an ortholog, so the reciprocal query sequence is used to filter the hit sequence with a significant E value to identify the ortholog.The reciprocal query sequence needs to search the database for the protein sequence of the basic organism for significant hits.When the best hit of the reciprocal query sequence is the paralog of the query sequence protein itself or the query sequence protein, the hit can be identified as the ortholog.Utilize the reciprocal query process, directly to the paralog in homolog and all homologs further distinguish, and this allows to infer the functional equivalence of the gene.

[0144] The term "complementarity percentage" or "complementarity percentage" used herein with respect to two nucleotide sequences is similar to the concept of percent identity, but refers to the percentage of nucleotides of the query sequence that optimally base pair or hybridize with nucleotides of the subject sequence when the query sequence and the subject sequence are arranged linearly and optimally base paired without secondary folded structures (e.g., loops, stems, or hairpins). This percentage of complementarity can be between two DNA chains, two RNA chains, or a DNA chain and an RNA chain. "Complementarity percentage" is calculated by (i) optimally base pairing or hybridizing two nucleotide sequences in a linear and fully extended arrangement (i.e., without folding or secondary structure) over a comparison window, (ii) determining the number of positions of base pairs between the two sequences over the comparison window to produce the number of complementary positions, (iii) dividing the number of complementary positions by the total number of positions in the comparison window, and (iv) multiplying this quotient by 100% to produce the percentage of complementarity of the two sequences. The optimal base pairing of two sequences can be determined based on known nucleotide base pairings such as GC, AT, and AU by hydrogen bonding. If the "complementarity percentage" is calculated relative to a reference sequence without specifying a particular comparison window, the percent identity is determined by dividing the number of complementary positions between the two linear sequences by the total length of the reference sequence. Thus, for purposes of this disclosure, when two sequences (query sequence and subject sequence) are optimally base paired (which allows for mismatches or non-base paired nucleotides but no folding or secondary structure), the "complementarity percentage" of the query sequence is equal to the number of base paired positions between the two sequences divided by the total number of positions in the query sequence over its length (or divided by the number of positions in the query sequence over the comparison window), then multiplied by 100%.

[0145] As used herein, a "fragment" of a polynucleotide refers to a sequence comprising at least about 50, at least about 75, at least about 95, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 225, at least about 250, at least about 275, at least about 300, at least about 500, at least about 600, at least about 700, at least about 750, at least about 800, at least about 900, or at least about 1000 consecutive nucleotides or lengths of a DNA molecule or protein as disclosed herein. Methods for producing such fragments from an initial promoter molecule are well known in the art. Fragments of a DNA molecule or protein can exhibit the activity of the DNA molecule or protein from which they were derived.

[0146] The plant selection marker transgene in the transformation vector or construct of the present disclosure can be used for the selection of the cell or tissue of auxiliary transformation, and this is due to the presence of a selection agent, such as an antibiotic or a herbicide, wherein the plant selection marker transgene provides tolerance or resistance to the selection agent. Therefore, the selection agent can be biased towards or conducive to the survival, development, growth, proliferation, etc. of the transformed cells expressing the plant selection marker gene, thereby improving the ratio of transformed cells or tissues in the R0 plant. Commonly used plant selection marker genes include, for example, those that impart tolerance or resistance to antibiotics such as kanamycin and paromomycin (nptII), hygromycin B (aphIV), streptomycin or spectinomycin (aadA) and gentamicin (aac3 and aacC4), or those that impart tolerance or resistance to herbicides such as glufosinate (bar or pat), dicamba (DMO) and glyphosate (proA or EPSPS). Plant screenable marker genes that provide the ability to visually screen transformants, such as luciferase or green fluorescent protein (GFP), or genes expressing beta glucuronidase or the uidA gene (GUS), for which various chromogenic substrates are known, may also be used. Plant transformation may also be performed without selection at one or more steps or stages of culturing, developing or regenerating transformed explants, tissues, plants and / or plant parts.

[0147] IV. Transformation Methods

[0148] Provided are methods and compositions for transforming plant cells, tissues or explants with recombinant DNA molecules or constructs, wherein the recombinant DNA molecules or constructs encode one or more molecules required for targeted genome editing (e.g., guide RNA and / or site-directed nuclease). Suitable methods for transforming host plant cells actually include any method by which DNA or RNA can be introduced into cells (e.g., wherein the recombinant DNA construct is stably integrated into a plant chromosome or wherein the recombinant DNA construct or RNA is transiently provided to a plant cell), and are well known in the art. Two effective methods for cell transformation are bacterial-mediated transformation, such as Agrobacterium-mediated or Rhizobium-mediated transformation, and microparticle or gene gun bombardment-mediated transformation. For example, microparticle bombardment methods are described in U.S. Patents Nos. 5,550,318; 5,538,880; 6,160,208; and 6,399,861. Agrobacterium-mediated methods are described in, for example, U.S. Pat. No. 5,591,616, Hinchliffe and Harwood (2019), and Sparrow and Irwin (2015). Other methods for plant transformation are also known in the art, such as microinjection, electroporation, vacuum infiltration, pressure, ultrasonic treatment, silicon carbide fiber agitation, PEG-mediated transformation, etc.

[0149] The transformation of plant material is carried out in tissue culture on nutrient medium (for example, a nutrient mixture that allows cell in vitro growth). Receptor cell targets include, but are not limited to, meristem cells, bud tips, hypocotyls, callus, immature or mature embryos and gametic cells such as microspores and pollen. Callus can be derived from tissues, including but not limited to immature or mature embryos, hypocotyls, seedling apical meristems, microspores, etc. Cells comprising transgenic cell nuclei grow into transgenic plants. Any suitable method or technology known in the art for plant cell transformation can be used according to the method of the present invention. In transformation, in any one transformation experiment, DNA is usually only imported into the target plant cell of small percentage. Marker genes are used to provide an effective system for identifying those cells that are stably transformed by accepting recombinant DNA molecules or integrating recombinant DNA molecules into their genome.

[0150] As used herein, the term "regeneration" or "regenerating" refers to the process of growing or developing a plant from one or more plant cells through one or more culture steps. Transformed or edited cells, tissues or explants comprising a DNA sequence insertion or edit can be grown, developed or regenerated into transgenic plants in culture, plugs or soil according to methods known in the art. Therefore, certain embodiments of the present disclosure relate to methods and constructs for regenerating plants from cells having modified genomic DNA resulting from genome editing. The regenerated plants can then be used to propagate additional plants.

[0151] According to one aspect of the present disclosure, the regenerated plant or its progeny plant, plant part or seed can be screened or selected based on a marker, trait or phenotype in the developed or regenerated plant, or its progeny plant, plant part or seed, produced by editing or mutation, or by site-directed integration of an insertion sequence, a transgene, etc. If a given mutation, edit, trait or phenotype is recessive, one or more generations or crosses (e.g., selfing) from the initial R0 plant may be required to produce a homozygous plant for the edit or mutation so that the trait or phenotype can be observed. The zygosity of progeny plants (e.g., plants grown from R1 seeds or subsequent generations) can be tested using any known zygosity assay, such as by using single nucleotide polymorphism (SNP) assays, DNA sequencing, thermal amplification, or polymerase chain reaction (PCR), and / or Southern blots that allow differentiation between heterozygous, homozygous and wild-type plants to test progeny plants.

[0152] The present invention provides methods and techniques for screening and / or identifying cells or plants, etc., for screening and / or identifying the presence of targeted edits or transgenes, and for selecting cells or plants containing targeted edits or transgenes, which can be based on one or more phenotypes or traits, or based on the presence or absence of molecular markers or polynucleotide or protein sequences in cells or plants. As used herein, "molecular techniques" refers to any method known in the fields of molecular biology, biochemistry, genetics, plant biology, or biophysics that involves the use, manipulation, or analysis of nucleic acids, proteins, or lipids. Molecular techniques for detecting the presence of modified sequences in the genome include, but are not limited to: phenotypic screening; molecular marker techniques, such as by or Illumina / Infinium technology; Southern blot; PCR; enzyme-linked immunosorbent assay (ELISA); and sequencing (e.g., Sanger, 454. Pac-Bio and IonTorrent TM). In one aspect, the detection methods provided herein include phenotypic screening. In another aspect, the detection methods provided herein include SNP analysis. In another aspect, the detection methods provided herein include Southern blot. In another aspect, the detection methods provided herein include PCR. In one aspect, the detection methods provided herein include ELISA. In another aspect, the detection methods provided herein include determining the sequence of nucleic acids or proteins. Without limitation, hybridization detection nucleic acids can be used. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

[0153] The nucleic acid can be isolated using conventional techniques in the art. For example, any method can be used to isolate nucleic acid, including but not limited to recombinant nucleic acid technology and / or PCR. General PCR technology is described in, for example, PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid technology includes, for example, restriction enzyme digestion and ligation, which can be used to isolate nucleic acid. Isolated nucleic acid can also be chemically synthesized as a single nucleic acid molecule or as a series of oligonucleotides.

[0154] Detection (e.g., detection of amplification products, hybridization complexes, polypeptides) can be accomplished using detectable labels that can be linked or associated with hybridization probes or antibodies. The term "label" is intended to include the use of direct labels as well as indirect labels. Detectable labels include enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Modified (e.g., edited) plants or plant cells can be screened and selected by any methodology known to those skilled in the art of molecular biology. Examples of screening and selection methodologies include, but are not limited to, Southern analysis, PCR amplification for detecting polynucleotides, Northern blotting, RNase protection, primer extension, RT-PCR amplification for detecting RNA transcripts, Sanger sequencing, next generation sequencing techniques (e.g., for detecting enzyme or ribozyme activity of polypeptides and polynucleotides) Ion Torrent TMThe present invention also can be used to detect the presence or expression of polypeptides and / or polynucleotides. Methods for performing all reference techniques are known in the art.

[0155] As used herein, the term "polypeptide" refers to a chain of at least two covalently linked amino acids. The polypeptide can be encoded by a polynucleotide as provided herein. An example of a polypeptide is a protein. The protein as provided herein can be encoded by a nucleic acid molecule as provided herein. The polypeptide can be purified from a natural source (e.g., a biological sample) by known methods, such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography. The polypeptide can also be purified, for example, by expressing the nucleic acid in an expression vector. In addition, purified polypeptides can be obtained by chemical synthesis. The purity of the polypeptide can be measured using any suitable method, such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

[0156] Antibodies can be used to detect polypeptides. Techniques for detecting polypeptides using antibodies include enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation, and immunofluorescence. Antibodies provided herein can be polyclonal antibodies or monoclonal antibodies. Antibodies with specific binding affinity to polypeptides provided herein can be produced using methods well known in the art. Antibodies provided herein can be attached to solid supports such as microtiter plates using methods known in the art.

[0157] The recombinant DNA molecules provided herein can be present in a host cell, wherein the host cell is any type of cell. Host cells contemplated by the present disclosure include cells selected from the group consisting of bacterial cells, animal cells, plant cells, yeast cells, fungal cells and insect cells.

[0158] For example, a bacterial host cell that can be transformed with a recombinant DNA molecule or a transformation vector comprising Cas12a, a guide RNA, or a combination thereof can be from a genus of bacteria selected from the group consisting of Agrobacterium, Rhizobium, Bacillus, Brevibacillus, Escherichia, Pseudomonas, Klebsiella, Pantoea, and Erwinia.

[0159] Animal host cells transformed with recombinant DNA molecules or transformation vectors comprising Cas12a, guide RNA or a combination thereof may include mammalian host cells, such as fibroblasts, epithelial cells, lymphocytes or macrophages. Animal host cells according to the present disclosure may be immortalized animal cell lines, primary cells or stem cells.

[0160] Plant cells that can be transformed with a recombinant DNA molecule or a transformation vector comprising Cas12a, a guide RNA, or a combination thereof can include a variety of flowering plants or angiosperms, which can be further defined as including a variety of dicot plant species or monocot plant species. The dicotyledonous plant can be leguminous (such as leguminous plants), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), sesame (Sesamum spp.), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatas), cassava (Manihot esculenta), coffee (Coffea spp.), tea (Camellia spp.), fruit trees such as apples (Malus spp.), Prunus plants such as plums, apricots, peaches, cherries, etc., pears (Pyrus spp.), figs (Ficus carica), etc., citrus trees (Citrus spp.), cocoa (Theobromacacao), avocado (Persea americana), olives (Olea europaea), almonds (Prunus amygdalus), walnuts (Juglans spp.), strawberries (Fragaria spp.), watermelon (Citrullus lanatus), pepper (Capsicum spp.), beet (Beta vulgaris), grape (Vitis, Muscadinia), tomato (Lycopersiconesculentum, Solanum lycopersicum), cucumber (Cucumis sativus), and members of the Cruciferae family, such as Arabidopsis thaliana, and members of the Brassica genus (e.g., B. napus, B. rapa, B. juncea), particularly Brassica plants as a source of seed oil.Pulses and legumes include pea (Pisum sativum), alfalfa (Medicago sativa), alfalfa (Medicago truncatula), pigeon pea (Cajanus cajan), guar (Cyamopsis tetragonoloba), carob (Ceratonia siliqua), fenugreek (Trigonella foenum-graecum), soybean (Glycine max), kidney bean (Phaseolus vulgaris), cowpea (Vigna unguiculata), mung bean (Vigna radiata), lima bean (Phaseolus lunatus), broad bean (Vicia faba), lentil (Lens culinaris or Lens esculenta), peanut (Arachis hypogaea), liquorice (Glycyrrhiza glabra), and chickpea (Cicer arietinum). Monocots can be oil palm (Elaeis spp.), coconut (Cocos spp.), banana (Musa spp.), and cereals such as corn (Zea mays), barley (Hordeum vulgare), sorghum (Sorghum bicolor), rice (Oryza sativa), and wheat (Triticum aestivum). Given that the present disclosure is applicable to a wide range of plant species, the present disclosure also applies to other plant structures similar to the pods of legumes, such as pods, siliques, fruits, nuts, tubers, and the like.

[0161] V. Genome-modified plants

[0162] As used herein, "modified" in the context of plants, plant seeds, plant parts, plant cells and / or plant genomes refers to plants, plant seeds, plant parts, plant cells and / or plant genomes that contain engineered changes in the expression level and / or sequence of one or more target genes relative to wild-type or control plants, plant seeds, plant parts, plant cells and / or plant genomes. In fact, the term "modified" can also refer to plants, plant seeds, plant parts, plant cells and / or plant genomes with one or more deletions and / or one or more nucleotide substitutions or nucleotide insertions, which affect endogenous genes introduced by genome editing using any recombinant DNA molecules described herein. In one aspect, the modified plants, plant seeds, plant parts, plant cells and / or plant genomes may include one or more transgenes. Thus, for clarity, a modified plant, plant seed, plant part, plant cell and / or plant genome includes a mutated, edited and / or transgenic plant, plant seed, plant part, plant cell and / or plant genome having a modified genomic sequence relative to a wild-type or control plant, plant seed, plant part, plant cell and / or plant genome.

[0163] Modified plants, plant parts, seeds, etc. can be subjected to mutagenesis, genome editing or site-directed integration, genetic transformation, or a combination thereof. Such "modified" plants, plant seeds, plant parts, and plant cells include "modified" plants, plant seeds, plant parts, and plant cells that retain molecular changes (e.g., changes in expression levels and / or activity) of target genes, or plants, plant seeds, plant parts, and plant cells derived from them. The modified seeds provided herein can produce the modified plants provided herein. The modified plants, plant seeds, plant parts, plant cells, or plant genomes provided herein may contain recombinant DNA constructs or vectors or genome editing provided herein. "Modified plant products" can be any product made from the modified plants, plant parts, plant cells, or plant chromosomes provided herein, or any part or component thereof.

[0164] The modified plant can be further hybridized with itself or other plants to produce modified plant seeds and offspring. The modified plant can also be prepared by hybridizing a first plant comprising a DNA sequence or construct or editing (e.g., genomic deletion) with a second plant lacking a DNA sequence or construct or editing. For example, a DNA sequence or inversion can be introduced into a first plant strain suitable for transformation or editing, which can then be hybridized with a second plant strain to introgress the DNA sequence or editing (e.g., deletion) gene into the second plant strain. The offspring of these hybridizations can be further backcrossed to the desired strain for many times, for example, by 6-8 generations or backcrossing, to produce offspring plants with substantially the same genotype as the original parent strain but for introducing a DNA sequence or editing. The modified plant, plant cell or seed provided herein can be a hybrid plant, plant cell or seed. As used herein, "hybridization" is produced by hybridizing two plants from different varieties, strains, inbred strains or species, so that the offspring includes the genetic material from each parent. Those skilled in the art recognize that higher-order hybrids can also be produced.

[0165] The modified plants, plant parts, plant cells or seeds provided herein can be superior varieties or superior lines."Superior varieties" or "superior lines" refer to varieties with superior agronomic performance produced by breeding and selection.

[0166] As used herein, the term "control plant" (or similar "control" plant seeds, plant parts, plant cells and / or plant genomes) refers to a plant (or plant seeds, plant parts, plant cells and / or plant genomes) used for comparison with a modified plant (or modified plant seeds, plant parts, plant cells and / or plant genomes) and having the same or similar background (e.g., the same parental line, cross, inbred line, experimenter, etc.) as the modified plant (or plant seeds, plant parts, plant cells and / or plant genomes), except for genome editing (e.g., deletion) that affects the target gene. For example, the control plant can be the same inbred line as the inbred line used to prepare the modified plant, or the control plant can be a cross product of the same inbred parental line as the modified plant, except that there is no transgenic event or genome editing that affects the target gene in the control plant. Similarly, an "unmodified control plant" refers to a plant that shares a substantially similar or substantially identical genetic background with the modified plant, but does not have one or more engineered changes (e.g., mutations or edits) to the genome of the modified plant. For comparison purposes with a modified plant, plant seed, plant part, plant cell and / or plant genome, a "wild-type plant" (or similarly a "wild-type" plant seed, plant part, plant cell and / or plant genome) refers to a non-transgenic and non-genome-edited control plant, plant seed, plant part, plant cell and / or plant genome. As used herein, a "control" plant, plant seed, plant part, plant cell and / or plant genome may also be a plant, plant seed, plant part, plant cell and / or plant genome having a similar (but not identical or identical) genetic background to the modified plant, plant seed, plant part, plant cell and / or plant genome, if deemed sufficiently similar to compare the characteristics or traits to be analyzed.

[0167] As used herein, the terms "inhibit," "suppress," "suppress," "inhibit," "knockout," "knockdown," and "downregulate" refer to the downregulation, reduction, or elimination of the expression level of mRNA and / or protein encoded by a target gene in a plant, plant cell, or plant tissue at one or more stages of plant development, as compared to the expression level of such target mRNA and / or protein in a wild-type or control plant, cell, or tissue at the same stage of plant development.

[0168] As used herein, the term "activity" refers to the biological function of a gene or protein. A gene or protein can provide one or more different functions. Therefore, the reduction, destruction or change of "activity" refers to the downregulation, reduction or elimination of one or more functions of a gene or protein in a plant, plant cell or plant tissue at one or more stages of plant development compared to the activity of a gene or protein in a wild-type or control plant, cell or tissue at the same stage of plant development. In addition, therefore, improving "activity" refers to the improvement of one or more functions of a gene or protein in a plant, plant cell or plant tissue at one or more stages of plant development compared to the activity of a gene or protein in a wild-type or control plant, cell or tissue at the same stage of plant development.

[0169] According to some embodiments, plants are provided having mRNA levels of a recombinant DNA molecule as described herein that are reduced or increased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90% or 100% in at least one plant tissue compared to a control plant. According to some embodiments, plants are provided having mRNA expression levels of the recombinant DNA molecules described herein that are reduced or increased by 5%-20%, 5%-25%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-70%, 5%-75%, 5%-80%, 5%-90%, 5%-100%, 75%-100%, 50%-100%, 50%-90%, 50%-75%, 25%-75%, 30%-80%, or 10%-75% in at least one plant tissue as compared to a control plant. According to some embodiments, plants are provided having expression levels of a protein from a recombinant DNA molecule as described herein that are reduced or increased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in at least one plant tissue as compared to a control plant. According to some embodiments, plants are provided having expression levels of a protein from a recombinant DNA molecule as described herein that are reduced or increased by 5%-20%, 5%-25%, 5%-30%, 5%-40%, 5%-50%, 5%-60%, 5%-70%, 5%-75%, 5%-80%, 5%-90%, 5%-100%, 75%-100%, 50%-100%, 50%-90%, 50%-75%, 25%-75%, 30%-80%, or 10%-75% in at least one plant tissue as compared to a control plant.

[0170] According to some embodiments, a plant is provided having a gRNA expression level that is reduced or increased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in at least one plant tissue compared to a control plant.

[0171] According to some embodiments, plants are provided having recombinant DNA molecules that produce increased editing efficiency, wherein the editing efficiency is increased by at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or 100% in at least one plant cell compared to a control plant.

[0172] Modified plants comprising or derived from plant cells comprising the disclosed genomic modifications can be further enhanced with stacked traits, for example, modified crop plants having enhanced traits resulting from expression of the DNA disclosed herein combined with one or more additional genomic modifications that provide beneficial agronomic traits or further improve the enhanced traits.

[0173] The recitation of ranges of values ​​herein is intended merely to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. The recitation of discrete values ​​should be understood to include the range between each value.

[0174] Modified plants comprising plant cells transformed with the recombinant DNA of the present disclosure or derived from plant cells transformed with the recombinant DNA of the present disclosure can be further enhanced with stacked traits, for example, modified crop plants having enhanced traits resulting from expression of the DNA of the present disclosure in combination with one or more agronomic target genes that provide beneficial agronomic traits (such as herbicide and / or pest resistance traits) to the crop plants. For example, traits conferred by the recombinant DNA constructs of the present disclosure can be stacked with other traits with agronomic targets, such as traits that provide insect resistance, such as using genes from Bacillus thuringiensis to provide resistance to Lepidoptera, Coleoptera, Homoptera, Hemiptera and other insects, or improved quality traits, such as improved nutritional value. Molecules and methods for conferring insect / nematode / virus resistance are disclosed in US Pat. Nos. 5,250,515; 5,880,275; 6,506,599; 5,986,175 and US Patent Application Publication No. 2003 / 0150017A1.

[0175] VI. Definitions

[0176] The following definitions are provided to define and clarify the meaning of these terms with reference to the relevant embodiments of the present disclosure as used herein, and to guide those of ordinary skill in the art to understand the present disclosure. Unless otherwise indicated, terms should be understood according to their conventional meanings and uses in the relevant fields, particularly in the fields of molecular biology and plant transformation.

[0177] When introducing elements of the present disclosure or embodiments thereof, the articles "a," "an," "the," and "said" are intended to indicate that there are one or more of the elements. When used in a list of two or more items, the term "and / or" refers to any one, any combination of items, or all of the items associated with the term.

[0178] The terms "comprising," "including," and "having" are intended to be inclusive, and mean that there may be additional elements in addition to the listed elements. For example, any method that "comprising," "having," or "including" one or more steps is not limited to possessing only those one or more steps, and may also encompass other unlisted steps. Similarly, any composition or device that "comprising," "having," and "including" one or more features is not limited to possessing only those one or more features, and may encompass other unlisted features.

[0179] As used herein, "plant" includes whole plants, explants, plant parts, seedlings or plantlets at any stage of regeneration or development.

[0180] As used herein, "plant part" may refer to any organ or intact tissue of a plant, such as meristem, bud organ / structure (e.g., leaf, stem or node), root, flower or flower organ / structure (e.g., bract, sepal, petal, stamen, carpel, anther and ovule), seed, embryo, endosperm, seed coat, fruit, mature ovary, propagule or other plant tissue (e.g., vascular tissue, cortical tissue, ground tissue, etc.) or any part thereof. Plant parts of the present disclosure may be vigorous, inactive, regenerable and / or non-regenerable. "Propaganda" may include any plant part that can grow into a whole plant.

[0181] An "embryo" is a portion of a plant seed that consists of precursor tissues (eg, meristems) that can develop into all or part of an adult plant. An "embryo" may further include a portion of a plant embryo.

[0182] "Meristem" or "meristem tissue" includes undifferentiated cells or meristem cells that are capable of differentiating to give rise to one or more types of plant parts, tissues, or structures, such as all or part of a shoot, stem, root, leaf, seed, etc.

[0183] As used herein, "genomic DNA" or "gDNA" refers to the chromosomal DNA of an organism. As used herein, "genomic modification" (also referred to as "modification") or "genomic editing" (also referred to as "editing") refers to any modification of the nucleotide sequence of a genome compared to a wild-type or control plant. Genomic modification or genome editing includes deletion, insertion, substitution, inversion, duplication, or any combination thereof.

[0184] As used herein, "T-DNA" or "transfer DNA" refers to the transfer DNA of certain bacterial species, such as the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens.

[0185] As used herein, "editing efficiency" (also referred to as "mutagenesis rate") refers to the number of TO lines that contain a target mutation compared to the total number of TO lines transformed with an applicable construct to generate the target mutation.

[0186] As used herein, the "vegetative stage" of plant development is the growth period between germination and flowering. For corn, the plant development scale commonly used in the art is called the V-stage. The V-stage is defined according to the uppermost leaf visible in the leaf collar. VE corresponds to emergence, V1 corresponds to the first leaf, V2 corresponds to the second leaf, V3 corresponds to the third leaf, and V(n) corresponds to the nth leaf. VT occurs when the last branch of the tassel is visible but before the appearance of the tassel silk. When corn fields are planted in stages, each specific V-stage is defined only when 50% or more of the plants in the field are at or above that stage. Other development scales are known to those skilled in the art and can be used with the methods of the present invention. The stages of corn reproduction are as follows: R1 (silking; corn silk emerges from the shell); R2 (bubbling; the outside of the corn kernel is white and the internal liquid is clear); R3 (white emulsion, the outside of the corn kernel is yellow, and the internal liquid is milky white); R4 (dough-like; the internal liquid thickens due to starch accumulation); R5 (depression; more than 50% of the corn kernels are depressed); R6 (physiological maturity; black layer is formed). Vegetative and reproductive stages for other crop species are well known to those skilled in the art, and numerous publications describing these stages can be found on the World Wide Web and elsewhere.

[0187] As used herein, the term "isogenic" refers to genetically identical, while non-isogenic refers to genetically different.

[0188] All methods described herein can be carried out in any suitable order, unless otherwise specified herein or clearly contradictory to the context. The use of any and all examples or exemplary language (such as, "for example") provided with respect to certain embodiments herein is intended only to illustrate the present disclosure, rather than to limit the scope of the additional claims for protection of the present disclosure.

[0189] Example

[0190] Example 1. Evaluation of novel Cas12a variants with a single promoter guide structure in barley

[0191] The editing efficiency of the Lachnospiraceae bacterial Cas12a nuclease (LbCas12a) variant was evaluated in barley. In particular, the rice optimized Cas12a coding sequence (CDS) (OsCas12a; SEQ ID NO: 1), the human optimized Cas12a CDS (HsCas12a; SEQ ID NO: 3), the Arabidopsis optimized Cas12a CDS (ttAtCas12a; SEQ ID NO: 5) that functions in dicotyledons and contains the D156R "high temperature resistance" mutation was evaluated. Two other variants were also created and evaluated, HsCas12a carrying the D156R mutation (ttHsCas12a; SEQ ID NO: 7) and ttAtCas12 carrying 8 introns (ttAtCas12+int; SEQ ID NO: 8). Constructs comprising Cas12a nuclease variants selected for evaluation each further comprise a C-terminal nuclear localization signal operably connected to the corresponding codon-optimized Cas12a nuclease variant. In short, OsCas12a comprises a polynucleotide of SEQ ID NO:42 (encoding SEQ ID NO:43); HsCas12a and ttHsCas12a comprise a polynucleotide of SEQ ID NO:44 (encoding SEQ ID NO:43); and ttAtCas12a and ttAtCas12+int comprise a polynucleotide of SEQ ID NO:45 (encoding SEQ ID NO:43). OsCas12a variants also comprise an N-terminal nuclear localization signal (SEQ ID NO:40; encoding SEQ ID NO:41). The novel ttAtCas12a+int variant also comprises a synonymous G to A substitution at base 2471 to remove the hidden splice site after intron insertion.

[0192] The target barley gene used in the evaluation was HORVU.MOREX.r3.1HG0069960, using Figure 1The construct structure shown. A single U6 promoter is used to drive four guide RNA sequences (SEQ ID NO: 20-23; also referred to herein as V1 construct or V1 array). LbCas12a can process a single gRNA transcript containing multiple guides into a separate guide by recognition and cutting at its own direct repeat (DR) sequence, which forms the invariant part of the guide. The self-processed hepatitis delta ribozyme (HDV) sequence is placed at the 3' end of the array before the terminator to prevent the formation of false additional guides from the final DR. Create 5 constructs, each of which contains a single Cas12a nuclease (OsCas12a, HsCas12a, ttAtCas12a, ttHsCas12a and ttAtCas12+int) and the same 4 gRNA sequences. Five constructs were transformed into barley cultivar Golden Promise (Golden promise) using Agrobacterium-mediated transformation, and T0 plants were regenerated. DNA was extracted from T0 plants and PCR amplified the HORVU.MOREX.r3.1HG0069960 locus for sequencing analysis (Sanger sequencing). The ABI files were analyzed by viewing the chromatograms in alignment with the wild-type sequence using Benchling (https: / / www.benchling.com / ) and the target mutations were confirmed using the ICE tool (Synthego-CRISPR Performance Analysis) to score plants as positive or negative for mutagenesis.

[0193] Figure 2Shown are the number of T0 lines tested / containing mutations. About 20 T0 lines were created for each of the 5 constructs, which showed significant differences in the number of target mutant lines. The rice-optimized OsCas12a showed no mutant lines (0 / 21), while the human-optimized HsCas12a produced 6 / 20 (30%) mutant lines. Interestingly, the inclusion of the D156 mutation in the human-optimized sequence (ttHsCas12a) increased the mutation rate to 12 / 22 (54%). More interestingly, the Arabidopsis-optimized Cas12a CDS (ttAtCas12a) containing the D156R "high temperature resistance" mutation did not produce mutant lines (0 / 17), but the addition of introns (ttAtCas12a+int) produced 20 / 23 (87%) mutant lines. Therefore, adding introns to the initially non-functional Arabidopsis CDS resulted in ttAtCas12+int, which was converted into the most efficient CDS evaluated in barley. In addition, both novel LbCas12a variants, ttHsCas12a and ttAtCas12a+int, resulted in highly efficient targeted mutagenesis in barley. These results confirm the significant and unexpected effects of the codon usage D156 mutation and the presence of introns on the mutagenesis efficiency of Cas12a in barley.

[0194] Example 2. Evaluation of novel Cas12a variants with multiple promoter guide structures in barley

[0195] Although 4 gRNA sequences were used in the LbCas12a comparison described in Example 1, only 2 were determined to be active based on sequencing results. In order to further verify the editing efficiency of the Cas12a variants described herein, additional gRNA constructs were used to evaluate constructs, wherein each guide was driven by a separate TaU6 / TaU3 promoter and flanked by a self-cleaving ribozyme (also referred to herein as a V2 construct or V2 array); 5' hammerhead (HH) and 3' HDV (Wolter 2019). Each HDV is followed by a transcription termination signal to prevent read-through. The V2 construct was coupled to ttHsCas12a and used to target HORVU.MOREX.r3.1HG0069960. 8 additional constructs (4 pairs) containing ttHsCas12a coupled to a V1 or V2 structure were prepared, targeting 4 additional barley genes, each with 4 guide RNA sequences. This allows direct comparison of the V1 / V2 guide structures. As described in Example 1, 19-25 TO lines were created for each construct, and these lines were subjected to PCR / Sanger sequencing, alignment, and ICE target mutation testing.

[0196] Figure 3The percentage of T0 strains carrying mutations at each guide target and the percentage of strains mutated at any guide target are shown. The V2 array is more efficient than the V1 array overall, producing the highest percentage of mutations at any guide target (36>23; 90>29; 90>88; 91>65; 85>54). Without being bound by any particular theory, when the V1 array is compared with the V2 array, the difference in editing efficiency can be attributed to the different abundances of each gRNA. For example, a single TaU6 promoter can only transcribe a short sequence with a length approximately equal to that of a single guide, so that the downstream guides in array positions 2, 3, and 4 are under-expressed or missing. In the V2 array, each of the 4 guides can be effectively transcribed, because the transcription of its own promoter makes the guide RNAs in array positions 1-4 abundant. In particular, for all 5 target genes, the V1 array shows a higher mutagenesis with a guide at array position 1 than V2 at array position 1. Nevertheless, these results confirm that ttHsCas12a with a V2 guide array achieves mutagenesis of 4 / 5 barley target genes in approximately 90% of T0 plants. These results also indicate that the editing efficiency in barley can be further improved using the ttAtCas12a+int variant, which performs best in the Cas12a comparison described in Example 1 (87%>54%).

[0197] Example 3. Phenotypic identification of barley edited by Cas12a variants and inheritance of editing in progeny plants

[0198] In order to study the ability of ttHsCas12a to produce a knockout phenotype in the first generation, the mutagenesis of the barley gene HORVU.MOREX.r3.2HG0184740 was evaluated. Specifically, the construct containing ttHsCas12a and a gRNA construct targeting HORVU.MOREX.r3.2HG0184740 was transformed into the barley cultivar Golden Promise using Agrobacterium-mediated transformation as described in Examples 1 and 2. It is known that knocking out two copies of HORVU.MOREX.r3.2HG0184740 results in the conversion of two-rowed golden barley spikelets into six-rowed spikelets (Komatsuda et al., 2007). This phenotype was observed in several active T0 lines when using V1 and V2 guide structures. Figure 4 An exemplary strain containing this phenotype is shown. These results confirm that ttHsCas12a produces the expected knockout phenotype in the first generation.

[0199] Further analysis of the T0 lines using the ICE tool calculated that a T0 line targeting HORVU.MOREX.r3.1HG0069960 contained 47% and 42% of the -10bp and -3bp alleles, respectively. Of the 24 T1 plants generated therefrom, 5 were T-DNA-free, 2 were homozygous for the 3bp deletion, 1 was homozygous for the 10bp deletion, and 2 were heterozygous ( Figure 5 ). These results confirmed that mutations generated by ttHsCas12a editing in T0 plants were inherited in subsequent generations.

[0200] Example 4. Evaluation of novel Cas12a variants with single and multiple promoter guide structures in Brassica oleracea

[0201] The editing efficiency of the Lachnospiraceae bacterial Cas12a nuclease (LbCas12a) variant was evaluated in cabbage. Specifically, the human-optimized Cas12a CDS (HsCas12a) as described in Example 1, the Arabidopsis-optimized Cas12a CDS (ttAtCas12a) containing the D156R "high temperature resistance" mutation, the novel HsCas12a (ttHsCas12a) carrying the D156R mutation, and the ttAtCas12 (ttAtCas12+int) carrying 8 introns were selected for evaluation. The target cabbage gene used in the evaluation is Bo2g016480.

[0202] Create as Figure 6 The construct shown in A (referred to herein as S5, S6, S7 and S8). In short, S5 incorporates a guide structure similar to the V1 array, in which 4 guide RNAs are driven by an AtU626 promoter, and the processing of a single transcript is performed by the Cas12a nuclease itself. S6 has the same LbCas12a expression cassette as S5 (ttAtCas12a), but includes a guide structure similar to the V2 array, in which the expression of a single guide is driven by the AtU626 promoter. Therefore, four S6 constructs were prepared, each containing different guide RNAs (A, B, C or D). The V2 guide structure is retained in S7 using guide C in combination with ttHsCas12a. Similarly, S8 includes a V2 structure using guide C, but includes ttAtCas12+int variants. The construct is transformed into cabbage alone using Agrobacterium-mediated transformation, and T0 plants are regenerated.

[0203] Figure 6B shows the percentage of T0 plants that are mutated as each target locus. From the 59 S5 T0 plants screened, only 2 (3%) carried target mutations, both of which were located at the guide C target. T0 plants transformed with S6 (which contains the same LbCas12a expression cassette as the V2 guide structure) resulted in 10% of plants being successfully mutated at locus A, and 50% of plants being successfully mutated at locus C. Therefore, by changing the guide structure from V1 to V2, the editing efficiency of targeted mutagenesis was increased from 0% to 10% at locus A and from 3% to 50% at locus C.

[0204] T0 plants transformed with S7 resulted in 50% of plants carrying mutations at locus C, indicating that ttHsCas12a and ttAtCas12a appear to be equally effective in cabbage. In addition, when T0 plants were transformed with S8, the efficiency of targeted mutagenesis increased to 68% at locus C. These results indicate that the inclusion of 8 introns in ttAtCas12a alone surprisingly increased the efficiency of targeted mutagenesis from 50% to 68%.

[0205] Example 5. Inheritance of editing in progeny plants of Brassica oleracea

[0206] To ensure that LbCas12a-derived mutations can be passed to the next generation in cabbage in the absence of T-DNA, two T0 lines with mutations at locus C were analyzed in the T1 generation. 24 seeds of each of the two T0 lines were germinated, and PCR was used to identify NptII markers for offspring without T-DNA. In the first line, 9 / 24 offspring did not contain T-DNA, and the 3bp deletions at locus C were all homozygous. In the second line, 5 / 24 offspring did not contain T-DNA, three of which contained 9bp double allele deletions, and two contained 12bp double allele deletions ( Figure 7 ). These results confirm that ttHsCas12a produces the expected knockout phenotype in the first generation. These results also confirm that mutations edited by LbCas12a in cabbage T0 plants show inheritance in subsequent plants.

[0207] Example 6. Evaluation of novel Cas12a variants editing in wheat plants

[0208] Editing efficiency experiments similar to those described in Examples 1-4 were performed in wheat. It is currently believed that the editing efficiency in wheat is very low (about 5%), with only one significant increase to 24% incidence. Based on the results disclosed herein, it is expected that ttHsCas12a and ttAtCas12a+int variants can significantly increase the efficiency of Cas12a mutagenesis in wheat to a level similar to that observed in barley.

[0209] Two high-performance versions of LbCas12a identified in previous examples were evaluated in wheat. Guide sequences (Wang, 2021) have been used to target various genes together with human codon-optimized LbCas12a (HsCas12a) tested in barley as described in previous examples. From these results, guides that lead to mutations in target genes that can be used in this experiment were identified. Fig. 9 The construct structure shown uses two guides targeting TaGW7 and one guide targeting TaGW2.

[0210] Two constructs were prepared, both targeting GW7 and GW2, which differed only in the LbCas12a version used. Construct 1 contained ttHsCas12a (SEQ ID NO: 5) and construct 2 contained ttAtCas12a+8 intron (SEQ ID NO: 8). 48 independent wheat lines were created for each construct, and the presence of target mutations in each of the three subgenomes (A, B and D) of GW7 and GW2 targets was assessed by PCR and Sanger sequencing.

[0211] Both constructs lead to mutagenesis in wheat, and as in barley, construct 2 (ttAtCas12a+8 introns) is more effective than construct 1 (ttHsCas12a) in general. At locus GW2, 50% of ttHsCas12a lines mutate in at least one of 3 subgenomes compared to 83% of ttAtCas12a+8 intron lines. At GW7 locus, the figure is 75% and 94% respectively. Compared with 38% of ttAtCas12a+8 intron lines, 21% of ttHsCas12a lines mutate in all 3 subgenomes at GW2 locus. At GW7 locus, the figure is 38% and 71% respectively. 19% of ttHsCas12a lines mutate in all 3 subgenomes at GW2 and GW7 loci, and the figure is increased to 33% in ttAtCas12a+8 intron lines. Of the 288 alleles available at the two GW2 plus GW7 loci, 44% were mutated in the ttHsCas12a lines and 74% were mutated in the ttAtCas12a+8 intron lines of the 48 lines created for both constructs.

[0212] These results suggest that ttAtCas12a+8 intron is more efficient than ttHsCas12a in wheat.

[0213] Alternative more efficient guide structures incorporating tRNA sequences instead of ribozymes were also tested in wheat. Fig.10As shown, a third construct was created using the ttAtCas12a+8 intronic nuclease and three guide RNAs in this alternative structure.

[0214] This structure further improves the result, 96% of strains include mutations in at least one GW2 subgenome, and 94% of strains include mutations in at least one GW7 subgenome. 90% of all 3 GW2 subgenomes and 77% of all GW7 subgenomes were edited in the same strain. 73% of strains include mutations in all 3 subgenomes of GW2 and GW7. Of the 288 alleles at GW2 and GW7 loci, 258 (90%) were edited, divided into 93% of GW2 alleles and 86% of GW7 alleles. In fact, the greatest improvement using tRNA guide structure is due to the GW2 locus, which may be obtained by making more GW2T6 guide transcripts to be easily obtained in a form compounded with Cas12a nuclease.

[0215] The high efficiency of the constructs disclosed herein is very surprising relative to previous studies conducted in protoplasts (Wang, 2001), which reported a maximum efficiency of approximately 14%. Previously reported stable transgenic lines included only 2 / 51 (4%) lines that contained a mutation in one subgenome at the GW7 locus but not at GW2.

[0216] In summary, the ttAtCas12a+intron construct disclosed herein has been demonstrated to be highly effective in wheat. When two tRNA guides were used to target GW7, 86% of the available alleles were mutated. When one tRNA guide was used to target GW2, 93% of the available alleles were mutated.

[0217] Example 7. Evaluation of novel Cas12a variants in corn plants

[0218] Editing efficiency experiments similar to those described in Examples 1-4 will be performed in corn. It is currently believed that the editing efficiency in corn using LbCas12a is very low. Based on the results disclosed herein, it is expected that the ttHsCas12a and ttAtCas12a+int variants can significantly improve the efficiency of Cas12a mutagenesis in corn to a level similar to that observed in barley and cabbage.

[0219] Example 8. Comparison of editing efficiency of ttAtCas12a with and without introns in Arabidopsis

[0220] Here, by using Fig.11Two guide RNAs in the construct structure shown target the acetolactate synthase (ALS) gene in Arabidopsis thaliana (At3g48560) to compare the efficiency of ttAtCas12a with and without introns, where the Cas12a nuclease is driven by an egg cell-specific promoter (EC.en). Egg cell expression is not expected to be present in the first generation plants (T1) until after meiosis, when egg cell expression may occur in isolated egg cells containing the transgene.

[0221] Only two transgenic lines containing the intronic version of Cas12a were obtained. However, due to the role of this gene in essential amino acid synthesis, complete knockout of this gene is likely to be lethal, which could lead to the inadvertent selection of lines with lower editing efficiency.

[0222] For two intron-containing lines (prefix 3312), 48 strains / lines were screened, of which 21% and 12.5% ​​were edited at guide 1 (mean 16.7%), and 67% and 52% were edited at guide 2 (mean 59.5%).

[0223] Several strains of Cas12a versions without introns were obtained. For the non-intron strain (prefix 3310), enough seeds were germinated to screen 24 T2 plants / strains of 9 randomly selected strains. The efficiency of Guide 1 varied between 0% and 17%, and the efficiency of Guide 2 varied between 4% and 58%, with an overall average efficiency of 5.1% for Guide 1 and 30% for Guide 2.

[0224] These results seem to indicate that for both strains evaluated, the Cas12a version containing introns has better performance. Moreover, the data confirm that the ttCas12a version with 8 introns disclosed herein functions in Arabidopsis.

[0225] Example 9. Further evaluation of Cas12a variants in barley

[0226] Additional constructs were assembled to further test Cas12a variants in barley. Exemplary variants have Fig.12 The constructs shown were tested using Fig.12 12 LbCas12a coding sequence (CDS) variants of the construct structure in , wherein each construct targets the same 3 genes, each with only one guide shown to be functional in the previous examples.

[0227] Guide 1 targets HORVU.MOREX.r3.2HG0133680, Guide 2 targets HORVU.MOREX.r3.7HG0640970, and Guide 3 targets HORVU.MOREX.r3.6HG0611290. The only difference between the constructs is the coding sequence they contain. Fig.13 12 CDSs are shown in . 20 independent transgenic barley plants were prepared for each of the 12 constructs, sampled once they were large enough, and screened for editing at the target locus by PCR and amplicon sequencing. The editing efficiency of the 12 CDSs for three different gene targets was determined. The editing efficiency of HsCas12a with and without D156R in barley was determined. The editing efficiency of AtCas12a with and without introns in barley was determined.

[0228] The effects of three additional gene targets on the editing efficiency of HsCas12a, ttHsCas12a and ttAtCas12a+8 introns in barley were observed. In addition, the effects of different numbers of introns in Cas12a variants were determined, including AtCas12a (ttAtCas12a; SEQ ID NO:5) with D156R compared to ttAtCas12a+1 intron and ttAtCas12a+8 introns. The editing efficiency of ttAtCas12a+8 introns, ttAtCas12a+S1 introns (retaining introns 1 / 2 / 3), ttAtCas12a+S2 introns (retaining introns 4 / 5 / 6) and ttAtCas12a+S3 introns (retaining introns 7 / 8) were also evaluated.

[0229] A rice codon-optimized Cas12a CDS (OsCas12a+12 intron; SEQ ID NO: 58) was developed using various short Arabidopsis introns, and the gene editing efficiency of this coding sequence was evaluated compared to the rice optimized Cas12a coding sequence (CDS) (OsCas12a; SEQ ID NO: 1).

[0230] Example 10. Further evaluation of Cas12a variants in mammalian cells

[0231] Three Cas12a variants targeting DNMT-1, EXM1 and FANCF genes, L0-Cas12a-HsD156R (human codon optimized), Pics190022 (Arabidopsis codon optimized) and EC00968 (modified Arabidopsis codons) were provided as glycerol stocks in bacteria. Mammalian cells (FreeStyleTM 293-F cells, QIB Extra, Ltd.) were transfected. The expression of Cas12a was determined by dot blot, and the reaction efficiency was evaluated by flow cytometry and sequencing.

[0232] The recombinant bacterial cells carrying the plasmid with Cas12a are grown and purified. By cloning each of the three Cas12a inserts into the pcDNA3.1-U6 vector, a novel Cas12a recombinant plasmid is produced. For the crRNA plasmid, DNMT1 gRNA (SEQ ID NO: 47), EMX1 gRNA (SEQ ID NO: 48) and FANCF gRNA (SEQ ID NO: 49) are synthesized and cloned into pcDNA3.1-U6 individually. A total of 6 recombinant plasmids based on pcDNA3.1-U6 vectors are produced.

[0233] In order to obtain sufficiently pure recombinant plasmids for mammalian transfection, the recombinant plasmids generated above were transformed into competent cells using a heat shock protocol. 10-β competent E. coli cells. Super optimal liquid medium with catabolite inhibition was added to the cells and incubated at 37°C. The suspension was spread on LB plates containing carbenicillin. Colonies from each transformation reaction were selected and grown in LB liquid medium, and the recombinant plasmid was purified using the PureLinkTM HiPurePlasmid Miniprep Kit, and the samples were analyzed on agarose gel electrophoresis after restriction digestion to confirm the integrity of the recombinant plasmid.

[0234] 16 hours before transfection, FreeStyleTM 293-F cells were seeded in 48-well plates with antibiotic-free medium (1 plate per construct). Using Lipofectamine 2000, cells were co-transfected with each recombinant Cas12a plasmid and each crRNA recombinant plasmid, producing 9 types of co-transfection. Cells transfected with relevant Cas12a plasmids were used only as negative controls. In order to test transfection efficiency and Cas12a expression, co-transfection of three Cas12a plasmids and DNMT1 gRNA targets was performed. Control transfection was performed only with Cas12a plasmids. After incubation for 8 hours, the transfection medium was removed and replaced with fresh medium. After incubation for 72 hours, the Cas12a expression of cells was checked by antibody detection. In short, the transfected cells or control cells were lysed, and the extracted proteins were analyzed by dot blot analysis of the second antibody conjugated with mouse anti-lbCas12a antibody and anti-mouse IgG-HRP. According to the results, the transfection conditions were optimized before transferring to other co-transfection combinations.

[0235] In order to analyze the target gene cutting, sequencing is used to monitor EMX1 and FANCF cutting, and DNMT1 cutting (due to the availability of commercial antibodies suitable for this target) is determined by sequencing and flow cytometry. For flow cytometry, the transfected cells expressing Cas12a (produced by step 3) are first stained with viability dye (Zombie Fixable Viability), then fixed and permeabilized using fixation / permeabilization buffer, and finally, cells are incubated with anti-DNMT1-PE antibodies. For sequencing methods, FreeStyleTM 293-F cell genomic DNA is purified and used as a template for PCR using specific primers for the target site gene region. The PCR product is further purified using a DNA extraction kit (Qiagen Gel extraction kit, Qiagen) and sequenced in an internal sequencing facility.

Claims

1. A recombinant DNA molecule comprising a polynucleotide sequence selected from the group consisting of: a. A sequence having at least 85% identity to any one of SEQ ID NOs: 1, 3, 5, 7 and 8; b. A sequence comprising SEQ ID NOs: 1, 3, 5, 7 and 8; c. A fragment of a sequence having at least 85% sequence identity to any one of SEQ ID NOs: 1, 3, 5, 7 and 8, wherein the fragment has nuclease activity; c. a fragment of any one of SEQ ID NO: 1, 3, 5, 7 and 8; and d. A sequence encoding a protein having at least 85% identity to any one of SEQ ID NOs: 2, 4, 6 and 9; wherein the protein encoded by the polynucleotide sequence comprises a modification at amino acid position 156 compared to the protein comprising the amino acid sequence of SEQ ID NO: 46, and at least one intron sequence having a sequence at least 85% identical to any one of SEQ ID NOs: 10-17 or a functional fragment thereof.

2. A recombinant DNA molecule according to claim 1, wherein the sequence is at least 90% identical to any one of SEQ ID NOs: 1, 3, 5, 7 and 8, and encodes a protein having a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO:

46.

3. A recombinant DNA molecule according to claim 2, wherein the sequence has at least 95% identity with any one of SEQ ID NOs: 1, 3, 5, 7 and 8, and encodes a protein having a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO:

46.

4. The recombinant DNA molecule of claim 1, wherein the sequence comprises any one of SEQ ID NOs: 1, 3, 5, 7 and 8.

5. The recombinant DNA molecule of claim 1, wherein the modification at amino acid position 156 is further defined as a substitution of aspartic acid to arginine.

6. The recombinant DNA molecule of claim 1, wherein the polynucleotide sequence further comprises an intron sequence of SEQ ID NOs: 10-17.

7. A transgenic plant cell comprising the recombinant DNA molecule according to claim 1.

8. The transgenic plant cell according to claim 7, wherein the transgenic plant cell is a monocotyledonous plant cell.

9. The transgenic plant cell of claim 8, wherein the monocotyledonous plant cell is selected from the group consisting of barley, cabbage, wheat and corn cells.

10. The transgenic plant cell of claim 7, wherein the transgenic plant cell is a dicotyledonous plant cell.

11. A transgenic plant or part thereof, comprising the recombinant DNA molecule according to claim 1.

12. A progeny plant or part thereof of the transgenic plant according to claim 11, wherein said progeny plant or part thereof comprises said recombinant DNA molecule.

13. A transgenic seed, wherein the seed comprises the recombinant DNA molecule of claim 1.

14. The recombinant DNA molecule according to claim 1, wherein: a. the recombinant DNA molecule is expressed in a plant cell to produce a genome modification; or b. The recombinant DNA molecule is operably linked to a vector, and the vector is selected from the group consisting of a plasmid, a phagemid, a bacmid, a cosmid and a bacterial or yeast artificial chromosome.

15. The recombinant DNA molecule of claim 14, which is present in a host cell, wherein the host cell is selected from the group consisting of a bacterial cell and a plant cell.

16. The recombinant DNA molecule of claim 15, wherein the bacterial host cell is from a genus of bacteria selected from the group consisting of Agrobacterium, Rhizobium, Bacillus, Brevibacillus, Escherichia, Pseudomonas, Klebsiella, Pantoea, and Erwinia.

17. The recombinant DNA of claim 15, wherein the plant cell is a dicotyledonous or monocotyledonous plant cell.

18. The recombinant DNA of claim 17, wherein the plant cell is selected from the group consisting of legume, sunflower, safflower, sesame, tobacco, potato, cotton, sweet potato, cassava, coffee, tea, apple, pear, fig, citrus, cocoa, avocado, olive, almond, walnut, strawberry, watermelon, pepper, beet, grape, tomato, cucumber, shepherd's purse, Brassica, pea, alfalfa, Medicago truncatula, pigeon pea, guar, carob, fenugreek, soybean, bean, cowpea, mung bean, lima bean, broad bean, lentil, peanut, licorice, chickpea, oil palm, coconut, banana, corn, barley, sorghum, rice, and wheat cells.

19. A method for producing a plant comprising a genomic modification, the method comprising: a. expressing in a plant cell a recombinant DNA molecule according to claim 1 and a guide RNA compatible with a protein encoded by the recombinant DNA molecule; b. introducing a modification into at least one target site in the genome of the plant cell; c. identifying and selecting one or more plant cells of step (b) comprising said modification in said plant genome; and d. Regenerating at least one plant from at least one or more cells selected in step (c).

20. The method of claim 19, wherein the modification is selected from the group consisting of substitution, insertion, inversion, deletion, duplication, and combinations thereof.

21. The method of claim 19, wherein the plant is a monocot.

22. The method of claim 21, wherein the plant is selected from the group consisting of barley, cabbage, wheat and corn plants.

23. A method for producing progeny seeds comprising the recombinant DNA molecule of claim 1, the method comprising: a. Planting a first seed comprising a recombinant DNA molecule according to claim 1; b. growing plants from the seeds of step (a); and c. harvesting progeny seeds from the plant, wherein the harvested seeds contain the recombinant DNA molecule.

24. A method for introducing a genomic modification in a plant, the method comprising: a. expressing in a plant a protein or a fragment thereof encoded by a DNA molecule according to claim 1; as well as b. expressing in plant cells a guide RNA compatible with the protein or fragment thereof having nuclease activity.

25. A method for detecting the presence of the recombinant DNA molecule according to claim 1 in a sample comprising plant genomic DNA, comprising: a. contacting the sample with a DNA probe that hybridizes under stringent hybridization conditions to genomic DNA from a plant comprising the recombinant nucleic acid DNA according to claim 1, and does not hybridize under such hybridization conditions to genomic DNA from other isogenic plants that do not comprise the recombinant DNA molecule according to claim 1, wherein the probe is homologous or complementary to a fragment of any one of SEQ ID NOs: 1, 3, 5, 7, 8, or a sequence encoding a protein comprising an amino acid sequence having at least 85%, or 90%, or 95%, or 98%, or 99%, or about 100% amino acid sequence identity with any one of SEQ ID NOs: 2, 4, 6, and 9; b. subjecting the sample and the probe to stringent hybridization conditions; and c. Detecting the hybridization of the DNA probe to the recombinant DNA molecule.

26. A method for detecting the presence of a nuclease protein or a fragment thereof in a sample comprising a protein, wherein the protein comprises the amino acid sequence of any one of SEQ ID NOs: 2, 4, 6 and 9 or a fragment thereof; or the protein comprises an amino acid sequence having at least 85%, or 90%, or 95%, or 98%, or 99%, or about 100% amino acid sequence identity to any one of SEQ ID NOs: 2, 4, 6 and 9 or a fragment thereof; the method comprising: a. contacting the sample with an immunoreactive antibody; as well as b. Detecting the presence of the protein or fragment thereof.

27. A method for modifying a polynucleotide fragment encoding a Cas12a protein or a fragment thereof having nuclease activity, the method comprising: a. obtain a polynucleotide sequence of any one of SEQ ID NO: 1, 3, 5, 7 and 8; as well as b. introducing a modification into at least one target site in the polynucleotide sequence such that the protein encoded by the polynucleotide sequence comprises a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO: 46; The modified polynucleotide sequence further comprises at least one intron sequence having a sequence that is at least 85% identical to any one of SEQ ID NOs: 10-17 or a functional fragment thereof.

28. The method of claim 27, wherein the protein encoded by the modified polynucleotide sequence comprises a substitution of aspartic acid to arginine at amino acid position 156 compared to a polynucleotide fragment lacking the modification.

29. The method of claim 28, wherein the modified polynucleotide sequence further comprises an intron sequence of SEQ ID NO: 10-17.

30. The method of claim 27, wherein the modified polynucleotide sequence comprises an aspartic acid to arginine modification at amino acid position 156 and further comprises at least one intron sequence of SEQ ID NOs: 10-17.

31. A method for improving gene targeting in crops using CRISPR-Cas12a gene editing, comprising the following steps: a. expressing in a plant cell a recombinant DNA molecule according to claim 1 and a guide RNA compatible with a protein encoded by the recombinant DNA molecule; as well as b. introducing a modification into at least one target site in the genome of a plant cell; wherein the modification is introduced at a higher rate when compared to the rate of introduction of the modification using a method comprising expressing a DNA molecule encoding the amino acid of SEQ ID NO:

46.

32. The method of claim 31, wherein the sequence has at least 90% identity to any one of SEQ ID NOs: 1, 3, 5, 7 and 8, and encodes a protein having a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO:

46.

33. The method of claim 32, wherein the sequence has at least 95% identity to any one of SEQ ID NOs: 1, 3, 5, 7 and 8, and encodes a protein having a modification at amino acid position 156 compared to a protein comprising the amino acid sequence of SEQ ID NO:

46.

34. The method of claim 31, wherein the sequence comprises any one of SEQ ID NO: 1, 3, 5, 7 and 8.

35. The method of claim 31, wherein the modification at amino acid position 156 is further defined as a substitution of aspartic acid to arginine.

36. The method of claim 31, wherein the polynucleotide sequence further comprises an intron sequence of SEQ ID NOs: 10-17.

Images