A method for inoculating large trees with Tuber yunnanense K. T. Chen var. lijiangense (Y. C. Liu, K. T. Chen & B. Liu) Y. C. Liu, K. T. Chen & B. Liu

Through the large tree inoculation method that improves soil in a specific environment and sprays spores seed liquid, the problem of insufficient yield of white truffles in Lijiang was solved, and efficient and rapid growth of truffles was achieved, with a success rate of up to 80%.

CN119234618BActive Publication Date: 2025-07-25INST OF BIOTECHNOLOGY & GERMPLASM RESOURCES YUNNAN ACAD OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411745585.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-02
Publication Date
2025-07-25
Estimated Expiration
2044-12-02

AI Technical Summary

Technical Problem

The prior art is difficult to effectively increase the yield of Lijiang white truffles on forest land without truffle ponds, and the traditional methods have long cycles and high costs, and excessive mining of wild resources leads to a decrease in yield.

Method used

By inoculating large trees under specific environmental conditions, using lime and stone powder to improve the soil, spraying spore seed liquid and managing it, we ensure that the soil pH value and exchangeable calcium content meet the growth needs of Lijiang white truffles, combined with lime disinfection and regular management, shortening the growth cycle.

Benefits of technology

The efficient inoculation of Lijiang white truffle on forest land without truffle ponds was achieved, with a success rate of up to 80%. The truffle fruiting entity could be seen in the winter of that year, significantly shortening the growth cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119234618B_ABST
    Figure CN119234618B_ABST
Patent Text Reader

Abstract

The present invention relates to a method for inoculating large trees with Tuber yunnanense, belonging to the field of biotechnology. The method includes seven major steps: requirements for the environment and inoculated trees, selection of inoculation time, preparations before inoculation, strain production, inoculation of large trees, management after inoculation, and collection of truffles. Compared with the truffle conservation and propagation technology and mycorrhizal seedling cultivation and planting technology, the cycle of the present invention is shorter. A small amount of truffle fruiting bodies were found to form in the winter of the year when the large trees were inoculated, and the success rate of inoculating large trees is over 80%, with obvious effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a large tree inoculation method of Lijiang white truffles. Background Art

[0002] Truffles, also known as truffles, belong to the Pezizales order and Tuberaceae family. They are a famous type of wild edible fungi. Among them, the Italian white truffle and the French black truffle are the most precious. They are known as "diamonds in the kitchen" and "underground gold". They are often called "pig arch mushrooms" by people in southwest my country, and are mostly called truffles in business.

[0003] Truffles are fragrant and delicious, and are one of the favorite mushrooms in Europe and the United States. They are mainly eaten fresh, made into food seasonings, or used to extract the required ingredients for use in cosmetics.

[0004] Lijiang White Truffle was officially named in 2011. It is a kind of white truffle grown in Yongsheng County, Lijiang City, Yunnan Province. It has a diameter of 0.5-3cm, is subspherical or irregularly spherical, is white in the young stage, and gradually turns grayish white with increasing maturity. When fully mature, it has a strong fragrance. The spores are gray-brown with white to grayish white veins. The size of the ascus is: 60-90×50-80µm, and the spore size is 25-42.5µm. Compared with black truffles, Lijiang White Truffles have a more delicate, dense and soft taste. The commodity value is 5-8 times that of black truffles, and it has great development and utilization prospects. However, at present, except for local farmers in Lijiang collecting wild Lijiang White Truffles for sale, there has been no development and research reports. Wild Lijiang White Truffles are scarce and the yield is extremely low, far from meeting people's needs.

[0005] Truffles are rich in nutrients, high in functional ingredients, strong in fragrance and high in value, so wild resources are often over-exploited, and wild truffle ponds are destroyed in large quantities, resulting in a decrease in production year by year. At present, there are two ways to increase truffle production and improve quality: 1. Wild truffle conservation and propagation technology. The necessary condition for this technology is to protect and improve the ecological conditions of the truffle ponds in the forest, so that the ponds can produce more truffles. However, this technology has little effect on forests with very few ponds, and it cannot be implemented at all for forests without ponds. 2. Truffle mycorrhizal seedling cultivation and planting technology. This technology requires the cultivation of sterile seedlings from tree seeds, and then inoculation of truffle spores to form mycorrhizal seedlings. After the cultivation is completed, the seedlings are planted and managed. After 5 to 8 years, the seedlings grow up, and the ponds are formed near the roots of the trees to naturally grow truffles. The whole process requires a long period of time and consumes a lot of manpower, material resources and time costs.

[0006] Therefore, how to overcome the shortcomings of existing technologies is an urgent problem to be solved in the field of biotechnology. Summary of the invention

[0007] The object of the present invention is to solve the deficiencies of the prior art and provide a method for inoculating large trees with Tuber yunnanense K. T. Chen var. lijiangense (Y. C. Liu, K. T. Chen & B. Liu) Wang & Zang

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] A method for inoculating large trees with Tuber yunnanense K. T. Chen var. lijiangense (Y. C. Liu, K. T. Chen & B. Liu) Wang & Zang comprises the following steps:

[0010] Step 1, requirements for the environment and inoculated trees:

[0011] The environmental requirements are as follows: sloping or flat forests at an altitude range of 1500 - 2800 m; average annual temperature of 13 - 20 °C, annual rainfall of 600 - 1800 mm, annual sunshine hours of 1600 - 3000 h; distinct dry and rainy seasons, daily temperature difference of 8 - 22 °C; soil types being red soil, brown soil or cinnamon soil, and the forest soil layer thickness > 40 cm;

[0012] The requirements for inoculated forest trees are as follows: adult Pinus yunnanensis forests, or mixed forests mainly composed of adult Pinus yunnanensis and mixed with one or more of Pinus armandii, Quercus aliena, Quercus franchetii, Castanea mollissima, Platycarya strobilacea, Corylus heterophylla, Populus yunnanensis and Cyclobalanopsis glaucoides, with forest canopy density of 6.5 - 7.5;

[0013] Step 2, selection of inoculation time:

[0014] Inoculate in March - April or June - July every year;

[0015] Before inoculating in March - April, it is necessary to sprinkle water to ensure that the surface soil with a depth of 3 - 5 cm is moist. After inoculation, water should be poured at a rate of 3 - 5 kg per 1 m 2 and water once every three days until the rain comes;

[0016] In June - July, inoculation should be carried out just after the rain falls or when the rain soaks the soil layer to a depth of 40 cm;

[0017] Step 3, preparations before inoculation:

[0018] Remove short shrubs and weeds in the forest land, and then shovel away the surface humus of the forest land; then shovel away the soil layer with a thickness of 2 - 4 cm under the humus; then loosen the soil layer with a thickness of 10 - 20 cm underground at this time to expose part of the epidermal roots of Pinus yunnanensis and other large trees; then sprinkle quicklime for disinfection; inoculate the next day after disinfection;

[0019] Step 4, strain production:

[0020] Use slaked lime to adjust the pH value of sterile water to between 7.5 and 8.0 as the solvent;

[0021] Select Tuber pseudoexcavatum fruit bodies with a diameter of more than 1 cm, free from insect damage, mildew, and with a maturity of 95% or more. Add 595 - 605 mL of solvent to every 99 - 101 g of fruit bodies, then put them into a blender and crush to make the original spore solution; store at 0°C - 4°C;

[0022] Before inoculation, dilute the original spore solution with the above-mentioned solvent to a spore solution with a volume concentration of 0.5% - 1.0%, then add slaked lime to adjust the pH to 7.0 - 7.5 for standby;

[0023] Step Five, inoculation on big trees:

[0024] On the forest land treated in Step Three, spray the forest land surface with the spore solution prepared in Step Four, spraying 500 - 600 kg of spore solution per mu; after spraying, first spread a layer of stone powder, spreading 3 - 5 kg of stone powder per square meter; then spread a layer of slaked lime, spreading 0.5 - 1.0 kg per square meter; then evenly backfill the soil shoveled in Step Three, and then evenly spread the humus shoveled in Step Three on it;

[0025] After inoculation, detect the content of soil exchangeable calcium Ca 2+ content and soil pH value. The content of soil exchangeable calcium Ca 2+ should reach 30 - 80 cmol / kg, and the soil pH value should be 7.5 - 8.5;

[0026] Step Six, management after inoculation:

[0027] After inoculation, animals and unauthorized personnel are prohibited from entering the inoculation area,

[0028] Check the formation of truffle mycorrhizae 6 months after inoculation; those without mycorrhizae formation need to be marked on the tree trunks for secondary supplementary inoculation in the coming year;

[0029] Every year in July - August after inoculation, conduct collective trapping and killing of ants and earwigs in the forest land;

[0030] Step Seven, truffle harvesting:

[0031] The harvesting time is from January to February in the third year after inoculation, and harvest when the maturity of truffles is 95% or more.

[0032] Furthermore, preferably, in Step One, the environmental requirement is that the landform is karst landform.

[0033] Furthermore, preferably, in Step One, in the inoculated forest, more than 60% of the trees are 10 - 35 years old, the tree diameter is 10 - 40 cm, and the tree spacing in both length and width is 2 - 5 meters.

[0034] Further, preferably, in step two, inoculation is carried out in June-July. If there is no rain for 20 consecutive days after inoculation, watering must be carried out by spraying method, and the watering amount is 3-5 kg per 1 m 2 , and watering is carried out once every three days.

[0035] Further, preferably, in step three, the forest floor humus is shoveled open and piled up in a heap every 5 m × 5 m; then the soil 2-4 cm thick under the humus is shoveled open and piled up in a heap every 3 m × 3 m.

[0036] Further, preferably, in step three, the amount of quicklime spread on every 667 m 2 of forest land is 200-300 kg.

[0037] Further, preferably, in step four, Tuber album K. M. Zhang fruiting bodies are obtained from the end of December to February of the following year. The soil and sundries on the surface of the Tuber album K. M. Zhang fruiting bodies are washed clean, and after being sealed and packaged, they are stored frozen in a refrigerator at -20 °C for later use; the fruiting bodies are taken out when preparing the spore solution;

[0038] When preparing the spore solution, the speed of the blender is 8000 rpm / min - 15000 rpm / min, and the crushing time is 15 s - 30 s.

[0039] Further, preferably, in step five, the thickness of the humus is 3.0-5.0 cm.

[0040] Further, preferably, in step six, the secondary supplementary inoculation method is to carry out secondary supplementary inoculation in March-April or May-June of the second year after inoculation; with the unmycorrhizal big tree as the center, the area with a radius of 1.0-1.5 m is the inoculation area. First, shovel open the backfilled humus, then shovel open the backfilled soil and the soil layer spread with slaked lime and stone powder, and then spray the spore solution at a rate of 0.85-0.90 kg / m 2 ; then backfill the soil layer spread with slaked lime and stone powder that has been shoveled open again, and then backfill the shoveled humus; after inoculation, watering must be carried out at a watering amount of 3-5 kg per 1 m 2 , and watering is carried out once every three days until the rain comes.

[0041] Further, preferably, in step seven, when harvesting, the raking depth shall not exceed 10 cm.

[0042] The technology of the present invention directly improves the soil through artificial intervention and carries out inoculation on large areas of big trees. The technology has high precision, high inoculation success rate, and the Tuber album K. M. Zhang fruiting bodies are formed in the year after inoculation, with quick results.

[0043] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0044] (1) The present invention provides a method for inoculating large trees with Tuber yunnanense var. lijiangense. This method involves inoculating Tuber yunnanense var. lijiangense across an entire forest, artificially improving the soil through methods such as covering with stone powder and lime, so that the pH value and exchangeable Ca content of the soil can meet the growth requirements of truffles. Therefore, the present invention does not require ensuring that there are a large number of truffle ponds in the inoculated forest land originally, that is, the method of the present invention can still be implemented even in the absence of truffle ponds; compared with the conservation and promotion techniques of truffles, the implementation scope of the method of the present invention is greatly increased; 2+ The content can meet the growth requirements of truffles. Therefore, the present invention does not require ensuring that there are a large number of truffle ponds in the inoculated forest land originally, that is, the method of the present invention can still be implemented even in the absence of truffle ponds; compared with the conservation and promotion techniques of truffles, the implementation scope of the method of the present invention is greatly increased;

[0045] (2) Compared with the truffle conservation and promotion techniques and mycorrhizal seedling cultivation and planting techniques, the present invention has a shorter cycle. A small amount of truffle fruiting bodies were found to form in the winter of the year when the large trees were inoculated, and the success rate of inoculating large trees was over 80%, with obvious effects;

[0046] (3) The present invention simultaneously implemented the large-tree inoculation technique for Tuber indicum, Tuber sinoaestivum, and Tuber yunnanense var. lijiangense. The inoculation success rates were 21% for Tuber indicum, 15% for Tuber sinoaestivum, and over 80% for Tuber yunnanense var. lijiangense. It was found that only Tuber yunnanense var. lijiangense showed excellent performance with the highest inoculation success rate, and the large-tree inoculation technique for Tuber yunnanense var. lijiangense is a pioneering technique and has not been reported so far.

[0047] Compared with the prior art, the method of the present invention is shown in Table 1 specifically.

[0048] Table 1

[0049] . BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 It is a forest map selected for the application example of the present invention;

[0051] Figure 2 It is a diagram of ascospores of Tuber yunnanense var. lijiangense; among them, (a) are mature spores observed under a 400-fold microscope; (b) are partially mature and partially immature spores observed under a 100-fold microscope;

[0052] Figure 3 It is the mycorrhizal morphology of Tuber yunnanense var. lijiangense observed visually;

[0053] Figure 4 It is the mycorrhizal morphology of Tuber yunnanense var. lijiangense observed with a 20-fold hand magnifier;

[0054] Figure 5 It is a diagram of a large number of hyphae observed under a microscope (400-fold) of a mycorrhizal section of Tuber yunnanense var. lijiangense;

[0055] Figure 6 It is a diagram of a fire circle formed under Pinus yunnanensis in the experimental plot; among them, the upper left part of the picture is the non-inoculated area with lush ground herbs, and the lower right part is the inoculated area where an entire fire circle has formed;

[0056] Figure 7 This is a figure showing a large number of young fruit bodies of truffles formed by inoculating forests selected in the application examples of the present invention. Detailed implementation manners

[0057] The present invention will be further described in detail below in conjunction with the embodiments.

[0058] Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the embodiments regarding specific technologies or conditions, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For those materials or equipment without indicating the manufacturer, they are all conventional products that can be obtained by purchase.

[0059] Embodiment 1

[0060] A method for inoculating large trees with Tuber panzhuanense, comprising the following steps:

[0061] Step 1, requirements for the environment and inoculated trees:

[0062] The environmental requirements are as follows: sloping or flat forests with an altitude range of 1500 - 2800 m; the annual average temperature is 13 - 20 °C, the annual rainfall is 600 - 1800 mm, and the annual sunshine hours are 1600 - 3000 h; the dry season and the rainy season are distinct, and the daily temperature difference is 8 - 22 °C; the soil type is red soil, brown soil or cinnamon soil, and the forest soil layer thickness > 40 cm;

[0063] The requirements for inoculated forest trees are as follows: adult Pinus yunnanensis forests, or mixed forests mainly composed of adult Pinus yunnanensis and mixed with one or more of Pinus armandii, Quercus aliena, Quercus franchetii, Castanea mollissima, Platycarya strobilacea, Corylus heterophylla, Populus yunnanensis and Cyclobalanopsis glaucoides, and the forest canopy density is 6.5 - 7.5;

[0064] Step 2, selection of inoculation time:

[0065] Inoculate in March - April or June - July every year;

[0066] Before inoculating in March - April, it is necessary to sprinkle water to ensure that the surface soil with a depth of 3.5 - 4.5 cm is moist. After inoculation, water should be poured according to the watering amount of 4 kg per 1 m 2 Once every three days until the rain comes;

[0067] In June - July, inoculation should be carried out just after the rain falls or when the rain has soaked the soil layer to a depth of 40 cm;

[0068] Step 3, preparations before inoculation:

[0069] Remove the low shrubs and weeds in the forest land, and then shovel the humus on the surface of the forest land; then shovel the soil 2.5 - 3.5 cm thick under the humus; then loosen the soil 13 - 18 cm thick underground at this time; then sprinkle quicklime for disinfection; inoculate on the second day after disinfection;

[0070] Step Four, spawn production:

[0071] Use slaked lime to adjust the pH value of sterile water to 7.7 as the solvent;

[0072] Select Tuber pseudoexcavatum fruit bodies with a diameter of more than 1 cm, no insect damage, no mildew, and a maturity of at least 95%. Add 600 mL of the solvent to every 100 g of fruit bodies, and then put them into a blender to be crushed to make the original spore solution; store at 0℃ - 4℃;

[0073] Before inoculation, dilute the original spore solution with the solvent to a spore solution with a volume concentration of 0.8%, and then add slaked lime to adjust the pH to 7.2 for use;

[0074] Step Five, inoculation of big trees:

[0075] On the forest land treated in Step Three, spray the forest land surface with the spore solution prepared in Step Four, spraying 550 kg of the spore solution per mu of land; after spraying, first sprinkle a layer of stone powder, 4 kg of stone powder per square meter; then sprinkle a layer of slaked lime, 0.6 kg per square meter; then evenly backfill the soil shoveled in Step Three, and then evenly spread the humus shoveled in Step Three on it;

[0076] After inoculation, detect the content of soil exchangeable calcium Ca 2+ content and soil pH value. The content of soil exchangeable calcium Ca 2+ should reach 30 - 80 cmol / kg, and the soil pH value should be 7.5 - 8.5;

[0077] Step Six, management after inoculation:

[0078] After inoculation, animals and unauthorized personnel are prohibited from entering the inoculation area,

[0079] Check the formation of truffle mycorrhizae 6 months after inoculation; for those without mycorrhizae formation, tree trunks need to be marked for secondary supplementary inoculation in the coming year;

[0080] Every year in July - August after inoculation, conduct a collective trapping and killing of ants and earwigs in the forest land;

[0081] Step Seven, truffle harvesting:

[0082] The harvesting time is from January to February in the third year after inoculation, and harvest when the maturity of truffles is at least 95%.

[0083] Example 2

[0084] A method for inoculating large trees with Tuber yunnanense Heim var. lijiangense, comprising the following steps:

[0085] Step 1, requirements for the environment and inoculated trees:

[0086] The environmental requirements are as follows: sloping or flat forests with an altitude range of 1500 - 2800 m; the annual average temperature is 13 - 20 °C, the annual rainfall is 600 - 1800 mm, and the annual sunshine hours are 1600 - 3000 h; the dry season and the rainy season are distinct, and the daily temperature difference is 8 - 22 °C; the soil type is red soil, brown soil or cinnamon soil, and the thickness of the forest soil layer > 40 cm;

[0087] The requirements for inoculated forest trees are as follows: adult Pinus yunnanensis forests, or mixed forests mainly composed of adult Pinus yunnanensis and mixed with one or more of Pinus armandii, Quercus aliena var. acuteserrata, Quercus franchetii, Castanea mollissima, Platycarya strobilacea, Corylus heterophylla, Populus yunnanensis and Cyclobalanopsis glaucoides, with a forest canopy density of 6.5 - 7.5;

[0088] Step 2, selection of inoculation time:

[0089] Inoculate in March - April or June - July every year;

[0090] Before inoculating in March - April, it is necessary to sprinkle water to ensure that the surface soil 3 - 4 cm deep is moist. After inoculation, water should be poured at a rate of 3 kg per 1 m 2 and water once every three days until the rain comes;

[0091] In June - July, inoculation should be carried out just after the rain falls or when the rain has penetrated the soil layer by 40 cm;

[0092] Step 3, preparations before inoculation:

[0093] Remove the short shrubs and weeds in the forest land, and then shovel away the surface humus of the forest land; then shovel away the soil 2 - 3 cm thick under the humus; then loosen the soil 10 - 15 cm thick underground at this time; then sprinkle quicklime for disinfection and sterilization; inoculate the next day after disinfection and sterilization;

[0094] Step 4, strain production:

[0095] Use slaked lime to adjust the pH value of sterile water to 7.5 as the solvent;

[0096] Select Tuber yunnanense Heim var. lijiangense fruit bodies with a diameter of more than 1 cm, free from insect damage, mildew, and a maturity of greater than or equal to 95%. Add 595 mL of the solvent to every 99 g of fruit bodies, and then put them into a blender for crushing to make the spore - seed stock solution; store at 0 °C - 4 °C;

[0097] Before inoculation, dilute the spore - seed stock solution with the above - mentioned solvent to a spore - seed solution with a volume concentration of 0.5%, and then add slaked lime to adjust the pH to 7.0 for standby;

[0098] Step 5, inoculation of big trees:

[0099] On the forest land treated in Step 3, spray the surface of the forest land with the spore solution obtained in Step 4 at a rate of 50 kg per mu; after spraying, first spread a layer of stone powder at a rate of 3 kg per square meter; then spread a layer of slaked lime at a rate of 0.5 kg per square meter; then evenly backfill the soil shoveled in Step 3, and then evenly spread the humus shoveled in Step 3 on it.

[0100] After inoculation, detect the content of soil exchangeable calcium Ca 2+ content and soil pH value. The content of soil exchangeable calcium Ca 2+ should reach 30 - 80 cmol / kg, and the soil pH value should be 7.5 - 8.5.

[0101] Step 6, management after inoculation:

[0102] After inoculation, animals and unauthorized personnel are prohibited from entering the inoculation area.

[0103] Check the formation of truffle mycorrhizae 6 months after inoculation; for those without mycorrhizae formation, tree trunks need to be marked for secondary supplementary inoculation in the coming year.

[0104] In July - August every year after inoculation, conduct a collective trapping and killing of ants and earwigs in the forest land.

[0105] Step 7, harvesting of truffles:

[0106] The harvesting time is from January to February in the third year after inoculation, and harvest when the maturity of truffles is greater than or equal to 95%.

[0107] In Step 1, the environmental requirement for the landform is karst landform.

[0108] In Step 1, in the inoculated forest, more than 60% of the trees are 10 - 20 years old, the tree diameter is 10 - 30 cm, and the tree spacing in both length and width is 2 - 4 meters.

[0109] In Step 2, inoculate in June - July. If it doesn't rain for 20 consecutive days after inoculation, water by spraying. The watering amount is 3 kg per 1 m 2 , and water once every three days.

[0110] In Step 3, shovel open the surface humus of the forest land and pile it up in a heap every 5 m × 5 m; then shovel open the soil 2 - 3 cm thick under the humus and pile it up in a heap every 3 m × 3 m.

[0111] In Step 3, the amount of quicklime spread on every 667 m 2 forest land is 200 kg.

[0112] In Step 4, collect the fruit bodies of Tuber yunnanense in late December to February of the following year. Wash the soil and debris on the surface of the fruit bodies, seal and package them, and store them frozen in a refrigerator at -20°C for later use. Take out the fruit bodies when preparing the spore solution.

[0113] When preparing the spore solution, the speed of the blender is 8000 rpm / min and the crushing time is 15 s.

[0114] In Step 5, the thickness of the humus is 3.0 - 4.0 cm.

[0115] In Step 6, the secondary supplementary inoculation method is to conduct secondary supplementary inoculation in March - April or May - June of the second year after inoculation; with the unmycorrhizal big tree as the center, an area with a radius of 1.0 - 1.2 m is the inoculation area. First, shovel away the backfilled humus, then shovel away the backfilled soil and the soil layer with slaked lime and stone powder sprinkled on it, and then spray the spore solution at a rate of 0.85 kg / m 2 Then backfill the soil layer with slaked lime and stone powder that has been shoveled away again, and then backfill the shoveled humus; after inoculation, water must be applied at a rate of 3 kg per 1 m 2 and water once every three days until the rain comes.

[0116] In Step 7, during harvesting, the depth of raking and digging shall not exceed 10 cm.

[0117] Example 3

[0118] A method for inoculating big trees with Tuber yunnanense includes the following steps:

[0119] Step 1, requirements for the environment and inoculated trees:

[0120] The environmental requirements are as follows: Sloping or flat forests with an altitude range of 1500 - 2800 m; the annual average temperature is 13 - 20°C, the annual rainfall is 600 - 1800 mm, the annual sunshine hours are 1600 - 3000 h; the dry season and the rainy season are distinct, and the daily temperature difference is 8 - 22°C; the soil type is red soil, brown soil or cinnamon soil, and the forest soil layer thickness > 40 cm;

[0121] The requirements for inoculated forest trees are as follows: Mature Pinus yunnanensis forests, or mixed forests mainly composed of mature Pinus yunnanensis and mixed with one or more of Pinus armandii, Quercus aliena, Quercus franchetii, Castanea mollissima, Platycarya strobilacea, Corylus heterophylla, Populus yunnanensis and Cyclobalanopsis glaucoides, with the forest canopy density of 6.5 - 7.5;

[0122] Step 2, selection of inoculation time:

[0123] Inoculate in March - April or June - July every year;

[0124] Before inoculating in March - April, sprinkle water to ensure that the surface soil with a depth of 4 - 5 cm is moist. After inoculation, water must be applied at a rate of 3 kg per 1 m 2The watering amount is 5 kg, and water is applied every three days until the rain comes.

[0125] In June and July, inoculation should be carried out just after the rain falls or when the rain has soaked the soil layer by 40 cm.

[0126] Step 3, Preparation before inoculation:

[0127] Remove the short shrubs and weeds in the forest land, and then shovel away the humus on the forest land surface; then shovel away the soil layer 3 - 4 cm thick under the humus; then loosen the soil layer 15 - 20 cm thick underground at this time; then sprinkle quicklime for disinfection; inoculation is carried out on the second day after disinfection.

[0128] Step 4, Strain production:

[0129] Use slaked lime to adjust the pH value of sterile water to 8.0 as the solvent.

[0130] Select Tuber pseudoexcavatum fruit bodies with a diameter of more than 1 cm, no insect damage, no mildew, and a maturity of more than or equal to 95%. Add 605 mL of the solvent to every 101 g of fruit bodies, and then put them into a blender for crushing to make the spore seed stock solution; store it at 0℃ - 4℃.

[0131] Before inoculation, dilute the spore seed stock solution with the solvent described above to a spore seed solution with a volume concentration of 1.0%, and then add slaked lime to adjust the pH to 7.5 for standby.

[0132] Step 5, Inoculation of big trees:

[0133] On the forest land treated in Step 3, spray the forest land surface with the spore seed solution prepared in Step 4, spraying 600 kg of the spore seed solution per mu of land; after spraying, first sprinkle a layer of stone powder, 5 kg of stone powder per square meter; then sprinkle a layer of slaked lime, 1.0 kg per square meter; then evenly backfill the soil shoveled in Step 3, and then evenly spread the humus shoveled in Step 3 on it.

[0134] After inoculation, detect the content of soil exchangeable calcium Ca 2+ and the soil pH value. The content of soil exchangeable calcium Ca 2+ should reach 30 - 80 cmol / kg, and the soil pH value should be 7.5 - 8.5.

[0135] Step 6, Management after inoculation:

[0136] After inoculation, animals and unauthorized personnel are prohibited from entering the inoculation area.

[0137] Check the formation of truffle mycorrhizae 6 months after inoculation; for those without mycorrhizae formation, tree trunks need to be marked for secondary supplementary inoculation in the coming year.

[0138] In July and August every year after inoculation, conduct collective trapping and killing of ants and earwigs in the forest land;

[0139] Step Seven, Tuber harvesting:

[0140] The harvesting time is from January to February in the third year after inoculation, and the harvesting is carried out when the maturity of the tuber is greater than or equal to 95%.

[0141] In Step One, the environmental requirement is that the landform is karst landform.

[0142] In Step One, in the inoculated forest, more than 60% of the trees are 15 - 35 years old, the tree diameter is 20 - 40 cm, and the tree spacing in both length and width is 3 - 5 meters.

[0143] In Step Two, inoculate in June and July. If it doesn't rain for 20 consecutive days after inoculation, it is necessary to water by spraying. The watering amount per 1m 2 is 5 kg, and water once every three days.

[0144] In Step Three, shovel open the surface humus in the forest land and pile it up in a heap every 5 meters × 5 meters; then shovel open the soil 3 - 4 cm thick under the humus and pile it up in a heap every 3 meters × 3 meters.

[0145] In Step Three, the amount of quicklime spread on every 667m 2 of forest land is 300 kg.

[0146] In Step Four, obtain the fruiting bodies of Tuber yunnanense in late December to February of the following year, wash the soil and sundries on the surface of the fruiting bodies of the tuber, seal and package them, and store them frozen in a -20°C refrigerator for later use; take out the fruiting bodies when preparing the spore solution;

[0147] When preparing the spore solution, the speed of the blender is 15000 rpm / min, and the pulverizing time is 30 s.

[0148] In Step Five, the thickness of the humus is 5.0 cm.

[0149] In Step Six, the secondary supplementary inoculation method is to conduct secondary supplementary inoculation in March - April or May - June of the second year after inoculation; with the non - mycorrhizal big tree as the center, the area with a radius of 1.2 - 1.5 m is the inoculation area. First, shovel open the backfilled humus, then shovel open the backfilled soil and the soil layer spread with slaked lime and stone powder, and then spray the spore solution at a rate of 0.90 kg / m 2 ; then backfill the shoveled soil and the soil layer spread with slaked lime and stone powder again, and then backfill the shoveled humus; after inoculation, it is necessary to water at a rate of 5 kg per 1m 2 and water once every three days until the rain comes.

[0150] In Step Seven, during harvesting, the raking depth shall not exceed 10 cm.

[0151] Example 4

[0152] A method for inoculating large trees with Tuber yunnanense in Lijiang, comprising the following steps:

[0153] Step 1, requirements for the environment and inoculated trees:

[0154] The environmental requirements are as follows: sloping or flat forests at an altitude range of 1500 - 2800 m; average annual temperature of 13 - 20 °C, annual rainfall of 600 - 1800 mm, annual sunshine hours of 1600 - 3000 h; distinct dry and rainy seasons, daily temperature difference of 8 - 22 °C; soil types being red soil, brown soil or cinnamon soil, and the forest soil layer thickness > 40 cm;

[0155] The requirements for inoculated forest trees are as follows: mature Pinus yunnanensis forests, or mixed forests mainly composed of mature Pinus yunnanensis and mixed with one or more of Pinus armandii, Quercus aliena, Quercus franchetii, Castanea mollissima, Platycarya strobilacea, Corylus heterophylla, Populus yunnanensis and Cyclobalanopsis glaucoides, with forest canopy density of 6.5 - 7.5;

[0156] Step 2, selection of inoculation time:

[0157] Inoculate in March - April or June - July every year;

[0158] Before inoculating in March - April, it is necessary to sprinkle water to ensure that the surface soil with a depth of 3 - 5 cm is moist. After inoculation, water should be poured according to a watering amount of 4 kg per 1 m 2 and water once every three days until the rain comes;

[0159] In June - July, inoculation should be carried out just after the rain falls or when the rain soaks the soil layer to a depth of 40 cm;

[0160] Step 3, preparations before inoculation:

[0161] Remove short shrubs and weeds in the forest land, and then shovel away the surface humus of the forest land; then shovel away the soil with a thickness of 2 - 4 cm under the humus; then loosen the soil with a thickness of 10 - 20 cm underground at this time; then sprinkle quicklime for disinfection and sterilization; inoculate the next day after disinfection and sterilization;

[0162] Step 4, strain production:

[0163] Use slaked lime to adjust the pH value of sterile water to 7.8 as the solvent;

[0164] Select Tuber yunnanense fruit bodies with a diameter of more than 1 cm, free from insect borers and mildew, and a maturity of greater than or equal to 95%. Add 600 mL of solvent to every 100 g of fruit bodies, and then put them into a blender for crushing to make the spore seed stock solution; store at 0 °C - 4 °C;

[0165] Before inoculation, dilute the spore solution with the solvent described above to a spore solution with a volume concentration of 0.8%, and then add slaked lime to adjust the pH to 7.2 for standby;

[0166] Step Five, inoculation of big trees:

[0167] On the forest land treated in Step Three, spray the forest land surface with the spore solution prepared in Step Four, spraying 550 kg of spore solution per mu of land; after spraying, first spread a layer of stone powder, spreading 4 kg of stone powder per square meter; then spread a layer of slaked lime, spreading 0.8 kg per square meter; then evenly backfill the soil shoveled in Step Three, and then evenly spread the humus shoveled in Step Three on it;

[0168] After inoculation is completed, detect the content of soil exchangeable calcium Ca 2+ and the soil pH value. The content of soil exchangeable calcium Ca 2+ should reach 30 - 80 cmol / kg, and the soil pH value should be 7.5 - 8.5;

[0169] Step Six, management after inoculation:

[0170] After inoculation, animals and unauthorized personnel are prohibited from entering the inoculation area,

[0171] Check the formation of truffle mycorrhizae 6 months after inoculation; for those without mycorrhizae formation, tree trunks need to be marked for secondary supplementary inoculation in the coming year;

[0172] In July - August every year after inoculation, conduct a collective trapping and killing of ants and earwigs in the forest land;

[0173] Step Seven, harvesting of truffles:

[0174] The harvesting time is from January to February in the third year after inoculation, and harvest when the maturity of truffles is greater than or equal to 95%.

[0175] In Step One, the environmental requirement is that the landform is karst landform.

[0176] In Step One, in the inoculated forest, more than 60% of the trees are 10 - 35 years old, the tree diameter is 10 - 40 cm, and the tree spacing in length and width is both 2 - 5 meters.

[0177] In Step Two, inoculate in June - July. If it doesn't rain for 20 consecutive days after inoculation, it is necessary to water by spraying, with the watering amount being 4 kg per 1 m 2 and watering once every three days.

[0178] In Step Three, shovel open the surface humus of the forest land and pile it up in a heap every 5 m × 5 m; then shovel open the soil 2 - 4 cm thick under the humus and pile it up in a heap every 3 m × 3 m.

[0179] In Step Three, every 667 m2 The amount of quicklime spread in the forest land is 250 kg.

[0180] In Step 4, the fruiting bodies of Tuber yunnanense are obtained from the end of December to February of the following year, the soil and sundries on the surface of the fruiting bodies are washed clean, and after being sealed and packaged, they are stored frozen in a refrigerator at -20°C for future use; the fruiting bodies are taken out when preparing the spore solution.

[0181] When preparing the spore solution, the speed of the blender is 10,000 rpm / min and the crushing time is 20 s.

[0182] In Step 5, the thickness of the humus is 3.0 - 5.0 cm.

[0183] In Step 6, the secondary supplementary inoculation method is to conduct secondary supplementary inoculation in March - April or May - June of the second year after inoculation; with the unmycorrhizal big tree as the center, the area with a radius of 1.1 - 1.4 m is the inoculation area. First, shovel away the backfilled humus, then shovel away the backfilled soil and the soil layer with slaked lime and stone powder spread, and then spray the spore solution at a rate of 0.88 kg / m 2 ; then backfill the shoveled soil and the soil layer with slaked lime and stone powder spread again, and then backfill the shoveled humus; after inoculation, the watering amount per 1 m 2 is 4 kg, and water is applied once every three days until the rain comes.

[0184] In Step 7, when harvesting, the depth of raking and digging shall not exceed 10 cm.

[0185] Application examples

[0186] I. Requirements for the environment and inoculated trees

[0187] Environmental requirements: Sloping or flat forests with an altitude range of 1500 - 2800 m. The annual average temperature is 13 - 20°C, the annual rainfall is 600 - 1800 mm, and the annual sunshine hours are 1600 - 3000 h. The dry season and the rainy season are distinct, and the daily temperature difference is 8 - 22°C. The karst landform area is the best, and the soil types are mainly red soil, brown soil or cinnamon soil formed by sandstone, basalt, limestone as the parent rock, the forest soil layer thickness > 40 cm, with loose structure and good permeability.

[0188] Requirements for inoculated forest trees: For standardized adult Pinus yunnanensis ( Pinus yunnanensis ) forests, or mainly Pinus yunnanensis, mixed with Pinus armandii ( Pinus armandii ) Quercus aliena ( Quercus aliena ) Quercus franchetii ( Quercus franchetii ) Castanea mollissima ( Castanea mollissima ) Platycarya strobilacea ( Platycarya strobilacea ) Corylus heterophylla ( Corylus heterophylla ) Populus yunnanensis ( Populus yunnanensis ) Cyclobalanopsis glaucoides ( Quercus glaucoides)A mixed forest of one or more of the above tree species. In the inoculated forest, more than 60% of the trees are 10 - 35 years old, with a tree diameter of 10 - 40 cm, and the tree spacing is 2 - 5 meters in both length and width. Preferably, the tree canopy density is 6.5 - 7.5 (see Figure 1 ).

[0189] II. Selection of inoculation time

[0190] In the Yunnan region, there are two optimal periods for inoculation.

[0191] Period 1: Inoculate from March to April every year. At this time, the plants and trees recover, new branches sprout, and fibrous roots grow. The mycorrhiza formation rate of the inoculation is relatively high. However, in the Yunnan region, March to April is a period of severe drought. To ensure the formation of mycorrhiza between the inoculated spore solution and the fibrous roots of the big trees, it is necessary to sprinkle water before inoculation to ensure that the surface soil 3 - 5 cm deep is moist. After inoculation, water should be poured at a rate of 3 - 5 kg per 1 m 2 and watered once every three days until the rain comes.

[0192] Period 2: Inoculate from June to July every year. Inoculate when the rain has just fallen in Yunnan or when the soil layer is soaked by rain to a depth of 40 cm. When the rain comes, everything is full of vitality, and the inoculation success rate is also relatively high at this time.

[0193] III. Preparation before inoculation

[0194] Use tools to remove short shrubs and weeds in the forest land, shovel away the surface humus of the forest land, and pile it up in a heap every 5 m × 5 m; then shovel away the soil 2 - 4 cm thick under the humus and pile it up in a heap every 3 m × 3 m; then use a soil loosening tool to fully loosen the soil 10 - 20 cm thick underground at this time, expose the epidermal roots of Pinus yunnanensis and other big trees, sprinkle quicklime for disinfection and sterilization, and sprinkle 2 200 - 300 kg of quicklime per 667 m 2+ to kill a large number of miscellaneous bacteria and insect eggs, and increase the content of exchangeable calcium Ca in the soil. Inoculation should be carried out in a timely manner the next day after the soil treatment. When all the preparatory operations are carried out, do not damage or break the big trees in the forest.

[0195] IV. Strain production

[0196] 1. Strain selection: The fruit bodies of Tuber pseudoexcavatum from Lijiang with a diameter of more than 1 cm, free from insect damage and mildew, and a maturity of greater than or equal to 95%. The maturity detection method is through microscopic observation, and the detection is carried out by calculating the number of ascospores of the mature truffle / the number of ascospores of the detected truffle × 100%. The mature and partially mature ascospores of Tuber pseudoexcavatum from Lijiang are shown in Figure 2 .

[0197] 2. Strain treatment: Collect or purchase the fruit bodies of Tuber pseudoexcavatum from Lijiang from the end of December to February of the following year, wash the soil and sundries on the surface of the fruit bodies, seal and package them with polyethylene plastic bags, and store them frozen in a -20°C refrigerator for later use.

[0198] 3. Preparation of spore solution: When in use, take out the fruiting body, adjust the pH value of sterile water to 7.5 - 8.0 with slaked lime as the solvent, add 600 mL of the solvent to every 100 g of the fruiting body, then put it into a blender and crush it at 8000 rpm / min - 15000 rpm / min for 15 s - 30 s to make the original spore solution. Put it into a sterilized bottle, seal it and store it at 0℃ - 4℃. Before inoculation, dilute the original spore solution with the above-prepared solvent to a spore solution with a volume concentration of 0.5% - 1.0% (there is 0.5 - 1 mL of the original spore solution in every 100 mL of the spore solution), and add slaked lime to adjust the pH to 7.0 - 7.5 for standby.

[0199] V. Inoculation of big trees

[0200] On the treated inoculation forest land, after filling a watering can with the spore solution, spray the spore solution on the surface of all the cleared forest land, directly spraying it onto the exposed surface roots or soil of the big trees until the soil is slightly wet, and spray 500 - 600 kg of the spore solution per mu of land. After spraying, first spread a layer of stone powder (powder made by crushing stones, and the invention does not limit the mesh number of the powder as long as it is in powder form), spread 3 - 5 kg per square meter, then spread a layer of slaked lime, spread 0.5 - 1.0 kg per square meter, evenly backfill the previously shoveled soil, and then evenly spread the shoveled humus on it, with the thickness of the humus being 3.0 - 5.0 cm;

[0201] After inoculation, the soil exchangeable calcium Ca 2+ content and the soil pH value should be detected. The soil exchangeable calcium Ca 2+ content should reach 30 - 80 cmol / kg, and the soil pH value should be preferably 7.5 - 8.5, and the maximum can reach 9.5. If the inspection fails, if the exchangeable calcium Ca 2+ content fails to meet the standard, stone powder should be spread on the soil surface. If the pH value fails to meet the standard, slaked lime should be spread on the soil surface until the requirements are met.

[0202] VI. Management after inoculation

[0203] 1. Set up a simple enclosure facility to enclose the inoculation area, prohibit livestock and unauthorized personnel from entering the inoculation area, and no grazing or taking humus soil is allowed.

[0204] 2. If the inoculation time is from March to April and it does not rain after inoculation, water it by spraying 3 days after inoculation, with the watering amount being 3 - 5 kg per 1 m 2 , and spray water once every three days until the rain comes. For forest land without watering conditions, try to choose to inoculate from June to July. If it does not rain continuously for 20 days after inoculation, it is necessary to water by spraying to ensure the success of inoculation, with the watering amount being 3 - 5 kg per 1 m 2 , and water once every three days.

[0205] 3. Check the formation of truffle mycorrhiza 6 months after inoculation. Dig open the surface soil at a distance of 10 - 30 cm from the trunk of the big tree to find the fibrous roots of the big tree. First, observe the roots of the tree visually. A bunch of grape-like protrusions can be seen at the fibrous root part (see Figure 3 ). When there is mycorrhiza, observe the mycorrhiza morphology with a hand-held magnifying glass with a magnification of 20 times or more (see Figure 4 ). Then take a mycorrhiza section for microscopic detection. The microscopic structure should show a large number of truffle hyphae and have the typical characteristics of truffle mycorrhiza, such as a mosaic or square structure (see Figure 5 ). For those without mycorrhiza formation, mark the tree trunk and conduct secondary supplementary inoculation in the following year;

[0206] 4. The method of secondary supplementary inoculation is carried out in March - April or May - June of the second year after inoculation. Taking the big tree without mycorrhiza formation as the center, an area with a radius of 1.0 - 1.5 m is the inoculation area. First, shovel away the surface humus, then shovel away the epidermal soil and the soil layer with slaked lime and stone powder sprinkled, and then spray the spore solution at a rate of 0.85 - 0.90 kg / m 2 . Then backfill the shoveled soil and the soil layer with slaked lime and stone powder sprinkled again, and then backfill the shoveled humus. After inoculation, the watering amount should be 3 - 5 kg per 1 m 2 , and water once every three days until the rain comes.

[0207] 5. Conduct collective trapping and killing of ants and earwigs in the forest land every July - August after inoculation; for example, mix trichlorfon into the fried bran (use it after stacking and stewing for 12 hours) to make poisonous bait to kill earwigs, and drop trichlorfon into honey or sugar water to make poisonous bait to kill ants, so as to prevent pests from gnawing on the tender fruiting bodies of truffles and causing losses.

[0208] VII. Truffle Harvest

[0209] Harvest time: Harvest in January - February of the third year after inoculation. Wait until the maturity of the truffle is greater than or equal to 95% and the fragrance is strong before harvesting. A well-trained truffle dog can be used to assist in the harvest. When using a tooth rake for harvesting, the digging depth shall not exceed 10 cm to avoid damaging a large number of mycorrhizas.

[0210] On March 12, 2023, the inoculation of Lijiang white truffle trees was carried out at the truffle conservation base at an altitude of 2,300m in Yongsheng County, Lijiang City, Yunnan Province. The inoculation standard is 7 acres of Yunnan pine forest, with 55-65 Yunnan pine trees per acre of forest. On September 15, the mycorrhizal formation was checked, and it was found that 50%-52% of the trees had formed truffle mycorrhiza. On September 16, 2023, 15 large trees with formed mycorrhiza in the forest were investigated, and young truffle fruiting bodies were found in the soil at the roots of 5 large trees. Molecular testing was performed on the fruiting bodies. In January 2024, mature truffle fruiting bodies were found under 10%-15% of the large trees. They were not harvested and kept in the original place.

[0211] On March 16, 2024, the remaining large trees that had not formed mycorrhizae were inoculated for the second time. On August 17, 2024, it was found that the inoculated forest had formed a large area of burnt circles (see Figure 6 ), the burn circle is the area of the forest where the fruiting bodies of truffles grow and develop, which is formed by the intersection of truffle hyphae, mycorrhiza, soil, organic matter, minerals, etc. The mushroom pond can inhibit the growth of surface herbs and even kill them, eventually forming an area similar to a burnt area, called a "burn circle". Figure 6 In the middle, the upper left part of the picture is the uninoculated area with lush herbaceous plants on the surface, and the lower right part is the inoculated area, forming a whole burn circle.

[0212] The mycorrhizal formation of all the trees was re-examined and it was found that 90%-95% of the trees had formed mycorrhizae. A survey of 15 large trees with mycorrhizal formation in the forest was conducted and young truffle fruiting bodies were found in the soil at the roots of 13 large trees (see Figure 7 ), and molecular detection of the fruiting bodies.

[0213] Detection method: Cut an appropriate amount of young truffle fruiting bodies, grind them with liquid nitrogen (or grinder), and use a plant genomic DNA extraction kit (Shanghai Shenggong Biotechnology Co., Ltd.) to extract total DNA according to the steps in the kit manual. Use RNA polymerase chain reaction (PCR) technology to select ITS gene fragments for amplification:

[0214] Fungal universal primers ITS4: 5'-tcctccgcttattgatatgc-3' (SEQ ID NO. 1), ITS5: 5'-ggaagtaaaagtcgtaacaagg-3' (SEQ ID NO. 2), PCR amplification of ITS fragments;

[0215] 25 μL PCR reaction system includes: 2×PCRmix 12.5 μL, 10 μmol·L -1 1 μL each of forward and reverse primers, 1 μL DNA template, and 9.5 μL ddH2O.

[0216] The PCR reaction conditions were as follows: pre-denaturation at 94 °C for 5 min, then denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, extension at 72 °C for 1 min, for 35 cycles; finally, extension at 72 °C for 7 min. The amplified products were stored at 4 °C after completion.

[0217] Precisely weigh 1 g of agarose using an electronic balance and dissolve it in 100 mL of 0.5×TBE buffer (Tris-borate-EDTA). Place it in a microwave oven and heat it on medium heat for 2.0 min until it becomes clear and transparent. When the temperature reaches 65 °C, add 1 μL of nucleic acid dye, shake well, pour it into a silica gel plate, let it cool for standby. Put it into the electrophoresis tank and use a pipette for sample loading. The sample loading volume is 5 μL. During electrophoresis, the voltage is 160 V, the current is 90 A, and the time is 15 min. After electrophoresis in 1.0×TBE buffer, observe, take pictures and record the results under an ultraviolet gel imager, detect the concentration of the extracted DNA, and send the positive products to Sangon Biotech in Shanghai for sequencing.

[0218] After sequencing the amplified fragments, the sequences were blasted and aligned in GeneBank to confirm that the detected truffle fruiting body was Tuber niveum from Lijiang.

[0219] The detected ITS sequence is: aaaacacatccatgagtaccctcccatgttgcttccccagaccagtggccactgctgccagctctgtcctctaatacaggatcgtgggttgaggtgtctggggaagggccaactgtcaaaacttttgaaccaatttgttgtctgagaaggccatatgccgcaatatttaaaaacatgttaaaactttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccctttggcattccttagggcatgcctgttcgagcgtcactaaaaaccccctcacagataatgtggtattggtagaagtgggtagtactaacagtgctttgtcccactctaccaaaattaataggccagaaaagtgaacttgggtaacagactctcagagtgttttaaaatgctaaactagtcttatccaggttggaatctgagccactggacccccttttagtccaaaacagagaggttgacctcggatcaggtagggatacccgctgaacttaagatta (SEQ ID NO.3)

[0220] The present invention simultaneously implemented the big tree inoculation technique for Tuber indicum, Tuber sinoaestivum, and Tuber leucanthum (using the method of the present invention, the only difference being the type of truffle). The inoculation success rate for Tuber indicum was 21%, for Tuber sinoaestivum was 15%, and for Tuber leucanthum was greater than 80%. It was found that only Tuber leucanthum showed excellent performance with the highest inoculation success rate, and the big tree inoculation technique for Tuber leucanthum was a pioneering technique, and no relevant reports have been seen so far.

[0221] Comparative experiment 1

[0222] This experiment was a comparative experiment on inoculation time and watering requirements; the only differences were the inoculation time, watering frequency, and watering amount, and the others were the same as the method of the present invention.

[0223] For each test setup, 20 Chinese pine trees were inoculated. The test site was in Yongsheng County, Lijiang City, Yunnan Province. The experimental results are shown in Table 2. As can be seen from Table 2, the inoculation effect is better in spring. Watering should be done in small amounts but frequently, and a large amount of watering is not conducive to the formation of mycorrhiza. However, for forest land without watering conditions, it is best to choose the rainy season for inoculation, and the watering requirements for forest land inoculated in the rainy season are not strict.

[0224] Table 2

[0225]

[0226] Comparative Test 2

[0227] This test is a comparative test of soil treatment. The only difference lies in the dosages of quicklime, stone powder, and slaked lime, and the others are the same as the method of the present invention.

[0228] For each test setup, 20 Chinese pine trees were inoculated. The test site was in Yongsheng County, Lijiang City, Yunnan Province. The inoculation time was March 15, 2023, and the watering measure was to water once every 3 days, with a watering volume of 3 - 5 kg per 1 m 2 The results are shown in Table 3. The experimental results show that the effect of experimental group E is the best.

[0229] Table 3

[0230]

[0231] Comparative Test 3

[0232] This test is a comparative test of the dosage of inoculation spore solution. The only difference lies in the different dosages of inoculation spore solution, and the others are the same as the method of the present invention.

[0233] For each test setup, 20 Chinese pine trees were inoculated. The test site was in Yongsheng County, Lijiang City, Yunnan Province. The results are shown in Table 4. The experimental results show that when the inoculation spore solution is 500 - 600 kg per mu, the best effect has been achieved. Increasing the dosage of inoculation spore solution not only increases the cost but also does not achieve a better effect.

[0234] Table 4

[0235]

[0236] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for inoculating truffles in large trees in Lijiang, characterized in that, It includes the following steps: Step 1, Requirements for the environment and inoculated trees: The environmental requirements are as follows: Sloping or flat forests at an altitude range of 1500 - 2800m; annual average temperature of 13 - 20°C, annual rainfall of 600 - 1800mm, annual sunshine hours of 1600 - 3000h; distinct dry and rainy seasons, daily temperature difference of 8 - 22°C; soil types are red soil, brown soil or cinnamon soil, and the forest soil layer thickness > 40cm; Requirements for inoculated forest trees: Adult Pinus yunnanensis forests, or mixed forests mainly composed of adult Pinus yunnanensis and one or more of Pinus armandii, Quercus aliena var. acuteserrata, Quercus franchetii, Castanea mollissima, Platycarya strobilacea, Corylus heterophylla, Populus yunnanensis and Cyclobalanopsis glaucoides, with forest canopy density of 6.5 - 7.5; Step 2, Selection of inoculation time: Inoculate from March to April or from June to July every year; Before inoculation in March and April, water must be sprinkled to ensure that the surface soil 3-5 cm deep is moist. After inoculation, the watering amount should be 3-5 kg per 1 m 2 and water once every three days until the rain comes; When inoculating from June to July, it should be carried out just after the rain has fallen or when the rain has soaked the soil layer to a depth of 40cm; Step 3, Preparation before inoculation: Remove short shrubs and weeds in the forest land, and then shovel away the surface humus of the forest land; then shovel away the soil layer 2 - 4cm thick under the humus; then loosen the soil layer 10 - 20cm thick underground at this time; then sprinkle quicklime for disinfection; inoculate the next day after disinfection; Step 4, Strain production: Use slaked lime to adjust the pH value of sterile water to between 7.5 and 8.0 as the solvent; Select Tuber pseudoexcavatum fruit bodies with a diameter of more than 1cm, free from insect borers and mildew, and a maturity of greater than or equal to 95%. Add 595 - 605mL of solvent to every 99 - 101g of fruit bodies, and then put them into a blender for crushing to make the spore seed stock solution; store at 0°C - 4°C; Before inoculation, dilute the spore seed stock solution with the above - mentioned solvent to a spore seed solution with a volume concentration of 0.5% - 1.0%, and then add slaked lime to adjust the pH to 7.0 - 7.5 for use; Step 5, Inoculation of big trees: On the forest land treated in Step 3, spray the spore seed solution prepared in Step 4 on the surface of the forest land, spraying 500 - 600kg of spore seed solution per mu; after spraying, first sprinkle a layer of stone powder, sprinkling 3 - 5kg of stone powder per square meter; then sprinkle a layer of slaked lime, sprinkling 0.5 - 1.0kg per square meter; then evenly backfill the soil shoveled in Step 3, and then evenly spread the humus shoveled in Step 3 on it; After inoculation, detect the soil exchangeable calcium Ca 2+ content and soil pH value. The soil exchangeable calcium Ca 2+ content should reach 30 - 80 cmol / kg, and the soil pH value should be 7.5 - 8.5; Step 6, Management after inoculation: After inoculation, animals and unauthorized personnel are prohibited from entering the inoculation area, Check the formation of truffle mycorrhizae 6 months after inoculation; those without mycorrhizae formation need to be marked on the tree trunks for secondary supplementary inoculation in the coming year; Every year from July to August after inoculation, conduct collective trapping and killing of ants and earwigs in the forest land; Step 7, Truffle harvesting: The harvesting time is from January to February in the third year after inoculation, and harvest when the truffle maturity is greater than or equal to 95%; In Step 6, the method of secondary supplementary inoculation is to conduct secondary supplementary inoculation from March to April or from May to June in the second year after inoculation; Taking the non-mycorrhizal big tree as the center, the area with a radius of 1.0 - 1.5 m is the inoculation area. First, shovel away the backfilled humus, then shovel away the backfilled soil and the soil layer with slaked lime and stone powder sprinkled on it, and then spray the spore solution in an amount of 0.85 - 0.90 kg / m 2 ; then backfill the soil layer with slaked lime and stone powder shoveled away again, and then backfill the shoveled humus; after inoculation, the watering amount per 1 m 2 should be 3 - 5 kg, and water once every three days until the rain comes; In Step 7, when harvesting, the raking depth shall not exceed 10cm.

2. The method for inoculating big trees with Tuber yunnanense as claimed in claim 1, wherein, In Step 1, the environmental requirement for the landform is karst landform.

3. The method for inoculating big trees with Tuber sichuanense as claimed in claim 1, wherein In Step 1, in the inoculated forest, more than 60% of the trees are 10 - 35 years old, with a tree diameter of 10 - 40cm, and the tree spacing in both length and width is 2 - 5 meters.

4. The method for inoculating big trees with Tuber himalayense Heim. var. luridum (Cooke) R. H. Petersen in Lijiang according to claim 1, wherein, In step 2, inoculate in June and July. If there is no rain for 20 consecutive days after inoculation, water by spraying. The watering volume is 3-5 kg per 1 m 2 and water once every three days.

5. The method for inoculating big trees with Tuber sichuanense as claimed in claim 1, wherein, In Step 3, the forest floor humus is shoveled open and piled up in heaps every 5 m × 5 m; then, the soil with a thickness of 2 - 4 cm below the humus is shoveled open and piled up in heaps every 3 m × 3 m.

6. The method for inoculating big trees with Tuber sichuanense as claimed in claim 1, wherein In Step 3, the amount of quicklime applied to every 667 m 2 of forest land is 200 - 300 kg.

7. The method for inoculating big trees with Tuber yunnanense as claimed in claim 1, characterized in that, In Step 4, the fruiting bodies of Tuber yunnanense are obtained from the end of December to February of the following year. The soil and sundries on the surface of the fruiting bodies are washed away, and after being sealed and packaged, they are stored frozen in a refrigerator at -20°C for future use; the fruiting bodies are taken out when preparing the spore solution. When preparing the spore solution, the speed of the blender is 8000 rpm / min - 15000 rpm / min, and the crushing time is 15 s - 30 s.

8. The method for inoculating big trees with Tuber yunnanense as claimed in claim 1, wherein, In Step 5, the thickness of the humus is 3.0 - 5.0 cm.

Citation Information

Patent Citations

  • Truffle lagoon recovery and tree inoculation method

    CN108713448A

  • Mycorrhiza cultivation method for inoculating big pecan tree seedlings by using truffles

    CN108990707A