Cultivation method of Russula griseocarpa mycorrhizal purified seedlings

Abstract

The invention provides a cultivation method of purified mycorrhizal seedlings of russula griseocarnosa, and belongs to the technical field of edible fungus cultivation, the cultivation method comprises the following steps: 1) collecting active mycorrhiza of russula griseocarnosa; 2) attaching the active mycorrhiza to the surface of a sterile host seedling root system, and culturing to obtain a stable mycorrhiza seedling; (3) screening specific mycorrhiza of russula griseocarnosa from the stable mycorrhiza seedlings; and 4) inoculating the specific mycorrhiza of the russula griseocarnosa with a sterile host seedling, and culturing to obtain a purified mycorrhiza seedling of the russula griseocarnosa. According to the culture method, a hypha purification culture link which must be carried out in a traditional method is omitted, the whole process is remarkably simplified, the production period is shortened, the mycorrhiza forming efficiency is stably improved, and the industrial application obstacle caused by inseparable pure culture of the mycorrhizal edible fungi is effectively broken through.

Description

Technical Field

[0001] The invention belongs to the technical field of edible fungus cultivation, and in particular relates to a method for cultivating purified mycorrhizal seedlings of Russula grisea. Background Art

[0002] Mycorrhizae are mutually beneficial symbiotic systems formed through long-term co-evolution between plant roots and soil fungi. Ectomycorrhizae, as one of the most common types of symbiosis, significantly enhance the host's ability to absorb water and mineral elements by establishing a "plant-fungus" metabolic network, while simultaneously improving stress resistance and soil microenvironment. Highly economically valuable mycorrhizal edible fungi (such as *Tuber spp.*, *Boletus*, *Tricholoma*, and *Russula*) rely on this symbiotic relationship to complete their life cycle. Their fruiting bodies not only have edible and medicinal value but also play a vital role in maintaining the balance of forest ecosystems. Mycorrhizal edible fungi, represented by *Tricholoma matsutake*, *Tuber melanosporum*, and *Russula griseocarnosa*, require mycorrhizal seedling cultivation as a core technical step in their commercial cultivation due to their unique symbiotic dependence.

[0003] Currently, mycorrhizal seedling cultivation is mainly achieved through two methods: spore infection or mycelial inoculation. Although some species, such as *Lactarius deliciosus*, have achieved mycelial purification and commercialization, precious species such as *Russula* (including *Russula griseocarnosa* and *Russula alutacea*) and *Chroogomphus rutilus* still face significant technical bottlenecks: First, mycelial isolation and purification technology has not yet been mastered, making it difficult to obtain sterile cultures; second, the mycorrhizal synthesis process lacks a standardized control system, resulting in insufficient survival rate and symbiotic stability of mycorrhizal seedlings; third, different species exhibit significant differences in host specificity and environmental adaptability, making it difficult for existing technologies to meet the targeted needs of specific stress improvement. In particular, for *Russula* species, the inability to achieve mycelial purification and the traditional spore inoculation method suffer from low infection efficiency and long symbiotic establishment cycles, severely restricting the large-scale cultivation of mycorrhizal seedlings and subsequent fruiting body production.

[0004] Existing research indicates that the quality of mycorrhizal seedlings directly affects the colonization efficiency and fruiting body yield of ectomycorrhizal fungi. Therefore, developing a mycorrhizal purification technology system for Russula species and establishing an efficient and controllable mycorrhizal synthesis method have become key issues in overcoming the bottlenecks in the artificial cultivation of this type of rare edible fungus, and are of significant practical importance for improving the composite benefits of economic forests and promoting the sustainable use of forest resources. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a method for cultivating purified mycorrhizal seedlings of Russula gray-fleshed mushrooms, overcoming the technical bottleneck of the difficulty in in vitro culture of Russula mycelium. The cultivation method of this invention omits the mycelial purification and culture step required in traditional methods, significantly simplifying the overall process, shortening the production cycle, and steadily improving mycorrhizal formation efficiency, effectively overcoming the obstacles to industrial application caused by the unculturability of fungi.

[0006] This invention provides a method for cultivating purified mycorrhizal seedlings of *Russula greifolia*, comprising the following steps:

[0007] 1) Collect active mycorrhizae of Russula grisea;

[0008] 2) After attaching the active mycorrhizae to the root surface of sterile host seedlings, stable mycorrhizal seedlings are obtained by culturing.

[0009] 3) Screening for specific mycorrhizae of *Russula gracilis* from the stable mycorrhizal seedlings;

[0010] 4) inoculating sterile host seedlings with the specific mycorrhiza of Russula grisea, culturing, and obtaining mycorrhizal purified seedlings;

[0011] Step 3) The screening is performed by PCR amplification combined with morphological observation; the PCR amplification is performed using primers specific for Russula grisea.

[0012] Preferably, the Russula grisea-specific primers include Rg_F and Rg_R; the nucleotide sequence of Rg_F is shown in SEQ ID NO.1, and the nucleotide sequence of Rg_R is shown in SEQ ID NO.2.

[0013] Preferably, after obtaining the mycorrhizal purified seedlings in step 4), the method further includes a propagation step: co-culturing the mycorrhizal purified seedlings with sterile host seedlings.

[0014] Preferably, the ratio of the number of the purified mycorrhizal seedlings to the sterile host seedlings is 1:(5-20).

[0015] Preferably, the substrate for co-cultivation includes akadama soil, pumice, and forest topsoil, with a volume ratio of (1.5~2.5):1:1. During the co-cultivation period, the moisture content of the substrate is maintained at 60%~70%.

[0016] Preferably, the Akadama has a particle size of 1.5-3 mm and a pH value of 5.5-6.0; the pumice is a porous volcanic rock, and the particle size of the pumice is 3-5 mm.

[0017] Preferably, the host is Castanopsis fargesii, Castanopsis rubrum, Castanopsis fargesii, Castanopsis spp., Castanopsis fargesii, Castanopsis spp., Castanopsis fargesii, Ligustrum lucidum, and Quercus glauca.

[0018] Preferably, the cultivation conditions in step 2) are as follows: 23-25℃, 16h light exposure, light intensity of 6000-8000lx; 20-25℃ darkness for 8h; the cultivation time is 80-100 days.

[0019] Compared with the prior art, the present invention has the following beneficial effects: the method for cultivating purified mycorrhizal seedlings of Russula grisea provided by the present invention, by attaching active mycorrhizae to the root surface of sterile host seedlings and then culturing, using Russula grisea-specific primers to identify and screen Russula grisea-specific mycorrhizae, excluding non-Russula grisea mycorrhizae, and then inoculating sterile host seedlings and co-culturing in a specific matrix, significantly shortens the production cycle and stably improves the mycorrhizal formation efficiency.

[0020] The method for cultivating purified mycorrhizal seedlings of Russula scabra provided by the present invention overcomes the technical drawbacks of Russula fungi, which cannot achieve mycelial purification and culture, and can only be cultured using traditional spore inoculation methods, resulting in low infection efficiency and a long symbiotic establishment period. The method successfully obtains Russula scabra-specific mycorrhizal seedlings by inoculating sterile host seedlings with active mycorrhizae and culturing them in a specific matrix and under specific culture conditions, with a probability of obtaining Russula scabra-specific mycorrhizal seedlings reaching 70% to 100%. The Russula scabra-specific mycorrhizal seedlings are then co-cultured with the sterile host seedlings for infection, achieving a 100% infection success rate. Attached Figure Description

[0021] Figure 1 The fruiting body of *Pleurotus eryngii* var. *shunchangensis*;

[0022] Figure 2 The mycorrhizal cells of *Russula grayi* found in the wild in Shunchang;

[0023] Figure 3 Photo of inoculating *Russula ovata* seedlings with *Russula ovata* mycorrhizal fungi;

[0024] Figure 4 This is a morphological photo of the Russula mycorrhiza formed on Castanopsis carlesii seedlings 3 months after inoculation with Russula grisea.

[0025] Figure 5 Photo 1 of the propagation and transplantation of the mycorrhizal seedlings of Russula grisea;

[0026] Figure 6 Photo 2 shows the propagation and transplanting of *Russula gracilis* mycorrhizal seedlings. DETAILED DESCRIPTION

[0027] This invention provides a method for cultivating purified mycorrhizal seedlings of Russula grayi, comprising the following steps: 1) collecting active mycorrhizae of Russula grayi; 2) attaching the active mycorrhizae to the root surface of sterile host seedlings and culturing to obtain stable mycorrhizal seedlings; 3) screening Russula grayi-specific mycorrhizae from the stable mycorrhizal seedlings; 4) inoculating the Russula grayi-specific mycorrhizae into sterile host seedlings to obtain purified mycorrhizal seedlings.

[0028] In this invention, active mycorrhizae of *Russula purpurea* are collected; preferably, healthy and mature *Russula purpurea* mycorrhizae are collected from the soil of *Russula purpurea* growing areas in the wild, after removing contaminating fungi, transported at a low temperature of 4°C, and active mycorrhizae with plump appearance, milky white color, moist surface and slight luster, and coral-like branching structure are selected under a stereomicroscope (e.g., *Russula purpurea*). Figure 2 ).

[0029] This invention involves attaching the active mycorrhizae to the root surface of sterile host seedlings to obtain stable mycorrhizal seedlings. In this invention, the host is preferably *Castanopsis fargesii*, *Castanopsis sanguinalis*, *Castanopsis spp.*, *Castanopsis spp.*, *Castanopsis chinensis*, *Castanopsis fargesii*, *Lithocarpus spp.*, or *Quercus glauca*. The cultivation of the host seedlings preferably includes the following steps: S1) preparation and sterilization of the host substrate; S2) disinfection of the host seeds; S3) sowing of the host seeds and seedling management.

[0030] In this invention, the host substrate preferably comprises akadama soil, pumice, and forest topsoil, with a preferred volume ratio of (1.5~2.5):1:1, more preferably (1.8~2.2):1:1. The akadama soil is preferably granular soil formed by high-temperature calcination; the particle size of the akadama soil is preferably 1.5~3 mm, and the pH value of the akadama soil is preferably 5.5~6.0. The pumice is porous volcanic rock, with a preferred particle size of 3~5 mm. The forest topsoil is preferably collected from the natural distribution area of ​​*Russula ovata*, after removing humus and passing through a 1 cm sieve, collecting the undersized components. In this invention, the akadama soil, pumice, and forest topsoil are mixed and sterilized to obtain the host substrate; the sterilization temperature is preferably 121°C, and the sterilization time is preferably 2~4 hours.

[0031] In this invention, the disinfection of the host seed preferably includes the following steps: soaking in pasteurized disinfectant, rinsing with sterile water, and soaking in sterile water; the soaking time in pasteurized disinfectant is preferably 30-45 min, and the soaking time in sterile water is preferably 20-28 h, more preferably 22-26 h, and even more preferably 24 h.

[0032] This invention involves evenly sowing sterilized seeds in seedling trays filled with sterilized substrate, spraying water to keep the substrate moist, and then culturing them in a greenhouse or constant-temperature incubator. When the taproot of the seed reaches 3-5 cm in length, about 1 / 3 of the top of the taproot is cut off using sterilized scissors, and the seedling is then transplanted to a new seedling tray for further cultivation for 30-60 days until well-developed lateral roots are formed. Before inoculation, the seedlings are transplanted to a sterile container until new roots grow, facilitating subsequent mycorrhizal inoculation. During the cultivation period, the substrate moisture content is checked regularly; if it dries out, it is thoroughly watered with sterile water or tap water.

[0033] This invention involves obtaining the root system of a host seedling, attaching the active mycorrhizae to the surface of the sterile host seedling root system, and then culturing to obtain stable mycorrhizal seedlings. The culturing conditions in this invention are as follows: 23–25°C, 16 hours of light exposure at a light intensity of 6000–8000 lx; ​​8 hours of darkness at 20–25°C; and a culturing time of 80–100 days.

[0034] This invention screens specific mycorrhizae of *Russula greifolia* from stable mycorrhizal seedlings. The screening is preferably performed using PCR amplification combined with morphological observation. The PCR amplification uses *Russula greifolia*-specific primers. In this invention, stable mycorrhizal seedlings are sampled, DNA is extracted, and then PCR amplification is performed using the *Russula greifolia*-specific primers. *Russula greifolia*-specific mycorrhizae are determined and screened based on the amplification results. In this invention, the *Russula greifolia*-specific primers include Rg_F and Rg_R; the nucleotide sequence of Rg_F is shown in SEQ ID NO.1, and the nucleotide sequence of Rg_R is shown in SEQ ID NO.2. In this invention, the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, repeated 35 times; 72℃ extension for 5 min. The PCR amplification system is as described in the kit instructions.

[0035] In this invention, the specific mycorrhizae of *Russula greifolia* are inoculated into sterile host seedlings and cultured to obtain purified mycorrhizal seedlings. In this invention, the culture conditions are the same as those for the culture of stable mycorrhizal seedlings described above, and will not be repeated here.

[0036] After obtaining purified mycorrhizal seedlings, this invention further includes a propagation step: co-culturing the purified mycorrhizal seedlings with sterile host seedlings. In this invention, the ratio of the number of purified mycorrhizal seedlings to sterile host seedlings is 1:(5~20), preferably 1:(8~15), and more preferably 1:10. In this invention, the co-culturing substrate is the same as the host substrate, and will not be described again here. During the co-culturing period, the moisture content of the substrate is preferably maintained at 60%~70%; after co-culturing, the purified mycorrhizal seedlings and sterile host seedlings achieve large-scale propagation and preparation of purified mycorrhizal seedlings through rhizosphere cross-infection.

[0037] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0038] Example 1

[0039] 1. Planting of host seedlings

[0040] (1) Sterilization of culture medium

[0041] Akadama soil, pumice, and forest topsoil are mixed in a volume ratio of 2:1:1, placed in a high-pressure steam sterilizer, and sterilized at 121°C for 3 hours before use. The pH value is 5.5-6.

[0042] (2) Disinfection of host seeds

[0043] Soak the collected Castanopsis chinensis seeds in pasteurized solution for 30 minutes. After disinfection, rinse thoroughly with sterile water and then soak in sterile water for 24 hours before use.

[0044] (3) Seed sowing and seedling management

[0045] Evenly sow the sterilized seeds in seedling trays containing the sterilized substrate from step (1), spray water to keep the substrate moist, and place them in a greenhouse or constant temperature incubator for cultivation until well-developed lateral roots are formed (120~135 days). Before inoculation, transplant them to sterile containers until new roots grow to facilitate subsequent mycorrhizal inoculation. During the cultivation period, check the substrate moisture content regularly. If it dries out, water it thoroughly with sterile water or tap water to replenish the moisture.

[0046] 2. Mycorrhizal inoculation

[0047] (1) Preparation and sterilization of culture medium

[0048] Akadama soil, pumice stone and forest topsoil are mixed in a volume ratio of 2:1:1, placed in a high-pressure steam sterilizer, sterilized at 121°C for 3 hours and set aside. The pH value is 5.5-6.

[0049] (2) Mycorrhizal sample processing

[0050] Fresh, highly active mycorrhizae of red mushrooms were collected from the soil of wild red mushroom growing sites, and other bacteria were removed.

[0051] (3) Inoculation and cultivation

[0052] After removing contaminants, the mycorrhizae were attached to the root surface of the sterile host seedlings and planted in the sterilized substrate. They were then placed in a greenhouse or culture room for cultivation under the following conditions: 23-25℃, 16 hours of light, and a light intensity of 6000-8000 lx; ​​8 hours of darkness at 20-25℃ until mycorrhizal seedlings were formed.

[0053] 3. Infection and propagation of mycorrhizal seedlings

[0054] (1) Mycorrhizal identification

[0055] Collect the mycorrhizal sample formed in step 2 (3), extract DNA and perform PCR amplification and sequencing using specific primers for Pleurotus eryngii;

[0056] Specific primers for *Russula gracilis*:

[0057] Rg_F: ATCTCGTTTCGCCGGACTAT (SEQ ID NO.1);

[0058] Rg_R: TCCTCATTGACTTCGGCCTT (SEQ ID NO. 2).

[0059] During PCR amplification, the DNA of the fruiting body of *Pleurotus eryngii* was used as a reference. The amplified length was consistent with the length of the fruiting body, and the amplified fragment length was 392 bp.

[0060] Combined with microscopic morphological observation (milky white with a slight reddish tinge, multi-branched or coral-like, such as...) Figure 4 ) were used for species-specific identification to screen out the mycorrhizae specific to Russula gray flesh. The success rate of mycorrhizal seedlings of Russula with Castanopsis carlesii as the host reached 70%.

[0061] (2) Propagation and mass production of mother seedlings

[0062] The specific mycorrhizae of *Russula gracilis* that passed identification were inoculated again into sterile host seedlings to obtain purified mycorrhizal mother seedlings. Subsequently, the well-developed mycorrhizal mother seedlings and a large number of sterile host seedlings were co-cultured in a substrate. During the culture period, the substrate surface was watered thoroughly when it became slightly dry. After about 3 months of co-culture, cross-infection between the mother seedlings and sterile seedlings occurred through the rhizosphere, achieving large-scale preparation of purified mycorrhizal seedlings.

[0063] Three replicate experiments were conducted using the above method. The ratio of mycorrhizal mother seedlings to infected host seedlings in groups 1-3 was 1:3, 1:5, and 1:10, respectively. According to the test results, the probability of successfully obtaining mycorrhizal seedlings was 72%-90%. The mycorrhizal infection rate of the cultivated purified mycorrhizal seedlings reached 88%-100%. Since there was no need to separate mycelial culture, the cultivation cycle of mycorrhizal seedlings was shortened by more than 90 days compared with traditional mycorrhizal seedling cultivation.

[0064] Table 1. Success rate and infection rate of specific mycorrhizal species in *Russula greifolia*

[0065]

[0066] Comparative Example 1

[0067] In contrast treatment 1, the culture substrate was changed to calcined core soil and forest topsoil in a volume ratio of 2:1, and the ratio of mycorrhizal mother seedlings to infected host seedlings was 1:3. The remaining operations were the same as in Example 1.

[0068] In comparative treatment 2, the cultivation medium was changed to separate forest topsoil, the ratio of the number of mycorrhizal mother seedlings to the infected host seedlings was 1:3, and the rest of the operations were the same as in Example 1.

[0069] In contrast treatment 3, the culture substrate was changed to vermiculite and forest topsoil in a volume ratio of 2:1, and the ratio of mycorrhizal mother seedlings to infected host seedlings was 1:3. The remaining operations were the same as in Example 1.

[0070] The experimental results are shown in Table 2.

[0071] Table 2 Comparison of the success rate and infection rate of the specific mycorrhizal roots of Russula grisea in treatments 1 to 3

[0072]

[0073] It is evident that the composition of the culture medium has a significant impact on the formation and infection effect of mycorrhizal seedlings. The culture medium provided by this invention is specifically optimized for Russula gravidarum and is more suitable for the formation and infection of Russula gravidarum mycorrhizal seedlings.

[0074] Comparative Example 2

[0075] The mycorrhiza PCR amplification and identification steps in Example 1 were omitted, and identification was performed only by morphological observation under a microscope.

[0076] The results are shown in Table 3.

[0077] Table 3. Success rate and infection rate of specific mycorrhizal species in *Russula greifolia*

[0078]

[0079] As can be seen from the results in 1, omitting the step of mycorrhizal PCR amplification and identification resulted in the presence of non-Grey Rose Mushroom-specific mycorrhizae in the obtained mycorrhizal seedlings, leading to a decrease in the success rate of seedling infection.

[0080] As can be seen from the above embodiments and comparative examples, the cultivation method of purified mycorrhizal seedlings of *Russula greyne-fleshed* provided by the present invention, the substrate composition, mycorrhizal PCR amplification and identification, etc., all affect the success rate and infection rate of the final mycorrhizal seedlings. The present invention successfully obtained specific mycorrhizal seedlings of *Russula greyne-fleshed* under specific substrate and specific culture conditions, and achieved a very high infection rate.

[0081] Regarding the cultivation cycle, conventional mycelial inoculation methods first require the isolation and purification of the target fungus mycelium, a process that typically takes 60-90 days or even longer. Afterward, the purified mycelium is inoculated into the culture medium of the host seedling, and under suitable environmental conditions, mycorrhizal formation usually takes at least another 60 days. Because purified mycelium has high requirements for host adaptability and is easily affected by multiple factors such as the fungal species, host, and soil environment, the final mycorrhizal formation rate is often only around 40% and is unstable.

[0082] In contrast, this invention directly uses purified active mycorrhizae for inoculation, omitting the mycelial purification and culture step, which can shorten the overall culture cycle by about 90 days and obtain uniform and stable mycorrhizal formation within 30 to 60 days; at the same time, the mycorrhizal formation rate obtained by the method of this invention can reach more than 70%, and the results are more consistent, reproducible and reliable.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for cultivating purified mycorrhizal seedlings of Russula grisea, characterized in that: The following steps are involved: 1) Collect active mycorrhizae of Russula grisea; 2) attaching the active mycorrhiza to the root surface of a sterile host seedling, and then cultivating to obtain a stable mycorrhizal seedling; 3) screening the specific mycorrhizae of Russula grisea from the stable mycorrhizal seedlings; 4) inoculating sterile host seedlings with the specific mycorrhiza of Russula grisea to obtain purified mycorrhizal seedlings of Russula grisea; Step 3) The screening is performed by PCR amplification combined with morphological observation; the PCR amplification is performed using primers specific for Russula grisea.

2. The cultivation method according to claim 1, characterized in that The Russula grisea-specific primers include Rg_F and Rg_R; the nucleotide sequence of Rg_F is shown in SEQ ID NO.1, and the nucleotide sequence of Rg_R is shown in SEQ ID NO.

2.

3. The cultivation method according to claim 1, wherein After step 4) obtaining the purified mycorrhizal seedlings, the method further includes a propagation step of co-culturing the purified mycorrhizal seedlings with sterile host seedlings.

4. The cultivation method according to claim 3, characterized in that The ratio of the number of the mycorrhizal purified seedlings to the sterile host seedlings is 1: (5-20).

5. The cultivation method according to claim 3 or 4, characterized in that The co-cultivation matrix includes red jade soil, pumice and forest topsoil, and the volume ratio of the red jade soil, pumice and forest topsoil is (1.5-2.5):1:

1. During the co-cultivation period, the water content of the matrix is maintained at 60%-70%.

6. The cultivation method according to claim 5, characterized in that The particle size of the red jade soil is 1.5-3 mm, and the pH value is 5.5-6.0; the pumice is porous volcanic stone, and the particle size of the pumice is 3-5 mm.

7. The cultivation method according to claim 1, characterized in that The hosts are Castanopsis carlesii, Castanopsis rubrum, Castanopsis fargesii, Castanopsis fujianensis, Castanopsis kawakamii, Castanopsis annularis, Lithops, and Cyclobalanopsis glauca.

8. The cultivation method according to claim 1, characterized in that Step 2) The culture conditions are as follows: 23-25° C., light for 16 h, light intensity of 6000-8000 lx; 20-25° C., darkness for 8 h; the culture time is 80-100 days.

Images