Multi-site specific integrated cell of difficult-to-express protein

Abstract

The present disclosure relates to site-specific integration (SSI) mammalian cells comprising at least two different recombinant target sites (RTSs), wherein the two RTSs are chromosomically integrated within the NL1 locus or the NL2 locus. The disclosure also relates to an SSI mammalian cell comprising at least four different RTSs wherein two RTSs are chromosomically integrated within the NL1 or NL2 locus and two RTSs are chromosomically integrated within separate loci. The disclosure also relates to methods for using SSI mammalian cells to produce recombinant protein expression cell lines that can express difficult-to-express proteins.

Description

Field of the Invention

[0001] The present disclosure relates to site-specific integration (SSI) mammalian cells comprising at least two different recombination target sites (RTS), wherein the two RTS are chromosomally integrated within the NL1 locus or the NL2 locus. The disclosure also relates to SSI mammalian cells comprising at least 4 different RTS, wherein 2 RTS are chromosomally integrated within the NL1 or NL2 locus, and 2 RTS are chromosomally integrated within separate loci. The disclosure also relates to methods for using SSI mammalian host cell lines to generate recombinant protein expressing cell lines that can additionally express difficult-to-express proteins. Background Art

[0002] Novel and biosimilar biopharmaceuticals continue to see high demand and increased sales revenue. Newer formats with increased ubiquity, non-monoclonal antibodies (mAbs), recombinant proteins (rPs), many of which can be classified as difficult to express (DtE), can pose challenges to the delivery of therapeutics in the biopharmaceutical industry. DtE proteins can be associated with lower than expected potency or with problems with multiple chains, accessory proteins, product recovery or purification (Pybus et al. Biotechnol. Bioeng. 111: 372-85 (2014)). Examples of DtE proteins include, but are not limited to, Fc-fusion proteins, bispecific or trispecific MAbs, enzymes, membrane receptors, and bispecific T cell engagers. (Micromet AG, Munich, Germany) molecules and selected mAbs.

[0003] A reported method for integrating a recombinant protein (rP) expression cassette into the host cell genome is based on random integration (RI), which is a method by which DNA is introduced into cells and merged into double-strand breaks (DSBs) present in the genome. Therefore, when using such a method, the number of integrated gene copies and the expression characteristics at the integration site (position variegation effect) can be highly variable. This may be problematic for DtE proteins for many reasons. For example, for some multi-chain proteins, it will be difficult to control the number of integrated gene copies encoding individual chains or auxiliary genes, vector size restrictions will hinder the expression of multi-chain proteins, and transfection of multiple vectors will result in low integration efficiency and high expression of some DtEs that may cause toxicity.

[0004] Another method for integrating the rP expression cassette is by using site-specific integration (SSI). The "landing pad" located in the genome of the SSI cell line can utilize a recombination target site (RTS) derived from a site-specific recombinase system, such as the FLP-FRT system derived from Saccharomyces cerevisiae or the Cre-loxP system derived from bacteriophage P1. In these systems, the recombinant enzyme or recombinase is responsible for the recombination event between the donor and the target DNA containing a compatible recombination site (respectively Frt or loxP) (see, for example, Curr. Op. in Biotech. 18: 411-9 (2007) such as Wirth). By using different recombination sites located at the 5' and 3' ends of the cassette to be exchanged (in the donor and target DNA), it is possible to ensure that the recombination occurs in a directed manner and that only the preferred cassette region is exchanged. Therefore, SSI can be more advantageous than random integration methods. The process of integrating the cassette into the SSI cell line is referred to as recombinase-mediated cassette exchange (EMCE). Indeed, the construction of cell lines for the production of recombinant proteins using EMCE involves the co-transfection of an expression vector encoding the recombinase and a targeting expression vector comprising the gene of interest (encoding rP) and a selection marker flanking the recombinase targeting sequence.

[0005] There are also limitations to using a single landing pad for producing SSI cell lines. For example, such methods usually, by design, result in a smaller number of integrated gene copies that can indirectly limit the expression titer of rP-produced recombinant proteins. If multiple proteins need to be produced in an SSI host cell line containing a single landing pad for rP production, then all the required genes will need to be included in a single vector. One way to increase the number of integrated recombinant gene copies is to accumulate SSI (sometimes referred to as stacking or multiplexing, see, for example, Kameyama et al. Biotechnol. Bioeng. 105: 1106-14 (2010), Kawabe et al. Cytotechnology 64: 267-79 (2012) and Turan et al. J. Mol. Biol. 402: 52-69 (2010)). With such an approach, repeated rounds of RMCE can be used to load a single site, followed by multiple copies of the rP expression cassette copy. Landing pads in such SSI host cell lines cannot be addressed independently, and repeated rounds of RMCE are required, which will take extra time for each cycle.

[0006] Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties. SUMMARY OF THE INVENTION

[0008] There is a need to generate SSI host cell lines that overcome the limitation of SSI hosts having only a single genomic insertion site. This invention addresses this need by using tandem SSI landing pads, where two or more landing pads are integrated at the same locus, potentially overcoming the limitation of cumulative site-specific integration. In such a system, the landing pads are independently addressable (due to recombination site and selectable marker selection).

[0009] In some embodiments, the present disclosure provides mammalian cells comprising at least two different RTS, wherein the two RTS are integrated into the NL1 locus or the NL2 locus on the chromosome. In some embodiments, the cell comprises two different RTS. In some embodiments, the two different RTS are integrated into the NL1 locus on the chromosome. In some embodiments, the two different RTS are integrated into the NL2 locus on the chromosome. In some embodiments, the cell comprises four different RTS. In some embodiments, the four different RTS are integrated into the same locus on the chromosome. In some embodiments, the two different RTS are integrated into a separate locus on the chromosome. In some embodiments, the separate locus is the Fer1L4 locus. In some embodiments, the two different RTS are integrated into the NL1 locus on the chromosome, and the two different RTS are integrated into the NL2 locus on the chromosome. In some embodiments, the cell comprises six different RTS. In some embodiments, at least four different RTS are integrated into the same locus on the chromosome. In some embodiments, at least two different RTS are integrated into the NL1 locus or the NL2 locus on the chromosome, and at least two different RTS are integrated into a separate locus on the chromosome. In some embodiments, the separate locus is the Fer1L4 locus. In some embodiments, at least two different RTS are integrated into the NL1 locus on the chromosome, and at least two different RTS are integrated into the NL2 locus on the chromosome. In some embodiments, at least one of the RTS is a Frt site, a lox site, a rox site or an att site. In some embodiments, at least one of the RTS is selected from SEQ ID No: 1-30. In some embodiments, the cell is a mouse cell, a human cell, a Chinese hamster ovary (CHO) cell, a CHO-K1 cell, a CHO-DXB11 cell, a CHO-DG44 cell, including various variants of CHOK1SV TM cells, including various variants of CHOK1SVGS-KO TM (glutamine synthetase knockout) cells, HEK cells, including adherent and suspension-adapted variants of HEK293 cells, HeLa cells, or HT1080 cells. In some embodiments, the cells are HEK cells.

[0010] In some embodiments, the cell comprises a first gene of interest, wherein the first gene of interest is integrated on a chromosome. In some embodiments, the first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, an auxiliary gene, or a combination thereof. In some embodiments, the gene of therapeutic interest comprises a gene encoding a DtE protein. In some embodiments, the DtE protein is selected from: an Fc fusion protein, an enzyme, a membrane receptor, a bispecific T cell engager ( Micromet AG, Munich, Germany) or a monoclonal antibody. In some embodiments, the monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody. In some embodiments, the first gene of interest is located between two RTSs. In some embodiments, the first gene of interest is located within the NL1 locus. In some embodiments, the cell comprises a second gene of interest, wherein the second gene of interest is integrated on a chromosome. In some embodiments, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, an auxiliary gene or a combination thereof. In some embodiments, the gene of therapeutic interest comprises a gene encoding a DtE protein. In some embodiments, the DtE protein is selected from: an Fc fusion protein, an enzyme, a membrane receptor, a bispecific T cell engager Or monoclonal antibody. In some embodiments, the second gene of interest is located between two RTS. In some embodiments, the second gene of interest is located in the NL1 locus or the NL2 locus. In some embodiments, the first gene of interest is located in the NL1 locus, and the second gene of interest is located in the NL2 locus. In some embodiments, the cell comprises a third gene of interest, wherein the third gene of interest is integrated on a chromosome. In some embodiments, the third gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the third gene of interest is located between two RTS. In some embodiments, the third gene of interest is located in the NL1 locus or the NL2 locus. In some embodiments, the third gene of interest is located in a locus different from the NL1 locus or the NL2 locus. In some embodiments, the first gene of interest, the second gene of interest, and the third gene of interest are located in three separate loci. In some embodiments, at least one of the first gene of interest, the second gene of interest, and the third gene of interest is located in the NL1 locus, and at least one of the first gene, the second gene of interest, and the third gene of interest is located in the NL2 locus. In some embodiments, the cell comprises a site-specific recombinase gene. In some embodiments, the site-specific recombinase gene is integrated on a chromosome.

[0011] In some embodiments, the present disclosure provides a mammalian cell comprising at least four different RTSs, wherein the cell comprises (a) at least two different RTSs, which are integrated on the chromosome at the NL1 locus or the NL2 locus; (b) a first gene of interest, which is integrated between the at least two RTSs of (a), wherein the first gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof; (c) and a second gene of interest, which is integrated in a second chromosomal locus different from the locus of (a), wherein the second gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof.

[0012] In some embodiments, the present disclosure provides a mammalian cell comprising at least four different RTSs, wherein the cell comprises (a) at least two different RTSs, which are chromosomally integrated within the Fer1L4 locus; (b) at least two different RTSs, which are chromosomally integrated within the NL1 locus or the NL2 locus; (c) a first gene of interest, which is chromosomally integrated within the Fer1L4 locus, wherein the first gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof; and (d) a second gene of interest, which is chromosomally integrated within the NL1 locus or the NL2 locus of (b), wherein the second gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof.

[0013] In some embodiments, the present disclosure provides a mammalian cell comprising at least six RTSs, wherein the cell comprises (a) at least two different RTSs and a first gene of interest, which are chromosomally integrated within the Fer1L4 locus; (b) at least two different RTSs and a second gene of interest, which are chromosomally integrated within the NL1 locus; and (c) at least two different RTSs and a third gene of interest, which are chromosomally integrated within the NL2 locus.

[0014] In some embodiments, the present disclosure provides a method for producing a recombinant protein producer cell, comprising (a) providing a cell comprising at least four different RTSs and a gene encoding a site-specific recombinase, wherein at least two different RTSs are integrated into the NL1 locus on the chromosome and at least two different RTSs are integrated into the NL2 locus on the chromosome; (b) transfecting the cell of (a) with a first vector and a second vector, wherein the first vector comprises an exchangeable cassette encoding a first gene of interest, and the second vector comprises an exchangeable cassette encoding a second gene of interest; (c) integrating the first exchangeable cassette into the NL1 locus and integrating the second exchangeable cassette into the NL2 locus; and (d) selecting a recombinant protein producer cell comprising the first exchangeable cassette and the second exchangeable cassette integrated into the chromosome. In some embodiments, the first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene, or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the DtE protein comprises an Fc fusion protein, an enzyme, a membrane receptor, a bispecific T cell engager Or a monoclonal antibody. In some embodiments, the monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody. In some embodiments, the first gene of interest is located between two RTS. In some embodiments, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the second gene of interest is located between two RTS.

[0015] In some embodiments, the present disclosure provides a method for producing a recombinant protein producer cell, comprising (a) providing a cell comprising at least four different RTS and a gene encoding a site-specific recombinase, wherein at least two different RTS are integrated on the chromosome within the Fer1L4 locus and at least two different RTS are integrated on the chromosome within the NL1 locus or the NL2 locus; (b) transfecting the cell of (a) with a first vector and a second vector, wherein the first vector comprises an interchangeable cassette encoding a first gene of interest, and the second vector comprises an interchangeable cassette encoding a second gene of interest; (c) integrating the first interchangeable cassette into the Fer1L4 locus and integrating the second interchangeable cassette into the NL1 locus or the NL2 locus; and (d) selecting a recombinant protein producer cell comprising the first interchangeable cassette and the second interchangeable cassette integrated into the chromosome. In some embodiments, the first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene, or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the DtE protein is composed of an Fc fusion protein, an enzyme, a membrane receptor, a bispecific T cell engager, Or monoclonal antibodies. In some embodiments, the monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody. In some embodiments, the first gene of interest is located between two RTS. In some embodiments, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the second gene of interest is located between two RTS.

[0016] In some embodiments, the present disclosure provides a method for producing a recombinant protein producer cell, which comprises (a) providing a cell comprising at least six different RTSs and a gene encoding a site-specific recombinase, wherein at least two different RTSs are integrated into the Fer1L4 locus on the chromosome, and at least two different RTSs are integrated into the NL1 locus on the chromosome, and at least two different RTSs are integrated into the NL2 locus on the chromosome; (b) transfecting the cell of (a) with a first vector, a second vector, and a third vector, wherein the first vector comprises an interchangeable cassette encoding a first gene of interest, the second vector comprises an interchangeable cassette encoding a second gene of interest, and the third vector comprises an interchangeable cassette encoding a third gene of interest; (c) integrating the first interchangeable cassette into the Fer1L4 locus, the second interchangeable cassette into the NL1 locus, and the third interchangeable cassette into the NL2 locus; and (d) selecting a recombinant protein producer cell comprising the first interchangeable cassette, the second interchangeable cassette, and the third interchangeable cassette integrated into the chromosome. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of a recombinase-mediated cassette exchange (RMCE) approach using a multisite site-specific integration (SSI) host cell line with two independently addressable landing pads. The number of landing pads is limited by the availability of suitable loci, incompatible Frt recombinase sites (e.g., wild-type Frt (F), Frt F5 (F5), Frt F14 (F14), and Frt F15 (F15)), and selectable markers compatible with such multiplex approaches (e.g., green fluorescent protein (GFP) or red fluorescent protein (RFP)).

[0018] Figure 2 A shows the expression of CHOK1SV GS-KO TM Schematic diagram of landing pad setup in multisite SSI host, the CHOK1SV GS-KO TM (Glutamine synthetase knockout) Two different exemplary landing pads (landing pad A and landing pad B) are included in the multi-site SSI host. Single and multi-site GS-CHOK1SV are shown in Table 10 TM More details on the chromosomal integration of these landing pads in the SSI host. Landing pad A contains the hygromycin phosphotransferase (Hpt) enhanced green fluorescent protein (eGFP) fusion gene (Hpt-eGFP). The Hpt-eGFP fusion gene expression is controlled by the SV40 early promoter and has an SV40 poly A sequence. Different and distinct Frt sites are located between the SV40 promoter and the Hpt-eGFP gene (F5) and 5' of the SV40 poly A sequence (F) of RMCE. Landing pad B contains the puromycin N-acetyltransferase-DsRed (PAC-DsRed) fusion gene controlled by the SV40 promoter and contains the SV40 poly A sequence. A different pair of Frt sites that are different from the Frt sites in landing pad A are located between the SV40 early promoter and the PAC-DsRed gene (F14) and 5' of the SV40 poly A sequence (F15). The location of the Frt site between the SV40E promoter and the selection marker will be used for subsequent rounds of RMCE. Targeting vectors designed for RMCE in SSI single or multi-site hosts contain a positive selection marker (e.g., GS) placed adjacent to the 3' end of the Frt site compatible with the target landing pad. Figure 2 B). The remainder of the vector contains the transcription unit of the GOI (e.g., mAb), followed by a Frt site that is compatible with the second Frt site in the landing pad. The targeting vector DNA is co-transfected with a vector expressing the FlpE recombinase ( Figure 3 A and Figure 5 )(Takata et al., Genes to Cells 16:7(2011))( Figure 3 B). The transfected cells were incubated for 24 hours and then selective pressure was applied (e.g., removal of glutamine from the culture medium). Successful RMCE is marked by the loss of Hpt-eGFP and its replacement by the positive selection marker gene ( Figure 2 C). Cells appear dark under a fluorescent microscope or analyzed by flow cytometry. Unexchanged cells recovered in positive selection are easily removed by fluorescence-assisted cell sorting.

[0019] Figure 3 The pMF25 targeting vector ( Figure 3 A) and pMF4 recombinase expression vector ( Figure 3 B) for CHOK1SVGS-KO TM Generate a DsRed-producing cell line in an SSI host. Figure 3 A) Contains a transcription unit incorporating the DsRed gene, flanked by mutant (F5) and wild-type (F) Frt sites. Transcription of the DsRed monomer is driven by the promoter of the hCMV major intermediate early gene 1 (hCMV) and its first intron (intron A (hCMV intron)), and the flanking exons encoding the 5'UTR are indicated as Ex1 and Ex2. Glutamine synthetase cDNA (GS) and SV40 intron A (SV40 intron) are placed 3' adjacent to FrtF5, and successful RMCE transcription is driven by the SV40E promoter located in the landing pad. pMF4 ( Figure 3 B) contains a transcription unit incorporating the FlpE gene (Takata et al., Genes to Cells 16:7 (2011)), driven by the promoter of the major intermediate early gene 1 (hCMV) and its first intron (intron A (hCMV intron)), and the flanking exons encoding the 5'UTR are indicated as Ex1 and Ex2. In both vectors, the polyadenylation sequence and β-lactamase are indicated as pA and bla, respectively.

[0020] Figure 4 Figure 2 shows the expression of pMF25 and FlpE recombinase encoding vectors from CHOK1SV GS-KO cells before and after co-transfection. TMData from flow cytometric analysis of SSI host clones (7878, 8086, 8096, 9113, 9116, and 9115). Green and yellow fluorescence of 7878 and 8086 (single site, Fer1L4 landing pad A), 8086 and 9113 (single site, NL1 landing pad A), and 9116 and 9115 (single site, NL2 landing pad Pad A) were measured using a Millipore Guava flow cytometer before and after RMCE (11 days of selection in glutamine-free medium). eGFP fluorescence was detected in the green channel and DsRed was detected in the yellow channel.

[0021] Figure 5 Targeting vectors are shown for use in CHOK1SV GS-KO derived TM mAb-producing cell lines were generated in an SSI host. Vectors pMF26 (A), pMF27 (B) and pMF28 (C) contain transcription units incorporating rituximab, cB72.3 and H31K5 antibody genes (respectively), flanked by mutant (F5) and wild-type (F) Frt sites. Transcription of the heavy chain (HC) and light chain (LC) genes is driven by the promoter of the hCMV major intermediate early gene 1 (hCMV) and its first intron (intron A (hCMV intron)), and the flanking exons encoding the 5'UTR are indicated as Ex1 and Ex2. Glutamine synthetase cDNA (GS) and SV40 intron-poly A (in Figure 5 The pA sequence was placed adjacent to Frt F5 at 3' to select for on-target integration after RMCE. β-lactamases were denoted as bla.

[0022] Figure 6 Shown are the secreted rituximab, cB72.3 and H31K5 mAb concentrations of CHOK1SV GS-KO grown in batch culture TM SSI library. CHOK1SV GS-KO was transfected with pMF26 (rituximab), pMF27 (cB72.3), or pMF28 (H31K5). TM SSI host clone 11434 (single locus, Fer1L4 landing pad A). Chow1SV GS-KO was cultured in replicates (n ≥ 3) in 8-day batch cultures TM SSI library. Secreted rituximab (A), cB72.3 (B) and H31K5 (C) mAbs (mg / L) were determined by Protein A HPLC.

[0023] Figure 7Data from multi-site SSI host flow cytometric analysis prior to RMCE are shown. The expression of CHOK1SV GS-KO was measured using a Millipore Guava flow cytometer TM Host (Host), 11434 (single locus, Fer1L4 landing pad A), DsRed random integration control and 6 CHOK1SV GS-KO TM Green and yellow fluorescence of multisite host clones (12151, 12152, 12606, 12607, 12608, and 12609) (multisite sister clones with landing pad A in the Fer1L4 locus and landing pad B in the NL1 locus). eGFP fluorescence was detected in the green channel and DsRed was detected in the yellow channel.

[0024] Figure 8 Schematic representation of vectors pCM9 and pCM11 targeting Fer1L4 and NL1 landing pads in CHOK1SV GS-KO SSI host. The vectors are as follows: Figure 8 A: pCM9 (E2 Deep Red expression vector targeting the Fer1L4 locus); Figure 8 B: pCM11 (E2 Deep Red expression vector targeting the NL1 locus).

[0025] Fig. 9 Flow cytometry analysis of CHOK1SV GS-KO SSI cells derived from cells targeted with pCM9 and pCM11 is shown. Multiple CHOK1SV GS-KO SSI clones 12151 (containing landing pad A in the Fer1L4 locus) were transfected with pCM9 (E2 Deep Red expression vector targeting the Fer1L4 locus) and pCM11 (E2 Deep Red expression vector targeting the NL1 locus). Figure 2 A) and contains landing pad B in the NL1 locus ( Figure 2 A)).

[0026] Fig.10 Targeting Fer1L4 ( Figure 2 , Landing Pad A), NL1( Figure 2 Schematic diagram of rituximab expression vectors pMF26, pCM38, pCM22, and pAR5 for use with either landing pad A or both. The vectors are as follows: pMF26 ( Fig.10 A: Rituximab 1x LC, 1xHC expression vector targeting Fer1L4 locus), pCM38 ( Fig.10 B: Rituximab 2x LC, 2x HC expression vector targeting Fer1L4 locus), pCM22 ( Fig.10 C: empty expression vector, which targets the NL1 locus) and pAR5 ( Fig.10D: Rituximab 1x LC, 1x HC expression vector targeting the NL1 locus).

[0027] Fig.11 Shown are the cell-specific rituximab productivity (qmAb) of RMCE pools targeted with pMF26, pCM38, pCM22, and pAR5 after 8 days of batch culture.

[0028] Fig.12 Targeting Fer1L4 ( Figure 2 , Landing Pad A), NL1( Figure 2 Schematic diagram of Cergutuzumab amunaleukin (CEA-IL2v) expression vectors pAB2, pAB5, pCM46, and pAR2 for Cergutuzumab amunaleukin (CEA-IL2v) expression of either 1, 2, or 3 CEA-IL2v. The vectors are as follows: pAB2 (CEA-IL2v LC, HC, and HC-IL2 expression vectors, which target the Fer1L4 locus), pAB5 (CEA-IL2v LC and HC-IL2 expression vectors, which target the Fer1L4 locus), pCM46 (empty expression vector, which targets the NL1 locus), and pAR2 (CEA-IL2v HC expression vector, which targets the NL1 locus).

[0029] Fig.13 Schematic diagram of SDS-page analysis of the RMCE library expressing CEA-IL2v after transfection with pAB2, pAB5, pCM46 and pAR2 ( Fig.12 ). A: Image of a 10% Bis-Tris protein gel produced under non-reducing conditions, lanes 1-9 are labeled. Lane 1: Protein standard pre-stained with Seeblue Plus2. Lane 2: Assay mock (empty) library generated by transfection with the pAB2 empty vector. Lanes 2-5: Control library generated with a vector expressing only 2 of the 3 chains required to generate CEA-IL2v for distributing folding intermediates. Lane 6: Analysis of a library with CEA-IL2v LC, HC, and HC-IL2 in the Fer1L4 locus (pAB2). Lane 7: Analysis of a library with CEA-IL2v LC and HC-IL2 in the Fer1L4 locus and an empty vector in NL1 (pCM46). Lanes 8 and 9: CEA-IL2v LC and HC-IL2 in the Fer1L4 locus and CEA-IL2v HC in the NL1 locus (pAR2). B: Summary hypothesis represents the bar graphs of the band densitometry of the light chain (LC), light chain dimer (2LC), half antibody (1LC, 1HC-IL2) and partially assembled chromatin monoclonal antibody amurulein (2LC, 2HC-IL2 and 2LC, 2HC).

[0030] Fig.14 Targeting Fer1L4 ( Figure 2 , Landing Pad A), NL1( Figure 2 Schematic diagram of the vectors for the genes of Entanercept, auxiliary or unstable GFP (dsGFP with miR target sequence in 3'UTR) or both. The vectors are as follows: pTC1 ( Fig.14 A, B and C: Etanercept expression vector targeting Fer1L4 locus), pCM22 ( Fig.14 A: empty vector targeting NL1), pCM39 ( Fig.14 B: Mus musculus SCD1 (mSCD1) expression vector targeting NL1), pCM40 ( Fig.14 B: Cricetulus griseus-optimized SCD1 codon for Mus musculus (ccmSCD1) expression vector targeting NL1), pCM41 ( Fig.14 B: Homo sapiens SCD1 (hSCD1), pCM42 ( Fig.14 B: Cricetulus griseus SREBF1 (ccSREBF1) expression vector targeting NL1), pCM43 ( Fig.14 C: dsGFP_6n CPEB2A expression vector targeting NL1), pCM44 ( Fig.14 C: dsGFP_6n CPEB2B expression vector targeting NL1) and pCM45 ( Fig.14 C: dsGFP_6n SRPα expression vector targeting NL1). See Tables 11 and 12 for details on the auxiliary genes and sponge sequence.

[0031] Fig.15 Growth and productivity assays from 8-day cultures of RMCE libraries expressing etanercept with or without accessory gene expression are summarized (see Fig.14 ). Data are mean (n=2) ± standard deviation. A: Cell-specific production rate (qP). B: Integrated viable cell concentration (IVCC). C: Secreted etanercept concentration. DETAILED DESCRIPTION OF THE INVENTION

[0033] The terms "a" or "an" when used in conjunction with "comprising" in the claims and / or the specification may mean "one", but is also consistent with the meaning of "one or more", "at least one" and "one or more than one".

[0034] Throughout the application, the term "about" is used to indicate a value that includes the inherent differences in the error of the device / method for determining the value or the differences that exist in the subjects. Typically, the term means including about or less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% variability, as the case may be.

[0035] The term "or" is used in the claims to mean "and / or" unless specifically indicated to refer to only alternatives, or the alternatives are mutually exclusive, but the disclosure supports a definition referring to only alternatives and "and / or."

[0036] As used in this specification and claims, the terms "comprising" (and any form of including, such as "containing" and "including"), "having" (and any form of having, such as "having" and "having"), "including" (and any form of including, such as "encompassing" and "enclosed"), or "containing" (and any form of containing, such as "included" and "comprising") are inclusive or open-ended and do not exclude additional unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with any method, system, host cell, expression vector and / or composition of the invention. In addition, the compositions, systems, cells and / or vectors of the invention can be used to implement any method described herein.

[0037] The use of the term "for example" and its corresponding abbreviation "such as" (whether italicized or not) means that the particular term recited is representative examples and embodiments of the disclosure and is not intended to be limiting to the particular examples recited or cited unless expressly stated otherwise.

[0038] In some embodiments, the present disclosure provides mammalian cells comprising at least two different RTSs, wherein the RTSs are chromosomally integrated within the NL1 locus or the NL2 locus.

[0039] As used herein, the term "mammalian cell" includes cells from any member of the class mammals, for example, human cells, mouse cells, rat cells, monkey cells, hamster cells, etc. In some embodiments, the mammalian cell is a mouse cell, a human cell, a Chinese hamster ovary (CHO) cell, a CHO-K1 cell, a CHO-DXB11 cell, a CHO-DG44 cell, a CHO-DG44 cell including various variants of CHO-DG4 ... TM Cells (e.g., CHOK1SV TM Lonza of Slough, UK, including various variants of the CHOK1SV GS-KO TM(glutamine synthetase knockout) cells, including adherent and suspension-adapted variants of HEK293 cells, HeLa cells, or HT1080 cells.

[0040] "Nucleic acid", "nucleic acid molecule" or "oligonucleotide" refers to a polymeric compound comprising covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA or MIRNA.

[0041] As used herein, "amino acid" refers to a compound containing a carboxyl (-COOH) and an amino (-NH2) group. "Amino acid" refers to both natural and non-natural (i.e., synthetic) amino acids. Natural amino acids include (by their three-letter and single-letter abbreviations): alanine (Ala; A); arginine (Arg; R); asparagine (Asn; N); aspartic acid (Asp; D); cysteine ​​(Cys; C); glutamine (Gln; Q); glutamic acid (Glu; E); glycine (Gly; G); histidine (His; H); isoleucine (Ile; I); leucine (Leu; L); lysine (Lys; K); methionine (Met; M); phenylalanine (Phe; F); proline (Pro; P); serine (Ser; S); threonine (Thr; T); tryptophan (Trp; W); tyrosine (Tyr; Y) and valine (Val; V).

[0042] The terms "peptide", "polypeptide" and "protein" are used interchangeably herein and refer to a polymeric form of amino acids of any length, which may include coded or non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones. The terms "chain" and polypeptide "chain" are used interchangeably herein and refer to a polymeric form of amino acids of a single peptide backbone.

[0043] When the term "recombinant" is used to refer to a nucleic acid molecule, a peptide, a polypeptide or a protein, it means or is derived from a new combination of genetic material that is not known to exist in nature. Recombinant molecules can be produced by any well-known technology available in the field of recombinant technology, including but not limited to, polymerase chain reaction (PCR), gene cutting (e.g., using restriction endonucleases) and solid-state synthetic nucleic acid molecules, peptides or proteins. In some embodiments, "recombinant" refers to a viral vector or virus that is not known to exist in nature, for example, a viral vector or virus with one or more mutations, nucleic acid insertions, or heterologous genes in a viral vector or virus. In some embodiments, "recombinant" refers to a cell or host cell that is not known to exist in nature, for example, a cell or host cell that has one or more mutations, nucleic acid insertions, or heterologous genes in a cell or host cell.

[0044] An "isolated" polypeptide, protein, peptide or nucleic acid is a molecule that has been removed from its natural context. It should also be understood that an "isolated" polypeptide, protein, peptide or nucleic acid can be formulated with an excipient such as a diluent or adjuvant and still be considered isolated.

[0045] In the case of nucleic acid sequences or amino acid sequences, the term "sequence identity" or "% identity" refers to the percentage of identical residues in the compared sequences when the sequences are aligned over a specified comparison window. The comparison window can be a segment of at least 10 residues to more than 1000 residues, in which sequences can be aligned and compared. Alignment methods for determining sequence identity are well known in the art and can be performed using publicly available databases such as BLAST (blast.ncbi.nlm.nih.gov / Blast.cgi.).

[0046] In some embodiments, the polypeptide or nucleic acid molecule has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity with a reference polypeptide or nucleic acid molecule (or a fragment of a reference polypeptide or nucleic acid molecule). In certain embodiments of the present disclosure, the polypeptide or nucleic acid molecule has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with a reference polypeptide or nucleic acid molecule (or a fragment of a reference polypeptide or nucleic acid molecule). In some embodiments, the polypeptide or nucleic acid molecule has about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% sequence identity with a reference polypeptide or nucleic acid molecule, respectively.

[0047] "Gene" refers to a combination of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acid molecules. "Gene" also refers to a nucleic acid fragment that can act as a regulatory sequence before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. In some embodiments, the gene is integrated into the host cell genome in multiple copies. In some embodiments, the gene is integrated into the host cell genome in a predefined copy number.

[0048] The term "regulatory element" as described herein refers to a genetic element that controls some aspects of nucleic acid sequence expression. "Promoter", "promoter sequence" or "promoter region" as used herein refers to a DNA regulatory region / sequence that can bind RNA polymerase and is involved in initiating transcription of downstream coding or non-coding sequences. In some examples of the present disclosure, the promoter sequence includes a transcription start site and extends upstream to include the minimum number of bases or elements required to initiate transcription at a level detectable above the background. In some embodiments, the promoter sequence includes a transcription start site, and a protein binding domain responsible for RNA polymerase binding. Eukaryotic promoters typically but not always include a "TATA" box and a "CAT" box. Various promoters, including inducible promoters, can be used to drive gene expression, for example, in a host cell or vector of the present disclosure. In some embodiments, the promoter is not a leaky promoter, i.e., the promoter does not constitutively express any of the gene products described herein.

[0049] As used herein, the term "heterologous promoter" refers to a regulatory element that is derived from a different species than the gene to which it is operably linked. In some embodiments, the heterologous promoter is derived from a prokaryotic system. In some embodiments, the heterologous promoter is derived from a eukaryotic system. In some embodiments, the disclosure provides cells in which one or more heterologous promoters are integrated into the host cell genome on a chromosome.

[0050] As used herein, the terms "operable combination", "operable order" and "operably linked" refer to the connection of nucleic acid sequences in such a way that the nucleic acid molecules are able to direct the transcription of a given gene and / or generate the synthesis of a desired protein molecule. The term also refers to the connection of amino acid sequences in a manner that produces a functional protein. In some embodiments, the gene of interest is operably linked to a promoter, wherein the gene of interest is integrated into the host cell on the chromosome. In some embodiments, the gene of interest is operably linked to a heterologous promoter, wherein the gene of interest is integrated into the host cell on the chromosome. In some embodiments, the auxiliary gene is operably linked to a promoter, wherein the auxiliary gene is integrated into the host cell genome on the chromosome. In some embodiments, the auxiliary gene is operably linked to a heterologous promoter, wherein the auxiliary gene is integrated into the host cell genome on the chromosome. In some embodiments, the gene encoding the DtE protein is operably linked to a promoter, wherein the gene encoding the DtE protein is integrated into the host cell genome on the chromosome. In some embodiments, the gene encoding the DtE protein is operably linked to a heterologous promoter, wherein the gene encoding the DtE protein is integrated into the host cell genome on the chromosome. In some embodiments, the recombinase gene is operably connected to a promoter, wherein the recombinase gene is integrated into the host cell on the chromosome. In some embodiments, the recombinase gene is operably connected to a promoter, wherein the recombinase gene is not integrated into the host cell genome on the chromosome. In some embodiments, the recombinase gene is operably connected to a heterologous promoter, wherein the recombinase gene is not integrated into the host cell genome on the chromosome. In some embodiments, the recombinase gene is operably connected to a heterologous promoter, wherein the recombinase gene is not integrated into the host cell genome on the chromosome. In some embodiments, the recombinase gene is operably connected to a heterologous promoter, wherein the recombinase gene is not integrated into the host cell genome on the chromosome.

[0051] In some embodiments, the regulatory element is operably linked to the presence of a ligand provided exogenously. In some embodiments, the gene of interest is operably linked to a promoter, wherein the promoter is operably linked to the expression of the gene and the presence of an exogenously provided ligand, and wherein the gene of interest is chromosomally integrated in the host cell genome. In some embodiments, an auxiliary gene is operably linked to a promoter, wherein the promoter is operably linked to the expression of the gene and the presence of an exogenously provided ligand, and wherein the auxiliary gene is chromosomally integrated in the host cell. In some embodiments, the gene encoding the DtE protein is operably linked to a promoter, wherein the promoter is operably linked to the expression of the gene and the presence of an exogenously provided ligand, and wherein the gene encoding the DtE protein is chromosomally integrated in the host cell genome. In some embodiments, a recombinase gene is operably linked to a promoter, wherein the promoter is operably linked to the expression of the gene and the presence of an exogenously provided ligand, and wherein the recombinase gene is chromosomally integrated in the host cell genome. In some embodiments, the recombinase gene is operably linked to a promoter, wherein the promoter is operably linked to gene expression in the presence of an exogenously provided ligand, and wherein the recombinase gene is not chromosomally integrated into the host cell genome.

[0052] The term "chromosomally integrated" or "chromosomal integration" as used herein refers to the stable incorporation of a nucleic acid sequence into a host cell, for example, a chromosome of a mammalian cell, that is, the nucleic acid sequence is integrated into the genomic DNA (gDNA) of a host cell (e.g., a mammalian cell) on the chromosome. In some embodiments, the chromosomally integrated nucleic acid sequence is stable. In some embodiments, the chromosomally integrated nucleic acid sequence is not located in a plasmid or vector. In some embodiments, the chromosomally integrated nucleic acid sequence is not sheared. In some embodiments, chromosomal integration is mediated by a clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-combined (Cas) protein gene editing system (CRISPR / CAS).

[0053] The term "chromosomal locus" used herein means a defined position of a nucleic acid on a cell chromosome that may include at least one gene. In some embodiments, the chromosomal locus includes about 500 base pairs to about 100,000 base pairs, about 5,000 base pairs to about 75,000 base pairs, about 5,000 base pairs to about 60,000 base pairs, about 20,000 base pairs to about 50,000 base pairs, about 30,000 base pairs to about 50,000 base pairs or about 45,000 base pairs to about 49,000 base pairs. In some embodiments, the chromosomal locus extends up to about 100 base pairs, about 250 base pairs, about 500 base pairs, about 750 base pairs or about 1000 base pairs to the 5' or 3' end of the nucleic acid sequence defined. In some embodiments, the chromosomal locus includes an endogenous nucleic acid sequence. In some embodiments, the chromosomal locus comprises an exogenous nucleotide sequence that has been incorporated into the chromosome using methods known to those skilled in the art of molecular biology. In some embodiments, the chromosomal locus comprises a nucleotide sequence in the host cell genome that provides strong and stable production of a heterologous protein encoded by a gene of interest integrated into the chromosomal locus. In some embodiments, the chromosomal locus comprises a nucleotide sequence in the host cell genome that provides strong and stable viral gene expression. In some embodiments, the chromosomal locus comprises a nucleotide sequence in the host cell genome that provides efficient site-specific integration. In some embodiments, the chromosomal locus comprises the NL1 locus, NL2 locus, NL3 locus, NL4 locus, NL5 locus, or NL6 locus described in Table 1. In some embodiments, the present disclosure relates to a mammalian cell comprising at least two different RTS, wherein the two RTS are integrated on the chromosome into the NL1 locus, NL2 locus, NL3 locus, NL4 locus, NL5 locus, or NL6 locus described in Table 1. In some embodiments, the present disclosure relates to a mammalian cell comprising at least two different RTS, wherein the two RTS are integrated on the chromosome into the NL1 locus, NL2 locus, NL3 locus, NL4 locus, NL5 locus, or NL6 locus described in Table 1.

[0054] Within the NL1 locus or the NL2 locus as described in Table 1.

[0055]

[0056]

[0057] Those skilled in the art will appreciate that the term "integrated within the NL1 locus" or "integrated within the NL2 locus" will include integration into any part of the locus and is not limited to the specified genomic coordinates. Those skilled in the art will appreciate that the term "integrated within the NL1 locus" or "integrated within the NL2 locus" will also include the corresponding locus in the corresponding organism. Thus, in some embodiments, the term "integrated within the NL1 locus" or "integrated within the NL2 locus" will include integration within about 50,000 bp, within about 40,000 bp, within about 30,000 bp, within 20,000 bp, or within 10,000 bp of the specified genomic coordinates.

[0058] In some embodiments, the disclosure relates to mammalian cells comprising at least two different RTS, wherein the two RTS are integrated on the chromosome in a locus selected from Fer1L4 (see, e.g., U.S. Patent Application No. 14 / 409,283), ROSA26, HGPRT, DHFR, COSMC, LDHA or MGAT1. In some embodiments, the chromosomal locus comprises the first intron of MID1 on chromosome X. In some embodiments, the chromosomal locus comprises an enhanced expression and stability region (EESYR see, e.g., U.S. Patent No. 7,771,997). In some embodiments, at least a portion of a gene in a natural chromosomal locus is deleted.

[0059] A "vector" or "expression vector" is a replicon, such as a plasmid, phage, virus or cosmid, that can connect another DNA segment to cause the connected DNA segment to replicate and / or express in a cell. A "vector" comprises an additional (e.g., plasmid) and a non-additive vector. In some embodiments of the present disclosure, the vector is an additional vector that is removed / lost from a cell population after multiple cell generations (e.g., by asymmetric distribution). The term "vector" comprises viral and non-viral means for introducing nucleic acid molecules into cells in vitro, in vivo or in vitro. The term vector may comprise a synthetic vector. The vector may be introduced into a desired host cell by well-known methods, including, but not limited to, transfection, transduction, cell fusion and lipofection. The vector may comprise various regulatory elements, including a promoter.

[0060] As used herein, the term "exchangeable cassette" or "cassette" is a class of mobile genetic elements that comprises a gene and a recombination site. In some embodiments, the exchangeable cassette comprises at least two RTSs. In some embodiments, the exchangeable cassette comprises a reporter gene or a selection gene. In some embodiments, the cassette is exchanged by recombinase-mediated cassette exchange (RMCE).

[0061] In some embodiments, site-specific integration is used to introduce one or more genes into host cell chromosomes.See, for example, Bode et al., Biol.Chem.381:801-813 (2000), Kolb, Cloning and Stem Cells4:381-392 (2002) and Coates et al., Trends in Biotech.23:407-419 (2005), each of which is incorporated by reference. In some embodiments, "site-specific integration" refers to the integration of a nucleic acid sequence into a chromosome at a specific site. In some embodiments, site-specific integration can also represent "site-specific recombination". In some embodiments, "site-specific recombination" refers to the rearrangement of two DNA partner molecules by a specific enzyme that is recombined at its target site or sequence homology. In contrast to homology recombination, site-specific recombination does not require DNA homology between parental DNA molecules, is independent of RecA, and does not involve DNA replication at any stage. In some embodiments, site-specific recombination uses a site-specific recombinase system to achieve site-specific integration of nucleic acids in host cells, for example, mammalian cells. The recombinase system usually includes three elements: two specific DNA sequences (recombination target sites) and a specific enzyme (recombinase). The recombinase catalyzes the recombination reaction between the specific recombination sites.

[0062] Recombinase system or recombinase is an enzyme that catalyzes recombination in site-specific recombination. In some embodiments of the present disclosure, the recombinase for site-specific recombination is derived from a non-mammalian system. In some embodiments, the recombinase is derived from bacteria, bacteriophage or yeast.

[0063] In some embodiments, the nucleic acid sequence encoding the recombinase is integrated into a host cell, for example, a mammalian cell. In some embodiments, the nucleic acid sequence encoding the recombinase is delivered to the host cell by methods known in molecular biology. In some embodiments, the recombinase polypeptide sequence can be delivered directly to the cell. In some embodiments, the recombinase is Cre recombinase, FLP recombinase, Dre recombinase, KD recombinase, B2B3 recombinase, Hin recombinase, Tre recombinase, λ recombinase, HK022 integrase, HP1 integrase, γδ resolvase / invertase, ParA resolvase / invertase, Tn3 resolvase / invertase, Gin resolvase / invertase, Integrase, BxB1 integrase, R4 integrase or other functional recombinase. See, e.g., Thorpe and Smith, Proc. Nat'l. Acad. Sci. USA 95:5505-5510 (1998); Kuhstoss and Rao, J. Mol. Biol. 222:897-890 (1991); U.S. Pat. No. 5,190,871; Ow and Ausubel, J. Bacteriol. 155:704-713 (1983); Matsuura et al., J. Bacteriol. 178:3374-3376 (1996); Sato et al., J. Bacteriol. 172:1092-1098 (1990); Stragier et al., Science 243:507-512 (1989); Carrasco et al., Genes Dev. 8:74-83 (1994); Bannam et al., Mol. Microbiol. 16:535-551 (1995); Crelin and Rood, J. Bacteriol. 179:5148-5156 (1997).

[0064] In some embodiments, the recombinase described herein is a FLP recombinase. The FLP recombinase is a protein that catalyzes a site-specific recombination reaction that involves amplifying the copy number of the 2μ plasmid of Saccharomyces cerevisiae during DNA replication. In some embodiments, the FLP recombinase of the present disclosure is derived from a species of the genus Saccharomyces. In some embodiments, the FLP recombinase is derived from Saccharomyces cerevisiae. In some embodiments, the FLP recombinase is derived from a strain of Saccharomyces cerevisiae. In some embodiments, the FLP recombinase is a thermostable, mutated FLP recombinase. In some embodiments, the FLP recombinase is FLP1 or FLPe. In some embodiments, the nucleic acid sequence encoding the FLP recombinase comprises human-optimized codons.

[0065] In some embodiments, the recombinase is a Cre recombinase. Cre (causing recombination) is a member of the Int family of recombinases (Argos et al. (1986) EMBO J. 5: 433) and has been shown to efficiently recombinant lox sites (X-ing over loci) in bacteria as well as in eukaryotic cells (Sauer (1987) Mol. Cell. Biol. 7: 2087; Sauer and Henderson (1988) Proc. Natl Acad. Sci. 85: 5166). In some embodiments, the Cre recombinase described and used herein is derived from a bacteriophage. In some embodiments, the Cre recombinase is derived from a P1 phage.

[0066] As used herein, the terms "site-specific integration site," "recombination target site," "RTS," and "site-specific recombinase target site" refer to a short (e.g., less than about 60 base pairs) nucleic acid site or sequence that is recognized by a site-specific recombinase and that becomes a crossover region during a site-specific recombination event. In some embodiments, the recombination target site is less than about 60 base pairs, less than about 55 base pairs, less than about 50 base pairs, less than about 45 base pairs, less than about 40 base pairs, less than about 35 base pairs, or less than about 30 base pairs. In some embodiments, the recombination target site is about 30-about 60 base pairs, about 30-about 55 base pairs, about 32-about 52 base pairs, about 34-about 44 base pairs, about 32 base pairs, about 34 base pairs, or about 52 base pairs. Examples of site-specific recombinase target sites include, but are not limited to, lox sites, rox sites, frt sites, att sites, and dif sites. In some embodiments, the recombination target site is a nucleic acid having a sequence substantially identical to that shown in SEQ ID NO: 1-30.

[0067] In some embodiments, RTS is a lox site selected from Table 2. The term "lox site" as used herein refers to a nucleotide sequence that Cre recombinase can catalyze site-specific recombination. Various lox sites are known in the art. The sequences of various lox sites are similar in this respect, and they all contain the same 13 base pairs of inverted repeats, which are flanked by an asymmetric core region of 8 base pairs in which recombination occurs. This is responsible for the directionality of the site and the asymmetric core region that varies between different lox sites. Their exemplary (non-limiting) examples include naturally occurring loxP (sequences present in the P1 genome), loxB, loxL and loxR (they are present in the E. coli chromosome) and a variety of mutants or variant lox sites, such as loxP 511, loxΔ86, loxΔ117, loxC 2, loxP 2, loxP 3 and loxP 23. In some embodiments, the lox recombination target site is a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a sequence present in Table 2.

[0068] Table 2

[0069]

[0070] In some embodiments, the RTS is a lox site selected from loxΔ86, loxΔ117, loxC2, loxP 2, loxP 3, and loxP23.

[0071] In some embodiments, RTS is a Frt site selected from Table 3. The term "Frt site" as used herein refers to the nucleotide sequence at the position where the FLP gene product of the yeast 2 μm plasmid, the FLP recombinase, can catalyze site-specific recombination. Various Frt sites are known in the art. The sequences of various Frt sites are similar in this respect, and they all contain the same 13 base pairs of inverted repeats, which are flanked by an asymmetric core region of 8 base pairs in which recombination occurs. This is the asymmetric core region responsible for the directionality of the site and the variation between different Frt sites. Their exemplary (non-limiting) examples include naturally occurring Frt (F), and a variety of mutant or variant Frt sites, such as Frt F1 and Frt F2. In some embodiments, the Frt recombination target site is a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the sequence present in Table 3.

[0072] Table 3

[0073]

[0074] In some embodiments, RTS is a rox site selected from Table 4. The term "rox site" as used herein refers to a nucleotide sequence at a position where the Dre recombinase can catalyze site-specific recombination. Various different rox sites are known in the art. Their illustrative (non-limiting) examples include roxR and roxF. In some embodiments, the rox recombination target site is a nucleic acid having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with a sequence present in Table 4.

[0075] Table 4

[0076] name Identifier sequence roxF SEQ ID NO.:22 TAACTTTAAATAATGCCAATTATTTAAAGTTA roxR SEQ ID NO.:23 TAACTTTAAATAATTGGCATTATTTAAAGTTA

[0077] In some embodiments, the RTS is an att site selected from Table 5. As used herein, the term "att site" refers to a lambda integrase or Integrase can catalyze the nucleotide sequence at the position of site-specific recombination. Various different aat sites are known in the art. Their illustrative (non-limiting) examples include attP, attB, proB, trpC, galT, thrA and rrnB. In some embodiments, the att recombination target site is a nucleic acid with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the sequence present in Table 5.

[0078] Table 5

[0079]

[0080] Term " different recombination target sites " described herein refers to recombination target sites that are not identical or heterospecific.For example, there are multiple variant Frt sites, but recombination can usually only occur between two identical Frt sites.In some embodiments, different recombination target sites refer to the different recombination target sites (for example, LoxP and LoxR) from the same recombination system.In some embodiments, different recombination target sites refer to the different recombination target sites (for example, LoxP and Frt) from different recombination systems.In some embodiments, different recombination target sites refer to the combination (for example, LoxP, LoxR, Frt and Frt1) of the recombination target sites from the same recombination system and the recombination target sites from different recombination systems.

[0081] Various combinations of RTS can be used. In some embodiments, the cell comprises two RTS. In some embodiments, the cell comprises four RTS. In some embodiments, the cell comprises six RTS. In some embodiments, at least one RTS is selected from SEQ ID No: 1-30. In some embodiments, the cell comprises six RTS. In some embodiments, at least one RTS is selected from SEQ ID No: 1-6. In some embodiments, the cell comprises six RTS. In some embodiments, at least one RTS is selected from SEQ ID No: 7-21. In some embodiments, the cell comprises six RTS. In some embodiments, at least one RTS is selected from SEQ ID No: 22-23. In some embodiments, at least one RTS is selected from SEQ ID No: 28-30. In some embodiments, the cell comprises six RTS. In some embodiments, at least one RTS is selected from SEQ ID No: 24-27. In some embodiments, cells comprising at least four different RTS include the following RTS: LoxP 511, Frt F5, Frt and LoxP. In some embodiments, cells comprising at least four different RTSs include the following RTSs: Frt F14 and Frt F15. In some embodiments, cells comprising at least four different RTSs include the following RTSs: LoxP 511, Frt F5, Frt, LoxP, Frt F14, and Frt F15. In some embodiments, cells comprising at least four different RTSs include the following RTSs: Frt 1, Frt 2, Frt 3, Frt 4. In some embodiments, cells comprising at least four different RTSs include the following RTSs: Frt m5, Frt wt, Frt m14, Frt m15, Frt m7, and Frt m6. In some embodiments, cells comprising six different RTSs include the following RTSs: Frt 1, Frt 2, Frt 3, Frt 4, Frt5, Frt 6. In some embodiments, the cells comprising at least four different RTSs include the following RTSs: Frt m5, Frt, Frtm14, Frt m15.

[0082] The term "landing pad" as used herein refers to a nucleic acid sequence contained in a first recombination target site integrated into a host cell on a chromosome. In some embodiments, the landing pad comprises two or more recombination target sites integrated into a host cell on a chromosome. In some embodiments, the cell comprises 1, 2, 3, 4, 5, 6, 7, or 8 landing pads. In some embodiments, the cell comprises 1, 2, or 3 landing pads. In some embodiments, the cell comprises 4 landing pads. In some embodiments, the landing pad is integrated into up to 1, 2, 3, 4, 5, 6, 7, or 8 different chromosomal loci. In some embodiments, the landing pad is integrated into up to 1, 2, or 3 different chromosomal loci. In some embodiments, the landing pad is integrated into 4 different chromosomal loci.

[0083] In some embodiments, the present disclosure describes how to express various proteins, such as DtE proteins, through different loci, it is possible to achieve desired protein expression. In some embodiments, the DtE protein is expressed from the NL1 locus, for example, located on a CHO chromosome. In some embodiments, the DtE protein is expressed from the NL2 locus, for example, located on a CHO chromosome.

[0084] In some embodiments, the cell comprises two different RTS. In some embodiments, the two different RTS are integrated in the NL1 locus on the chromosome. In some embodiments, the two different RTS are integrated in the NL2 locus on the chromosome. In some embodiments, the cell comprises four different RTS. In some embodiments, four different RTS are integrated in the same locus on the chromosome. In some embodiments, the two different RTS are integrated in the NL1 locus or the NL2 locus on the chromosome, and the two different RTS are integrated in a separate locus on the chromosome. In some embodiments, the separate locus is the Fer1L4 locus. In some embodiments, the two different RTS are integrated in the NL1 locus on the chromosome, and the two different RTS are integrated in the NL2 locus on the chromosome. In some embodiments, the cell comprises six different RTS. In some embodiments, at least four different RTS are integrated in the same locus on the chromosome. In some embodiments, at least two different RTS are integrated in the NL1 locus or the NL2 locus on the chromosome, and at least two different RTS are integrated in a separate locus on the chromosome. In some embodiments, the single locus is the Fer1L4 locus. In some embodiments, at least two different RTS are integrated on the chromosome in the NL1 locus, and at least two different RTS are integrated on the chromosome in the NL2 locus. In some embodiments, at least one of the RTS is a frt site, a lox site, a rox site or an att site. In some embodiments, at least one of the RTS is selected from SEQ ID No: 1-30.

[0085] Any of a variety of cells can be used according to the present disclosure. In some embodiments, the cells are mouse cells, human cells, Chinese hamster ovary (CHO) cells, CHO-K1 cells, CHO-DXB11 cells, CHO-DG44 cells, CHOK1SV including various variants. TM Cells (e.g., CHOK1SV TM Lonza of Slough, UK, including various variants of the CHOK1SV GS-KO TM(glutamine synthetase knockout) cells, including HEK293 cells of adhesion and suspension adaptation variants, HeLa cells, or HT1080 cells. In some embodiments, the mammalian cell comprises at least two different RTS, wherein the RTS is integrated in the NL1 locus, NL2 locus or Fer1L4 locus on the chromosome. In some embodiments, the mammalian cell comprises at least four different RTS, wherein two RTS are integrated in the NL1 locus or NL2 locus on the chromosome, and wherein two different RTS are integrated in a separate locus on the chromosome. In some embodiments, the separate locus is the Fer1L4 locus. In some embodiments, the mammalian cell comprises at least four different RTS, wherein two RTS are integrated in the NL1 locus on the chromosome, and two different RTS are integrated in the NL2 locus on the chromosome. In some embodiments, the mammalian cell comprises at least four different RTS, wherein four different RTS are integrated in the NL1 locus or NL2 locus on the chromosome. In some embodiments, the mammalian cell comprises at least six different RTS, two of which are integrated on the chromosome in the NL1 locus, two of which are integrated on the chromosome in the NL2 locus, and two of which are integrated on the chromosome in a separate locus. In some embodiments, the separate locus is the Fer1L4 locus. In some embodiments, the mammalian cell comprises at least six different RTS, six of which are integrated on the chromosome in the NL1 locus or the NL2 locus. In some embodiments, the mammalian cell comprises at least six different RTS, four of which are integrated on the chromosome in the NL1 locus or the NL2 locus, and two of which are integrated on the chromosome in a separate locus. In some embodiments, the second locus is the Fer1L4 locus.

[0086] In some embodiments, the cell comprises a first gene of interest, wherein the first gene of interest is integrated on a chromosome.

[0087] As used herein, the term "gene of interest" or "GOI" is used to describe a heterologous gene. As used herein, the term "heterologous gene" or "HG" when it refers to a nucleic acid sequence such as a coding sequence or a control sequence, refers to a nucleic acid sequence that is not normally joined together and / or is not normally associated with a particular cell, e.g., a gene. In some embodiments, a heterologous gene is a construct in which the coding sequence itself does not exist in nature (e.g., a synthetic sequence having codons that are different from those in the native gene). Allelic variation or naturally occurring mutational events do not produce heterologous DNA, as used herein.

[0088] In some embodiments, the gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, an auxiliary gene, or a combination thereof.

[0089] As used herein, a "reporter gene" is a gene whose expression confers a phenotype that can be easily identified and measured in a cell. In some embodiments, the reporter gene comprises a fluorescent protein gene. In some embodiments, the reporter gene comprises a selection gene.

[0090] As used herein, the term "selection gene" refers to the use of a gene encoding an enzyme activity that confers the ability to grow in a medium lacking what would otherwise be an essential nutrient; in addition, the selection gene confers resistance to antibiotics or drugs to cells in which the selection gene is expressed. Selection genes can be used to confer a specific phenotype on a host cell. When a host cell must express a selection gene to grow in a selective medium, the gene can be referred to as a positive selection gene. Selection genes can be used to select host cells that contain a specific gene; selection genes used in this manner are referred to as negative selection genes.

[0091] As used herein, the term "gene of therapeutic significance" refers to any functionally related nucleotide sequence. Therefore, the gene of therapeutic significance of the present disclosure may include any gene encoding such a protein, the expression of which is required for the preparation of therapeutic recombinant proteins. Representative (non-limiting) examples of suitable genes of therapeutic significance include monoclonal antibodies, bispecific monoclonal antibodies or antibody drug conjugates [including coagulation factors, well-expressed mAbs, where protein expression is restricted to transcription, hormones such as EPO, immune fusion proteins (Fc fusions), trispecific mAbs].

[0092] As used herein, the terms "ancillary gene" or "helper gene" are used interchangeably to refer to a first gene that assists in the expression of a second gene or assists in the stabilization, folding or post-transcriptional modification of a second gene product or creates a cellular environment that promotes the production of a second gene product. In some embodiments, the second gene is a gene encoding a DtE protein. In some embodiments, the ancillary gene encodes RNA. In some embodiments, the ancillary gene encodes mRNA, tRNA or miRNA. In some embodiments, the ancillary gene encodes a transcription factor, a molecular chaperone, a chaperone protein, a synthetase, an oxidase, a reductase, a glycotransferase, a protease, a kinase, a phosphatase, an acetyltransferase, a lipase or an alkylating enzyme.

[0093] In some embodiments, the first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, an auxiliary gene or a combination thereof. In some embodiments, the gene of therapeutic interest comprises a gene encoding a therapeutic protein that is well expressed at a desired copy number. In some embodiments, the gene encoding a well expressed therapeutic protein is at a copy number of 2 copies, 3 copies, 4 copies, 5 copies, 6 copies, 7 copies, 8 copies, 9 copies or 10 copies. In some embodiments, the gene of therapeutic interest comprises a gene encoding a DtE protein.

[0094] The term "difficult to express protein" as used herein refers to a protein that is difficult to produce. In some embodiments, the product of the DtE protein may be difficult because protein expression must be highly regulated. In some embodiments, the DtE protein is difficult to recover from the host cell. In some embodiments, the DtE protein is a protein that is prone to misfolding. In some embodiments, the DtE protein is a protein that is prone to shearing. In some embodiments, the DtE protein is a protein that is prone to degradation. In some embodiments, the DtE protein is a protein that is prone to aggregation. In some embodiments, the DtE protein is a protein with poor solubility. In some embodiments, the DtE protein is a membrane-bound protein. In some embodiments, the DtE protein is difficult to purify. In some embodiments, the DtE protein is cytotoxic. In some embodiments, the DtE protein comprises multiple polypeptide chains, for example, 2, 3 or 4 polypeptide chains. In some embodiments, the multiple polypeptide chains of the DtE protein form homo-oligomers to produce the DtE protein. In some embodiments, the multiple polypeptide chains of the DtE protein form hetero-oligomers to produce the DtE protein. In some embodiments, homo-oligomers or hetero-oligomers are formed by covalent interactions, non-covalent interactions, or a combination thereof. In some embodiments, the DtE protein comprises a protein that requires auxiliary gene expression to produce the DtE protein. In some embodiments, the DtE protein is a protein that requires post-transcriptional modification to produce the DtE protein. In some embodiments, a protein such as the DtE protein is expressed using standard techniques known to those of ordinary skill in the art of molecular biology, resulting in a product protein having various characteristics. In some embodiments, the DtE protein is a fusion protein.

[0095] For example, in some embodiments, the present disclosure describes how to express a DtE protein from the NL1 and / or NL2 loci, i.e., the DtE protein can be obtained at a protein production titer of more than 2 g / L. In some embodiments, expression of the DtE protein at the NL1 locus produces more than 2 g / L of the DtE protein. In some embodiments, expression of the DtE protein at the NL2 locus produces more than 2 g / L of the DtE protein. In some embodiments, the DtE protein is a protein that is expressed using standard techniques known to those of ordinary skill in the art of molecular biology techniques, resulting in a product protein titer of less than 2 g / L.

[0096] In some embodiments, the DtE protein is a monoclonal antibody. In some embodiments, the DtE protein is a bispecific monoclonal antibody. In some embodiments, the DtE protein is a trispecific monoclonal antibody. In some embodiments, the DtE protein is an Fc fusion protein. The term "Fc fusion protein" as used herein refers to a fusion protein in which the immunoglobulin Fc domain is operably linked to a second peptide. In some embodiments, the DtE protein is an enzyme. In some embodiments, the DtE protein is a membrane receptor. In some embodiments, the DtE protein is a bispecific T cell engager ( Micromet AG, Munich, Germany).

[0097] In some embodiments, the DtE protein is selected from: an Fc fusion protein, an enzyme, a membrane receptor, or a monoclonal antibody. In some embodiments, the monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody.

[0098] In some embodiments, the DtE protein is encoded by one or more genes of interest. In some embodiments, the first gene of interest is located between two RTSs.

[0099] The term "being located between two RTS" as described herein refers to a gene being located between two RTS, i.e., one RTS being located at the 5' of the gene and a different RTS being located at the 3' of the gene. In certain embodiments, the RTS is directly located near the gene being located between them. In certain embodiments, the RTS is located at a distance defined by the gene being located between them. In some embodiments, the RTS is a directional sequence. In some embodiments, the RTS 5' and 3' of the gene being located between them are directly oriented (i.e., they face the same direction). In some embodiments, the RTS 5' and 3' of the gene being located between them are reverse oriented (i.e., they face opposite directions).

[0100] In some embodiments, the first gene of interest is located within the NL1 locus. In some embodiments, the cell comprises a second gene of interest, wherein the second gene of interest is integrated on a chromosome. In some embodiments, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, an auxiliary gene, or a combination thereof. In some embodiments, the gene of therapeutic interest comprises a gene encoding a DtE protein. In some embodiments, the DtE protein is selected from: an Fc fusion protein, an enzyme, a membrane receptor, a bispecific T cell engager or monoclonal antibodies. In some embodiments, the second gene of interest is located between two RTSs. In some embodiments, the second gene of interest is located within the NL1 locus or the NL2 locus. In some embodiments, the first gene of interest is located within the NL1 locus, and the second gene of interest is located within the NL2 locus. In some embodiments, the cell comprises a third gene of interest, wherein the third gene of interest is integrated on a chromosome. In some embodiments, the third gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene, or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the third gene of interest is located between two RTSs. In some embodiments, the third gene of interest is located within the NL1 locus or the NL2 locus. In some embodiments, the third gene of interest is located at a locus different from the NL1 locus and the NL2 locus. In some embodiments, the first gene of interest, the second gene of interest, and the third gene of interest are located in three separate loci. In some embodiments, at least one of the first gene of interest, the second gene of interest, and the third gene of interest is located within the NL1 locus, and at least one of the first gene, the second gene of interest, and the third gene of interest is located within the NL2 locus.

[0101] In some embodiments, the cell comprises a site-specific recombinase gene. In some embodiments, the site-specific recombinase gene is integrated on a chromosome.

[0102] In some embodiments, the present disclosure provides a mammalian cell comprising: (a) at least four different RTSs, wherein the cell comprises at least two different RTSs, which are integrated on the chromosome at the NL1 locus or the NL2 locus; (b) a first gene of interest, which is integrated between at least two RTSs of (a), wherein the first gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof; and (c) and a second gene of interest, which is integrated in a second chromosomal locus different from the locus of (a), wherein the second gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof.

[0103] In some embodiments, the present disclosure provides a mammalian cell comprising: (a) at least four different RTSs, wherein the cell comprises at least two different RTSs, which are chromosomally integrated within the Fer1L4 locus; (b) at least two different RTSs, which are chromosomally integrated within the NL1 locus or the NL2 locus; (c) a first gene of interest, which is chromosomally integrated within the Fer1L4 locus, wherein the first gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof; and (d) a second gene of interest, which is chromosomally integrated within the NL1 locus or the NL2 locus of (b), wherein the second gene of interest comprises a reporter gene, a gene encoding a DtE protein, an auxiliary gene or a combination thereof.

[0104] In some embodiments, the present disclosure provides a mammalian cell comprising at least six different RTSs, wherein the cell comprises (a) at least two different RTSs and a first gene of interest, which are chromosomally integrated within the Fer1L4 locus; (b) at least two different RTSs and a second gene of interest, which are chromosomally integrated within the NL1 locus; and (c) at least two different RTSs and a third gene of interest, which are chromosomally integrated within the NL2 locus.

[0105] In some embodiments, the present disclosure provides a method for producing a recombinant protein producer cell, comprising (a) providing a cell comprising at least four different RTSs and a gene encoding a site-specific recombinase, wherein at least two different RTSs are integrated on the chromosome within the NL1 locus and at least two different RTSs are integrated on the chromosome within the NL2 locus; (b) transfecting the cell of (a) with a first vector and a second vector, wherein the first vector comprises an exchangeable cassette encoding a first gene of interest and the second vector comprises an exchangeable cassette encoding a second gene of interest; (c) integrating the first exchangeable cassette into the NL1 locus and integrating the second exchangeable cassette into the NL2 locus; and (d) selecting a recombinant protein producer cell comprising the first exchangeable cassette and the second exchangeable cassette integrated into the chromosome.

[0106] As used herein, "transfection" refers to the introduction of exogenous nucleic acid molecules, including vectors, into cells. "Transfected" cells contain exogenous nucleic acid molecules in the cell and "transfected" cells are cells in which the exogenous nucleic acid molecules in the cell induce phenotypic changes in the cell. Transfected nucleic acid molecules can be integrated into the genomic DNA of the host cell and / or can be temporarily maintained or maintained for a long time by the cell outside the chromosome. Host cells or organisms that express exogenous nucleic acid molecules or fragments are called "recombinant", "transformed" or "transgenic" organisms. Many transfection techniques are well known in the art. See, for example, Graham et al., Virology, 52: 456 (1973); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier (1986); and Chu et al., Gene 13: 197 (1981). Such techniques can be used to introduce one or more exogenous DNA moieties into a suitable host cell.

[0107] The term "matching" refers to two sequences with the ability to be bound by a recombinase and to affect site-specific recombination between the two sequences with respect to two RTS sequences. In some embodiments, an exchangeable cassette RTS that matches a cell RTS refers to a cassette RTS with a sequence substantially identical to that of a cell RTS. In some embodiments, an exchangeable cassette comprises a sequence substantially identical to one or two RTSs integrated into the host cell genome on a chromosome.

[0108] In some embodiments, the term integration refers to the integration (e.g., insertion) of the exchangeable box into the chromosome. In some embodiments, the integration is mediated by a site-specific recombinase. In some embodiments, the inventors have found that the use of SSI eliminates the need to clone cells from those transfected cells because the cells are homologous in their genetic makeup.

[0109] In some embodiments, the term "selection" refers to identifying cells containing a chromosomally integrated marker. In some embodiments, selection is by detecting the presence of a marker using methods known to those skilled in the art. In some embodiments, selection is by detecting the absence of a marker using methods known to those skilled in the art.

[0110] In some embodiments, the first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, an auxiliary gene, or a combination thereof. In some embodiments, the gene of therapeutic interest comprises a gene encoding a DtE protein. In some embodiments, the DtE protein comprises an Fc fusion protein, an enzyme, a membrane receptor, a bispecific T cell engager, or a combination thereof. Or monoclonal antibodies. In some embodiments, the monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody. In some embodiments, the first gene of interest is located between two RTS. In some embodiments, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the second gene of interest is located between two RTS.

[0111] In some embodiments, the present disclosure provides a method for producing a recombinant protein producer cell, comprising (a) providing a cell comprising at least four different RTS and a gene encoding a site-specific recombinase, wherein at least two different RTS are integrated on the chromosome within the Fer1L4 locus, and at least two different RTS are integrated on the chromosome within the NL1 locus or the NL2 locus; (b) transfecting the cell of (a) with a first vector and a second vector, wherein the first vector comprises an interchangeable cassette encoding a first gene of interest, and the second vector comprises an interchangeable cassette encoding a second gene of interest; (c) integrating the first interchangeable cassette into the Fer1L4 locus and integrating the second interchangeable cassette into the NL1 locus or the NL2 locus; and (d) selecting a recombinant protein producer cell comprising the first interchangeable cassette and the second interchangeable cassette integrated into the chromosome. In some embodiments, the first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, an auxiliary gene, or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the DtE protein is composed of an Fc fusion protein, an enzyme, a membrane receptor, a bispecific T cell engager, Or monoclonal antibodies. In some embodiments, the monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody. In some embodiments, the first gene of interest is located between two RTS. In some embodiments, the second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, an auxiliary gene or a combination thereof. In some embodiments, the gene of therapeutic significance comprises a gene encoding a DtE protein. In some embodiments, the second gene of interest is located between two RTS.

[0112] In some embodiments, the present disclosure provides a method for producing a recombinant protein producer cell, which comprises (a) providing a cell comprising at least six different RTSs and a gene encoding a site-specific recombinase, wherein at least two different RTSs are integrated into the Fer1L4 locus on the chromosome, and at least two different RTSs are integrated into the NL1 locus on the chromosome, and at least two different RTSs are integrated into the NL2 locus on the chromosome; (b) transfecting the cell of (a) with a first vector, a second vector, and a third vector, wherein the first vector comprises an interchangeable cassette encoding a first gene of interest, the second vector comprises an interchangeable cassette encoding a second gene of interest, and the third vector comprises an interchangeable cassette encoding a third gene of interest; (c) integrating the first interchangeable cassette into the Fer1L4 locus, the second interchangeable cassette into the NL1 locus, and the third interchangeable cassette into the NL2 locus; and (d) selecting a recombinant protein producer cell comprising the first interchangeable cassette, the second interchangeable cassette, and the third interchangeable cassette integrated into the chromosome.

[0113] In some embodiments, the inventors have found that the use of SSI to prepare rP expressing cells ensures that the library of rP expressing cells is homogeneous in its genetic composition. In some embodiments, the inventors have found that the use of SSI to prepare rP expressing cells ensures that the library of rP expressing cells is uniform in its efficiency. In some embodiments, the inventors have found that the use of SSI to prepare rP expressing cells ensures that the library of producer cells is uniform in the ratio of the first auxiliary gene to the second auxiliary gene. In some embodiments, the inventors have found that the use of SSI to prepare rP expressing cells ensures that the library of producer cells is uniform in the ratio of auxiliary genes to genes of therapeutic significance. In some embodiments, the inventors have found that the use of SSI to prepare rP expressing cells ensures a more consistent rP product quality.

[0114] The cell lines described herein, including prokaryotic and / or eukaryotic cell lines, can be cultured using any suitable apparatus, device, and method described herein. In addition, in some embodiments, the apparatus, device, and method are suitable for culturing suspension cells or anchorage-dependent (adherent) cells and are suitable for being configured to produce pharmaceutical or biopharmaceutical products such as polypeptide products, nucleic acid products (e.g., DNA or RNA), or mammalian or microbial cells and / or viruses such as those used in cell and / or viral and microbial therapy.

[0115] In some embodiments, the cell expresses or produces a product, such as a recombinant therapeutic or diagnostic product. As described in more detail below, the example of the product produced by the cell includes but is not limited to an antibody molecule (e.g., monoclonal antibody, bispecific antibody), an antibody mimic (a polypeptide molecule that specifically binds an antigen, but an antigen that is structurally unrelated to an antibody such as a DARP element, an affibody, an adnectin or an IgNAR), a fusion protein (e.g., an Fc fusion protein, a chimeric cytokine), or other recombinant proteins (e.g., glycosylated proteins, enzymes, hormones), viral therapy (e.g., viral vectors of gene therapy and viral immunotherapy, anticancer oncolytic cells), cell therapy (e.g., pluripotent stem cells, mesenchymal stem cells and adult stem cells), a vaccine or a lipid-encapsulated particle (e.g., an exosome, a virus-like particle), RNA (e.g., siRNA) or DNA (e.g., plasmid DNA), an antibiotic or an amino acid. In an embodiment, the device, equipment and method can be used to produce a biosimilar.

[0116] As described, in embodiments, the devices, apparatus and methods allow for the production of eukaryotic cells, e.g., mammalian cells or lower eukaryotic cells, such as yeast cells or filamentous fungal cells, or prokaryotic cells, such as Gram-positive or Gram-negative cells and / or products of eukaryotic or prokaryotic cells, e.g., proteins, peptides, antibiotics, amino acids, nucleic acids (such as DNA or RNA), synthesized by eukaryotic cells in a large-scale manner. In some embodiments, the use of microbial organisms and spores thereof for use in microbial therapy is also disclosed. Unless otherwise specified herein, the devices, apparatus and methods may include any volume or production capacity, including, but not limited to, laboratory scale, pilot scale and full production scale capabilities.

[0117] In addition, unless otherwise specified herein, the apparatus, equipment and method may include any suitable reactor or bioreactor, including but not limited to, stirred tank, air transport, fiber, microfiber, hollow fiber, ceramic matrix, fluidized bed, fixed bed and / or spouted bed bioreactor. "Reactor" or "bioreactor" as used herein may include a fermentor or fermentation unit, or any other reaction vessel, and the terms "reactor" and "fermentor" may be used interchangeably. The terms fermentor or fermentation refer to microorganisms and mammalian cultures. For example, in some aspects, an exemplary bioreactor unit may perform one or more or all of the following: feeding of nutrients and / or carbon sources, injection of suitable gases (e.g., oxygen), inlet and outlet flows of fermentation or cell culture media, separation of gas and liquid phases, maintaining temperature, maintaining oxygen and CO2 levels, maintaining pH levels, stirring (e.g., mixing) and / or cleaning / disinfection. Exemplary reactor unit, such as fermentation unit, can comprise multiple reactors in unit, for example, unit can have 1,2,3,4,5,10,15,20,25,30,35,40,45,50,60,70,80,90 or 100 or more bioreactors in each unit, and / or equipment can be included in multiple units with single or multiple reactors in equipment.In various embodiments, bioreactor can be applicable to batch, half batch, batch feeding, perfusion and / or continuous fermentation process.Can adopt any suitable reactor.In embodiments, bioreactor can have the volume of about 100mL to about 50,000L. Non-limiting examples include 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, 550 liters, 1,000 liters, 15,000 liters, 20,000 liters, and / or 50,000 liters. In addition, suitable reactors can be multiple use, single use, disposable or non-disposable, and can be formed of any suitable material, including metal alloys, such as stainless steel (e.g., 316L or any other suitable stainless steel) and Inconel, plastic and / or glass.

[0118] In embodiments and unless otherwise specified herein, devices, equipment and methods as described herein may also include any suitable unit operations and / or equipment not mentioned otherwise, such as operations and / or equipment for separating, purifying and / or separating these products. Any suitable equipment and environment may be used, such as traditional paste-up equipment, modular, mobile and temporary equipment, or any other suitable structure, equipment and / or layout. For example, in some embodiments, modular clean rooms may be used. In addition, and unless otherwise specified, devices, systems and methods as described herein may be packaged in a single location or equipment and / or carried out therein, or may be packaged in separate or multiple locations and / or equipment and / or carried out therein.

[0119] As non-limiting examples and without limitation, U.S. Patent Publication Nos. 2013 / 0280797; 2012 / 0077429; 2011 / 0280797; 2009 / 0305626; and U.S. Patent Nos. 8,298,054; 7,629,167; and 5,656,491 describe exemplary devices, apparatuses and / or systems that may be suitable, which are incorporated herein by reference in their entireties.

[0120] In an embodiment, the cell is a eukaryotic cell, for example, a mammalian cell. The mammalian cell can be, for example, a human or rodent or bovine cell line or cell strain. Examples of such cells, cell lines or cell strains are, for example, mouse myeloma (e.g., NS0 or SP2 / 0 cell lines), Chinese hamster ovary (CHO) cell lines, HT1080, H9, HepG2, MCF7, MDBKJurkat, NIH3T3, PC12, BHK (baby hamster kidney cells), VERO, YB2 / 0, Y0, C127, L cells, COS, for example, COS1 and COS7, QC1-3, HEK-293, VERO, PER.C6, HeLa, EB1, EB2, EB3, oncolytic cells or hybridoma cell lines. Preferably, the mammalian cell is a CHO cell line. In one embodiment, the cell is a CHO cell. In one embodiment, the cell is a CHO-K1 cell, a CHO-K1 SV cell, a DG44 CHO cell, a DUXB11 CHO cell, a CHOS, a CHO GS knockout cell, a CHOFUT8GS knockout cell, a CHOZN or a cell derived from CHO. A CHO GS knockout cell (e.g., a GSKO cell) is, for example, a CHOK1SV TM GS knockout cells (CHOK1SV GS-KO TM ). CHO FUT8 knockout cells are, for example, CHOK1SV TM (Lonza Biologics, Inc.). The eukaryotic cell may also be an avian cell, cell line or cell strain, for example, cells, EB14, EB24, EB26, EB66 or EBvl3.

[0121] In some embodiments, the eukaryotic cell is a stem cell. For example, the stem cell can be a pluripotent stem cell, including embryonic stem cells (ESC), adult stem cells, induced pluripotent stem cells (iPSC), tissue-specific stem cells (e.g., hematopoietic stem cells) and mesenchymal stem cells (MSC).

[0122] In one embodiment, the cell is a differentiated form of any cell described herein. In one embodiment, the cell is a cell derived from any primary cell in culture. In some embodiments, the cell is not derived from a stem cell. For example, in some embodiments, cells (e.g., lymphocytes) for immunotherapy are extracted or separated from individual patients or from established cell banks. In some embodiments, cells may include genetically manipulated cells (i.e., CAR-T, etc.).

[0123] In an embodiment, the cell is a hepatocyte, such as a human hepatocyte, an animal hepatocyte, or a non-parenchymal cell. For example, the cell can be a plateable metabolically qualified human hepatocyte, a plateable induced qualified human hepatocyte, a plateable Qualyst Transporter Certified TM Human hepatocytes, suspension qualified human hepatocytes (including 10 donors and 20 donors pooled hepatocytes), human liver Kupffer cells, human hepatic stellate cells, dog hepatocytes (including single and pooled Beagle hepatocytes), mouse hepatocytes (including CD-1 and C57BI / 6 hepatocytes), rat hepatocytes (including Sprague-Dawley, Wistar Han and Wistar hepatocytes), monkey hepatocytes (including Cynomolgus or Rhesus monkey hepatocytes), cat hepatocytes (including short-haired domestic cat hepatocytes) and rabbit hepatocytes (including New Zealand white rabbit hepatocytes). Exemplary hepatocytes are commercially available from Triangle Research Labs, LLC, 6 Research Triangle Park, Davis Drive, North Carolina, 27709, USA.

[0124] In one embodiment, the eukaryotic cell is a lower eukaryotic cell, e.g., a yeast cell (e.g., a Pichia spp. (e.g., Pichia pastoris, Pichia methanolica, Pichia kluyveri, and Pichia angusta), a Komagataella spp. (e.g., Komagataella pastoris, Komagataella pseudopastoris, or Komagataella phaffii), a yeast

[0125] The yeast may be a yeast of the genus Saccharomyces (e.g., Saccharomyces cerevisiae, Saccharomyces kluyveri, Saccharomyces uvarum), a yeast of the genus Kluyveromyces (e.g., Kluyveromyces lactis, Kluyveromyces marxianus), a yeast of the genus Candida (e.g., Candida utilis, Candida cacaoi, Candida boidinii), a yeast of the genus Geotrichum (e.g., Geotrichum fermentans), Hansenula polymorpha, Yarrowia lipolytica, or Schizosaccharomyces pombe. pombe). Preferred is the species Pichia pastoris. Examples of Pichia pastoris strains are X33, GS115, KM71, KM71H; and CBS7435.

[0126] In one embodiment, the eukaryotic cell is a fungal cell (e.g., Aspergillus (e.g., A. niger, A. fumigatus, A. orzyae, A. nidula), Acremonium (e.g., A. thermophilum), Chaetomium (e.g., C. thermophilum), Chrysosporium (e.g., Chrysosporium (such as C.thermophile), Cordyceps (such as C.militaris), Corynascus, Ctenomyces, Fusarium (such as F.oxysporum), Glomerella (such as G.graminicola), Meat Sealing Fungus ( Hypocrea (such as H.jecorina), Magnaporthe (such as M.orzyae), Myceliophthora (such as M.thermophile), Nectria (such as N.heamatococca), Neurospora (such as N.crassa), Penicillium (such as N. cillium, Sporotrichum (e.g., S. thermophile), Thielavia (e.g., T. terrestris, T. heterothallica), Trichoderma (e.g., T. reesei), or Verticillium (e.g., V. dahlia).

[0127] In one embodiment, the eukaryotic cell is an insect cell (e.g., Sf9, Mimic TM Sf9, Sf21, High Five TM

[00136] The present invention relates to a cell comprising a monocotyledonous plant (e.g., a BT1-TN-5B1-4, a BT1-TN-5B1-4, a BT1-Ea88 cell), an algal cell (e.g., an Amphora, a Bacillariophyceae, a Dunaliella, a Chlorella, a Chlamydomonas, a Cyanophyta (cyanobacteria), a Nannochloropsis, a Spirulina, or an Ochromonas), or a plant cell (e.g., from a monocotyledonous plant (e.g., corn, rice, wheat, or Setaria), or from a dicotyledonous plant (e.g., cassava, potato, soybean, tomato, tobacco, alfalfa, Physcomitrella patens, or Arabidopsis).

[0128] In one embodiment, the cell is a bacterium or a prokaryotic cell. In some embodiments, the prokaryotic cell is a gram-positive cell, such as Bacillus, Streptococcus, Staphylococcus, or Lactobacillus. The Bacillus that can be used is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus natto, or Bacillus megaterium. In an embodiment, the cell is Bacillus subtilis, such as Bacillus subtilis 3NA and Bacillus subtilis 168. Bacillus can be obtained from, for example, Bacillus Genetic Stock Center, 556 Biosciences, 484 West 12th Avenue, Columbus, Ohio 43210-1214.

[0129] In one embodiment, the prokaryotic cell is a Gram-negative cell, such as Salmonella spp. or Escherichia coli, such as, for example, TG1, TG2, W3110, DH1, DHB4, DH5a, HMS174, HMS174 (DE3), NM533, C600, HB101, JM109, MC4100, XL1-Blue and Origami, and those derived from E. coli B strains, such as BL-21 or BL21 (DE3), all of which are commercially available. Suitable host cells are commercially available, for example, from culture collections such as DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Brunswick, Germany) or American Type Culture Collection.

[0130] (ATCC). In some embodiments, the cells include other microbial groups used as therapeutic agents. They include microbial groups belonging to Firmicutes, Bacteroidetes, Proteobacteria, Verrumicrobia, Actinobacteria, Fusobacteria, and Fusobacteria that are present in the human microbiome. The microbial group may include aerobic, strictly anaerobic, or facultative anaerobic, including cells or spores. The therapeutic microbial group may also include genetically modified organisms and vectors modified using them. Other microbiome-related therapeutic organisms may include: archaea, fungi, and viruses. See, e.g., The Human Microbiome Project Consortium. Nature 486, 207–214 (June 14, 2012); Weinstock, Nature, 489(7415): 250–256 (2012); Lloyd-Price, Genome Medicine 8: 51 (2016).

[0131] In some embodiments, the cultured cells are used to produce proteins, e.g., antibodies, e.g., monoclonal antibodies, and / or recombinant proteins, for therapeutic use. In embodiments, the cultured cells produce peptides, amino acids, fatty acids, or other useful biochemical intermediates or metabolites. For example, in embodiments, molecules having a molecular weight of about 4000 daltons to greater than about 140,000 daltons can be produced. In embodiments, these molecules can have a range of complexity and can include post-translational modifications, including glycosylation.

[0132] In embodiments, the protein is, e.g., BOTOX, botulinum toxin, Neurobloc, Dysport (or other botulinum neurotoxin serotypes), alglucosidase alpha, daptomycin, YH-16, chorionic gonadotropin alfa, filgrastim, cetrorelix, interleukin-2, aldesleukin, teceleulin, denileukindiftitox, interferon alpha-n3 (injection), interferon alpha-nl, DL-8234, interferon, Suntory (gamma-1a), interferon gamma, thymosin alpha 1, tasonermin, DigiFab, ViperaTAb, EchiTAb, CroFab nesiritide, abatacept, alefacept, Rebif, eptoterminalfa, teriparatide (osteoporosis), calcitonin injectable (bone disease), calcitonin (nasal injection, osteoporosis), etanercept, hemoglobin glutamate 250 (cattle), drotrecogin alpha, collagenase, carperitide, recombinant human epidermal growth factor (topical gel, wound healing), DWP401, darbepoetin alpha alpha, epoetin omega, epoetin beta, epoetin alpha, desirudin, lepirudin, bivalirudin, nonacog alpha, Mononine, eptacog alpha (activated), recombinant factor VIII + VWF, recombinate, recombinant factor VIII, factor VIII (recombinant), Alphnmate, octocog alpha alpha), factor VIII, palifermin, indikinase, tenecteplase, alteplase, pamiteplase, reteplase, nateplase, monteplase,follitropin alpha, rFSH, hpFSH, micafungin, pegfilgrastim, lenograstim, nartograstim, sermorelin, glucagon, exenatide, pramlintide, iniglucerase, galsulfase, leucotropin, molgramostirn, triptorelin acetate acetate, histrelin (Hydron subcutaneous implant), deslorelin, histrelin, nafarelin, leuprolide extended-release reservoir (ATRIGEL), leuprolide implant (DUROS), goserelin, Eutropin, KP-102 program, growth hormone, mecasermin (growth failure), enlfavirtide, ORG-33408, insulin glargine, insulin glutamate, insulin (inhaled), insulin lispro, insulin detemir (insulin deternir, insulin (oral, RapidMist), mecaserminrinfabate, anakinra, celmoleukin, 99mTc-apreceptor injection, myelopid, Betaseron, glatiramer acetate, Gepon, sargramostim, oprelvekin, human leukocyte-derived interferon alpha, Bilive, insulin (recombinant), recombinant human insulin, insulin aspart, mecasenin, Roferon-A, interferon-alpha 2, Alfaferone, interferon alpha-1, interferon alpha, Avonex recombinant human luteinizing hormone, dornase alfa alpha), trafermin, ziconotide, taltirelin, diboterminalfa, atosiban,becaplermin, eptifibatide, Zemaira, CTC-111, Shanvac-B, HPV vaccine (quadrivalent), octreotide, lanreotide, ancestirn, agalsidase beta, agalsidase alfa, laronidase, prezatide copper acetate (topical gel), rasburicase, ranibizumab, Actimmune, PEG-Intron, Tricomin, recombinant house dust mite allergy desensitization injection, recombinant human parathyroid hormone (PTH) 1-84 (sc, osteoporosis), epoetin delta (epoetin delta, transgenic antithrombin III, Granditropin, hyaluronidase (Vitrase), recombinant insulin, interferon-alpha (oral lozenge), GEM-21S, vapreotide, idursulfase, omnapatrilat, recombinant serum albumin, certolizumab pegol, glucarpidase, human recombinant C1 esterase inhibitor (angioedema), lanoteplase, recombinant human growth hormone, enfuvirtide (needle-free injection, Biojector 2000), VGV-1, interferon (alpha), lucinactant, aviptadil (inhalation, lung disease), icatibant, ecallantide, omiganan, Aurograb, pexiganan acetate acetate), ADI-PEG-20, LDI-200, degarelix, cintredelinbesudotox, Favld, MDX-1379, ISAtx-247, liraglutide, teriparatide (osteoporosis), tifacogin, AA4500, T4N5 liposomal emulsion, catumaxomab, DWP413, ART-123, Chrysalin, desmoteplase, amediplase,corifollitropin alpha, TH-9507, teduglutide, Diamyd, DWP-412, growth hormone (sustained-release injection), recombinant G-CSF, insulin (inhaled, air), insulin (inhaled, technology), insulin (inhaled, AERx), RGN-303, DIAPEP277, interferon beta (hepatitis C virus infection (HCV)), interferon alpha-n3 (oral), belatacept, transdermal insulin patch, AMG-531, MBP-8298, Xerecept, opebacan, AIDSVAX, GV-1001, LymphoScan, ranpirnase, Lipoxysan, lusupultide , MP52 (β-triphosphate carrier, bone regeneration), melanoma vaccine, sipuleucel-T, CTP-37, Insegia, vitespen, human thrombin (freezing, surgical bleeding), thrombin, TransMID, alfimeprase, Puricase, terlipressin (intravenous, hepatorenal syndrome), EUR-1008M, recombinant FGF-I (injectable, vascular disease), BDM-E, rotigaptide, ETC-216, P-113, MBI-594AN, duramycin (inhaled, cystic fibrosis), SCV-07, OPI-45, endostatin, angiostatin, ABT-510, Bowman Birk inhibitor concentrate, XMP-629, 99mTc-Hynic-Annexin V, kahalalide F, CTCE-9908, teverelix (extended release), ozarelix, rornidepsin, BAY-504798, interleukin-4, PRX-321, Pepscan, iboctadekin, rhlactoferrin, TRU-015, IL-21, ATN-161, cilengitide, Albuferon, Biphasix, IRX-2, omega interferon, PCK-3145, CAP-232, pasireotide, huN901-DMI, ovarian cancer immunotherapy vaccine,SB-249553, Oncovax-CL, OncoVax-P, BLP-25, CerVax-16, multi-epitope peptide melanoma vaccine (MART-1, GP100, tyrosinase), nemifitide, rAAT (inhaled), rAAT (dermatology), CGRP (inhaled, asthma), pegsunercept, thymosin beta 4, plitidepsin, GTP-200, ramoplanin, GRASPA, OBI-1, AC-100, salmon calcitonin (oral, eligen), calcitonin (oral, osteoporosis), examorelin, capromorelin, Cardeva, velaferm in), 131I-TM-601, KK-220, T-10, ularitide, depelestat, hematide, chrysalin (topical), rNAPc2, recombinant factor V111 (PEGylated liposomes), bFGF, PEGylated recombinant staphylococcal kinase variant, V-10153, sonolysine prourokinase (SonoLysis Prolyse), NeuroVax, CZEN-002, islet cell regeneration therapy, rGLP-1, BIM-51077, LY-548806, exenatide (controlled release, Medisorb), AVE-0010, GA-GCB, avorelin, ACM-9604, linaclotide acetate (linaclotide acetate) eacetate), CETI-1, Hemospan, VAL (injectable), rapid-acting insulin (injectable, Viadel), intranasal insulin, insulin (inhaled), insulin (oral, Elligen), recombinant human leptin, pitrakinra (subcutaneous injection, eczema), pitrakinra (inhaled dry powder, asthma), multikine, RG-1068, MM-093, NBI-6024, AT-001, PI-0824, ORG -39141, Cpn10 (autoimmune diseases / inflammation), talactoferrin (topical), rEV-131 (ophthalmology), rEV-131 (respiratory diseases), oral recombinant human insulin (diabetes), RPI-78M, oprelvekin (oral), CYT-99007 CTLA4-Ig, DTY-001, valategrast, interferon alpha-n3 (topical), IRX-3, RDP-58,Tauferon, bile salt-stimulated lipase, merispase, alanine phosphatase, EP-2104R, melanotan-II, bremelanotide, ATL-104, recombinant human microplasmin, AX-200, SEMAX, ACV-1, Xen-2174, CJC-1008, dynorphin A, SI-6603, LAB GHRH, AER-002, BGC-728, Malaria vaccine (Virosome, PeviPRO), ALTU-135, Parvovirus B19 vaccine, Influenza vaccine (recombinant neuraminidase), Malaria / HBV vaccine, Anthrax vaccine, VACC-5Q, VACC-4X, HIV vaccine (oral), HPV vaccine, Tat toxoid, YSPSL, CHS-13340, PTH (1-34) liposome cream (Novasome), Ostabolin-C, PTH analog (topical, psoriasis), MBRI -93.02, MTB72F vaccine (tuberculosis), MVA-Ag85A vaccine (tuberculosis), FARA04, BA-210, recombinant plague FIV vaccine, AG-702, OxSODrol, rBetV1, Der-p1 / Der-p2 / Der-p7 allergen targeted vaccine (dust mite allergy), PR1 peptide antigen (leukemia), mutant ras vaccine, HPV-16E7 lipopeptide vaccine, labyrinthin vaccine (adenocarcinoma), CML vaccine, WT1-peptide vaccine (cancer), IDD-5, CDX-110, Pengqu Pentrys, Norelin, CytoFab, P-9808, VT-111, icrocaptide, telbermin (dermatology, diabetic foot ulcer), rupintrivir, reticulose, rGRF, HA, α-galactosidase A, ACE-011, ALTU-140, CGX-1160, angiotensin therapeutic vaccine, d-4F, ETC-642, APP-018, rhMB L, SCV-07 (oral, tuberculosis), DRF-7295, ABT-828, ErbB2-specific immunotoxin (anticancer), DT3SSIL-3, TST-10088, PRO-1762, Combotox, cholecystokinin-B / gastrin receptor binding peptide, 111In-hEGF, AE-37, trastuzumab-DM1, antagonist G, IL-12 (recombinant), PM-02734, IMP-321, rhIGF-BP3, BLX-883, CUV-1647 (topical),L-19-based radioimmunotherapy (cancer), Re-188-P-2045, AMG-386, DC / 1540 / KLH vaccine (cancer), VX-001, AVE-9633, AC-9301, NY-ESO-1 vaccine (peptide), NA17.A2 peptide, melanoma vaccine (pulse antigen therapy), prostate cancer vaccine, CBP-501, recombinant human lactoferrin (dry eye), FX-06, AP-214, WAP-8294A (injectable), ACP-HIP, SUN-11031, peptide YY[3-36] (obesity, intranasal), FGLL, atacicept, BR3-Fc, BN-003, B A-058, human parathyroid hormone 1-34 (nasal, osteoporosis), F-18-CCR1, AT-1100 (celiac disease / diabetes), JPD-003, PTH (7-34) liposome cream (Novasome), natriumin (ophthalmic, dry eye), CAB-2, CTCE-0214, GlycoPEGylated erythropoietin, EPO-Fc, CNTO-528, AMG-114, JR-013, factor XIII, aminocandin, PN-951, 716155, SUN-E7001, TH-0318, BAY-73-7977, teverelix (immediate release), EP- 51216, hGH (controlled release, biosphere), OGP-I, sifuvirtide, TV4710, ALG-889, ORG-41259, rhCC10, F-991, thymopentin (lung disease), r(m)CRP, liver-selective insulin, subalin, L19-IL-2 fusion protein, elafin, NMK-150, ALTU-139, EN-122004, thrombopoietin, thrombopoietin receptor agonist (thrombocytopenia), AL-108, AL-208, nerve growth factor antagonist (pain), SLV-317, CGX-1007, INNO-105, oral Teriparatide (eligen), GEM-OS1, AC-162352, PRX-302, LFn-p24 fusion vaccine (Therapore), EP-1043, pneumococcal pediatric vaccine, malaria vaccine, Neisseria meningitidis group B vaccine, neonatal group B streptococcal vaccine, anthrax vaccine, HCV vaccine (gpE1+gpE2+MF-59), otitis media treatment, HCV vaccine (core antigen+ISCOMATRIX), hPTH (1-34) (transdermal, ViaDerm), 768974, SYN-101, PGN-0052, aviscumine, BIM-23190, tuberculosis vaccine,Multi-epitope tyrosinase peptides, cancer vaccines, enkastim, APC-8024, GI-5005, ACC-001, TTS-CD3, vascular-targeted TNF (solid tumors), desmopressin (oral controlled release), onercept, and TP-9201.

[0133] In some embodiments, the polypeptide is adalimumab (HUMIRA), infliximab (REMICADE TM ), rituximab (RITUXAN TM / MABTHERA TM )etanercept (ENBREL TM ), bevacizumab (AVASTIN TM ), trastuzumab (HERCEPTIN TM ), pegrilgrastim (NEULASTA TM ), or any other suitable polypeptide, including biosimilars and biobetters.

[0134] Other suitable polypeptides are listed in Table 6 below and in Table 1 of US2016 / 0097074. It will be appreciated by those skilled in the art that the disclosure of the present invention also includes combinations of products and / or conjugates as described herein [i.e., multiproteins, modified proteins (coupled with PEG, toxins, other active ingredients)].

[0135] Table 6

[0136]

[0137]

[0138]

[0139] In an embodiment, the polypeptide is a hormone, a blood coagulation / clotting factor, a cytokine / growth factor, an antibody molecule, a fusion protein, a protein vaccine or a peptide as shown in Table 7.

[0140] Table 7. Exemplary products

[0141]

[0142]

[0143] In an embodiment, the protein is a multispecific protein, e.g., a bispecific antibody, as shown in Table 8.

[0144] Table 8: Bispecific formats

[0145]

[0146]

[0147]

[0148]

[0149]

[0150] Example

[0151] Example 1: Identification of highly expressed and stable loci

[0152] Screening of 400 GS-CHOK1 SVs producing monoclonal antibodies (mAbs) using random integration constructs TM The cloned cell lines (Lonza, Barcelona, ​​Switzerland) that met the following criteria: high q mAb (>1.25 pg / cell-hour), stable productivity (≥70 generations) and adequate growth (IVCC>1500 x 10 6 Cells / mL cells, μ~0.03 hours -1 Most of these cells were derived from two public Lonsard projects (Porter et al., Cell Culture and Tissue Engineering 26:1455-1464 (2010) and Povey et al., J Biotechnol 184:84-93 (2014)) and were used to construct GS-CHOK1SV TM The process of cloning cell lines is described in detail in Porter et al., 2010. Briefly, a PvuI-linearized Lonza glutamine synthetase (GS) expression vector encoding mAb was introduced into the host cell line CHOK1SV using standard electroporation methods. TM The transfection mixture was distributed in 80 96-well plates. The next day, fresh medium was added to the cell suspension in the plate; the concentration of methionine sulfoximine (MSX) in the medium was such that the final MSX concentration in each well was 50 μM. As the colony biomass increased, the cell lines were cultured in static 24-well plates and then in a static 25 cm 2 Cell lines are grown in T-flasks. Suspension cultures are made by mixing 25 cm 2 T-flask start-up and expansion for 10 L fed-batch bioreactor cultivation and cryopreservation.

[0153] The lowest passage number ampoules of these 20 cell lines were cultured to mid-exponential culture phase and analyzed for integrated vector copy number using qPCR (primer / probe set for β-lactamase gene). Five cell lines (964E7, 952C8, 2A6, E22 and E14) identified as meeting the copy number criteria (≤5 β-lactamase copies per genome) were sampled for flanking sequence identification.

[0154] Genomic DNA (gDNA) extracts were prepared from cells derived from the five cell lines described above and sequence capture analysis was performed. NimbleGen SeqCap targeted enrichment (Roche NimbleGen, Inc., Madison, USA) was performed on fragmented gDNA derived from recombinant cell lines using baits designed for regions within the glutamine synthase (GS) expression vector carrying the mAb gene. Eluted target enrichments were pooled and analyzed by Illumina (Next Gen Sequencing, Illumina, San Diego, CA, USA) sequencing. The same five cell lines were analyzed by whole genome resequencing (WGRS) (BGI, Tai Po, Hong Kong, China), and two selected cell lines (964E7 and 952C8) were analyzed using targeted locus amplification (TLA) (Cergentis BV, The Netherlands) to validate the results of targeted sequencing and WGRS.

[0155] Bioinformatics analysis of sequencing readings is carried out. Sequencing data will be captured and mapped to genome and vector sequences. Split readings (half from genome, half from vector) are used to identify potential integration sites and breakpoints. In addition, the reading pairs (one end is located at genome, one end is located at vector) indicating that the vector inserts are also identified to provide supporting evidence for the integration site. The list of potential integration sites is identified by sequence capture data, and the sites are sorted by supporting evidence. WGRS data are mapped to all potential integration sites to provide additional supporting evidence. The WGRS readings mapped across the breakpoints and the reading pairs covering the breakpoints are counted as positive support. For each integration site, left (L) and right (R) are used to refer to the position of the genomic sequence (always 5' to 3' according to gray hamster (Cricetulus griseus) scaffold and overlapping group sequence). On the left or right side, the vector is inserted with forward (F) or reverse (R). Data for cell lines 964E7 and 952C8 were followed by targeted sequencing with proximity ligation at Cergentis (Utrecht, The Netherlands), see, e.g., de Vree et al., Nat Biotechnol. 32: 1019-25 (2014).

[0156] The integration site is verified by the PCR amplification of the genome: vector border across all 5 kinds of clones. Table 9 summarizes the discovery of these integration sites, and the beta-lactamase gene copy number, productivity and growth data of these recombinant cell lines. In 5 kinds of clones, 6 sites (new locus 1-6 (NL1-6)) were confirmed by PCR, wherein 3 were confirmed (NL1, NL2 and NL4) by the PCR across two genome vector borders, and wherein 3 were only confirmed (NL3, NL5 and NL6) at one of the borders.

[0157] Table 9

[0158]

[0159] Because the derivative cell lines 964E7 and 952C8 had similar integrated β-lactamase copies as the other 3 cell lines, but achieved higher specific productivity (47-48 pg / cell-day), suggesting that these regions support higher recombinant gene expression, loci NL1 and NL2 developed SSI landing pad integrations. TM The loci were selected in the recombinant cell lines generated in the derivative hosts and the GS selection marker was used (see Stage 2 describing the RMCE steps) to ensure that the loci were compatible with the GS-based expression system. These loci have been shown to support stable recombinant gene expression (qP: 23-48 pg / cell-day) without negatively affecting processes important for growth (IVCC: 2039-6015×10 6 cells / hour mL).

[0160] Example 2: Engineering landing pads to selected combinations of loci.

[0161] Integrate a landing pad suitable for subsequent RMCE into CHOK1SV GS-KO TM Host cell lines.

[0162] First, the landing pad (landing pad A: Figure 2 ) are integrated into Fer1L4 (see, for example, WO2013190032A1 and EP2711428A1) ( Figure 4 : clone 7878 and 8086, Figure 7 : clone 11434), NL1 ( Figure 4 : clones 8096 and 9113) and NL2 (clones 9116 and 9115) loci. Clone 11434 (landing pad in Fer1L4 locus, landing pad A) was selected: Figure 2 A) For engineering modification of the second landing pad at NL1 (landing pad B: Figure 2A). This decision was made based on the ability to complete RMCE when GS selection was used, the stability of RFP expression in the library during repeated subcultures, and the concentration of mAb secreted into the medium of the batch fed culture at harvest. We have successfully demonstrated the general possibility that either A or B type landing pads can enter any of the loci in Table 1. A total of 6 multi-site SSI clones were generated (12151, 12152, 12606, 12607, 12608, and 12609). These 2-site hosts have a landing pad in Fer1L4 containing an Hpt-eGFP fusion flanked by Frt F5 and wild-type Frt F RTS, and a second landing pad at site 2 containing a PAC-DsRed fusion gene flanked by Frt F14 and Frt F15 RTS (landing pad in NL1 locus, landing pad B: Figure 2 ). The location of the Frt site between the SV40E promoter and the selection marker will be used in subsequent rounds of RMCE.

[0163] Targeting CHOK1SV GS-KO TM Targeting vectors designed by RMCE in single and multiple landing pad hosts contain a GS cDNA placed 3' adjacent to an Frt site compatible with the landing pad of interest ( Figure 2 B). The remainder of the vector contains the transcription unit for the GOI (e.g., mAb), followed by a Frt site that is compatible with the second Frt site in the landing pad. Targeting vector DNA ( Figure 3 A) and the vector expressing FlpE recombinase ( Figure 3 B) Co-transfection (with a plasmid molar ratio of 1:9, respectively). The transfected cells were incubated for 24 hours in the presence of 6mM glutamine to allow transient expression of the FlpE recombinase. The transfectant pool was then washed and incubated in medium lacking glutamine. The viable cell concentration and culture viability were monitored throughout the selection process. The hallmark of successful RMCE is the loss of the Hpt-eGFP gene and its replacement by the GS gene in the targeting vector. All transfections included a no-FlpE control (a transfection without the targeting vector DNA of pMF4) to confirm that any recovery was the result of transient FlpE recombinase expression (RMCE). After successful RMCE, cells appeared dark under a fluorescence microscope or analyzed by flow cytometry. Due to the CHOK1SV GS-KO TMThe host lacks a functional endogenous GS gene, and those cells with GS in-target integration can grow in the absence of glutamine, and the culture viability is higher than 95% 12-14 days after transfection. Since the GS cDNA in the targeting vector lacks a promoter, the possibility of off-target integration of the GS gene is very low, which will result in sufficient GS protein mass to grow in the absence of glutamine. Selection by inhibiting endogenous enzyme activity may have off-target effects (e.g., MSX, see Feary et al., Biotechnol. Prog. (2016)), and therefore selection in the absence of metabolites such as glutamine is advantageous. This selection system is very strict, and the percentage of non-exchange cells 14 days after transfection (by the presence of GFP fluorescent markers) is generally about 2-5% and is easily removed by fluorescence-assisted cell sorting. If two sites are targeted by a vector, multiple Frt sites can be set as concatemers to simplify transfection.

[0164] Example 3: In CHOK1SV GS-KO TM Evaluation of the Fer1L4, NL1, and NL2 loci in SSI hosts

[0165] The Fer1L4, NL1, and NL2 loci were then tested for their ability to support recombinant gene expression and achieve RMCE. Figure 3 A) and the recombinase vector pMF4( Figure 3 B) Co-transfected into 6 CHOK1SV GS-KO TM ( Figure 4 : Fer1L4 locus: 7878 and 8086, NL1: 8096 and 9113, NL2: 9116 and 9115) single landing pad SSI host and incubated in glutamine-free medium to select cells with completed RMCE. These CHOK1SV GS-KO were analyzed by flow cytometry before RMCE and after 11 days in glutamine-free medium. TM SSI Library Figure 4 ). Due to the landing pad in the clone (landing pad A, Figure 2 ) contains the Hpt-eGFP reporter gene (detected in the green channel) and the pMF25 targeting vector contains the DsRed reporter gene (detected in the yellow channel), thus demonstrating the success of RMCE by the change from +GFP, -YFP to -GFP, +YFP fluorescence.

[0166] The SSI host clone 11434 (landing pad in the Fer1L4 locus, landing pad A) was then tested: Figure 2) ability to produce therapeutic mAbs. A vector containing the transcription unit of rituximab, cB72.3 and H31K5 was generated, which targets the Fer1L4 locus in clone 11434 (see Figure 5 ). Then construct CHOK1SV GS-KO TM The pool was cultured in batch suspension culture for 8 days. The concentration of secreted mAb at harvest was determined by protein A HPLC at harvest (see Figure 6 These data show very consistent expression between replicate pools and between different mAbs (250-300 mg / L).

[0167] Example 4: CHOK1SV GS-KO at multiple loci TM Evaluation of Fer1L4 and NL1 in SSI hosts

[0168] The six multisite hosts described in Example 2 were analyzed by flow cytometry to confirm the ability of the loci to support recombinant gene expression ( Figure 7 ). Landing pad integrated at the Fer1L4 locus ( Figure 2 : Landing pad A) contains the Hpt-eGFP gene, while the landing pad integrated at the NL1 locus ( Figure 2 : Landing pad B) contains PAC-DsRed gene. eGFP fluorescence is detected in the green channel and DsRed is detected in the yellow channel. CHOK1SV GS-KO TM Host (host) was used as a negative control. Clone 11434 (landing pad in the Fer1L4 locus, landing pad A: Figure 2 ) was used as a positive control for eGFP fluorescence. The CHOK1SV GS-KO expressing the DsRed gene generated by random integration (DsRed RI control) was TM The pool was used as a positive control for Dsred fluorescence. As expected, all 6 multi-locus CHOK1SV GS-KO TM The SSI clones (12151, 12152, 12606, 12607, 12608, and 12609) had similar eGFP and DsRed fluorescence intensities as 11434 and the DsRed RI control ( Figure 7 ). This indicates that both sites can support the expression of foreign genes. Next, the ability of the multi-site host to complete RMCE was confirmed. The targeting vector pCM9 ( Figure 8 A, contains the E2 crimson expression cassette and targets landing pad A: Fer1L4) and pCM11 ( Figure 8 B, A cassette containing the E2 crimson expression cassette and targeting landing pad A:NL1) was transfected into multiple sites of CHOK1SV GS-KO TMSSI host 12151. The pool was incubated in glutamine-free medium to select for cells with completed RMCE. The no FlpE control was not recovered with the RMCE pool. These CHOK1SV GS-KO were analyzed by flow cytometry before RMCE and after 14 days in glutamine-free medium. TM SSI Library Figure 8 ). Due to CHOK1SV GS-KO TM Landing Pad A in the SSI host (Landing Pad A, Figure 2 ) contains the Hpt-eGFP reporter gene and the pCM9 targeting vector contains the E2 deep red reporter gene (detected in the red channel), thus demonstrating the success of RMCE by the change from +GFP, -RFP to -GFP, +RFP fluorescence. CHOK1SV GS-KO TM Landing Pad B in the SSI host (Landing Pad B, Figure 2 ) contains the PAC-DsRed reporter gene, but no DsRed signal was detected on the flow cytometer ( Fig. 9 The pCM11 targeting vector contains the E2 crimson reporter gene and thus demonstrated the success of RMCE without losing landing pad A (containing the Hpt-eGFP gene) by changing from +GFP, -RFP to +GFP, +RFP ( Fig. 9 ).

[0169] To understand the benefits of a therapeutic protein system, CHOK1SV was tested TM SSI multisite host (see Figure 2 ) for the expression of the therapeutic proteins summarized in Table 10. The experiment was divided into three phases; Phase 1: Testing the application of multisite SSI to increase qP; Phase 2: Testing the ability of multisite SSI to express a tri-gene bispecific mAb on two landing pads; Phase 3: Expressing an auxiliary gene at one site to assist in the expression of the DtE protein encoded at another site.

[0170] Table 10

[0171]

[0172] Phase 1: A limitation of some single-site SSI systems is that a single copy of the required transcription unit is insufficient to produce a suitable titer for clinical manufacturing. Therefore, we evaluated the option of using multisite SSI to increase the integrated copy number of the mAb gene. Two approaches to increase the integrated copy number were tested using the monoclonal antibody rituximab. In the first approach, a targeting vector was generated that contained four mAb expression cassettes ( Fig.10 B: pCM38 = 2×HC and 2LC) and targeting in CHOK1SVGS-KO TMLanding Pad A in the SSI host (Landing Pad A, Figure 2 A). This vector and two mAb expression cassettes are combined into one vector ( Fig.10 A: pMF26) were transfected separately (in duplicate) into GS-KO SSI host clone 12151 ( Fig.10 A and B), and the library was selected in glutamine-free medium (see Example 2 for detailed transfection method). In the second method, in addition to the targeted landing pad B (landing pad B, Figure 2 A targeting vector containing two mAb expression cassettes in addition to the neomycin phosphotransferase gene (NEO) Fig.10 C and D: pAR5 = 1×HC and 1×LC). A version of pAR5 lacking the mAb gene was also generated and designated pCM22 ( Fig.10 C) CHOK1SV GS-KO TM The SSI library was transfected with pMF26 and selected in glutamine-free medium, and then with pAR5( Fig.10 D) or pCM22 ( Fig.10 C) transfection (duplicate) (see Example 2 for detailed transfection method), in pMF4 ( Figure 3 B) were incubated for 24 hours in the presence of 400 μg / mL geneticin (G418) and then selected in 400 μg / mL geneticin (G418). Consistent with the selection in glutamine-free medium, the no-FlpE control cultured in the presence of G418 was not recovered with the RMCE library. After recovery from the selection, the 8 RMCE libraries were subcultured and then batch cultured for 8 days. The viable cell concentration was determined on days 4, 6 and 8 using a Vicell cell counter, and the concentration of secreted mAb at harvest was determined by a ForteBio Octet using a protein A sensor. The cell-specific productivity of rituximab (qmAb at harvest) was calculated (see Fig.11 These data suggest that both conditions are caused by CHOK1SV GS-KO TM SSI hosts are a viable option for improving cell-specific mAb productivity.

[0173] Phase 2: For most next-generation antibodies (e.g., tetravalent bispecific antibodies), the assembly of multiple heavy or light chains is a recurring problem. In order to obtain the best product quality with very few unwanted byproducts, it is beneficial to select suitable CHO clones that express up to 4 antibody chains in a stable and reproducible manner. Therefore, a large amount of product analysis using ELISA, RP-HPLC or CD-SDS is usually required during clone selection. However, in multi-site SSI cell lines, genes encoding multi-chain proteins are driven by separate promoters and spatially separated at at least two sites. This ensures that the copy number and relative expression of individual chains are consistent as early as in the transfectant library, and the empirical fine-tuning of the availability of each polypeptide chain can be achieved by manipulation of the promoter strength or copy number of the encoding transcription unit. The benefit of this is that the product quality is more consistent, the proportion of misfolded multi-chain recombinant proteins produced by SSI-generated libraries and cell lines is reduced, and the need for early evaluation is significantly circumvented. Therefore, we evaluated the opportunity to use multisite SSI to express the chromatin leukocyte antigen (CL) encoded by the following three genes: LC, HC, and HC-IL2 (Klein et al., Oncoimmunology 6:3 (2017)). We tested the insertion of these three genes into the CHOK1SV GS-KO TM Two approaches to SSI host genome. In this experiment (Phase 2), the mouse cytomegalovirus first early gene (IE1) (mCMV) promoter (EP 1525320) with human intron A (Addison et al., Journal of General Virology, 78 (1997)) was used instead of the hCMV promoter to drive expression of recombinant protein. In the first approach, we inserted the chromatin LC, HC and HC-IL2 into landing pad A ( Fig.12 A). Selection was performed in the absence of glutamine as described in Example 2. In a second approach, pAB5 ( Fig.12 B) Transfection of CHOK1SV GS-KO TM SSI host, the pAB5 contains targeting landing pad A ( Figure 2 ) of the expression units of the chromoglucoside monoclonal antibody amuna leukocyte antigen LC and HC-IL2. Selection was performed in the absence of glutamine as described in Example 2. We then generated such a targeting vector comprising a single chromoglucoside monoclonal antibody amuna leukocyte antigen HC expression cassette ( Fig.12 C: pAR2) and targeting landing pad B (landing pad B, Figure 2 A) containing the neomycin phosphotransferase selectable marker gene (NEO). A version of pAR2 lacking the mAb gene was also generated and designated pCM46 ( Fig.12 B: pCM46). CHOK1SV GS-KO TM The SSI library was transfected with pAB5 and selected in glutamine-free medium, then transfected with pCM46 or pAR2 (in duplicate) (see Example 2 for detailed transfection methods) and selected in medium containing 400 μg / mL Geneticin (G418). A control library was also constructed: a "mock" transfection was performed with an empty form of pAR2, and three libraries were used to identify CEA-IL2v antibody species, each of which lacked one of the three genes encoding the chromatin amuletin (LC+HC, LC+HC-IL2, and HC+HC-IL2). After recovery from the selection, the RMCE library was subcultured and then batch cultured for 8 days. The viable cell concentration was determined on days 4, 6, and 8 using a Vicell cell counter. The supernatant was analyzed by non-reducing on a 10% Bis-Tris SDS PAGE gel ( Fig.13 A) and subsequent densitometric analysis (ImageJ software) ( Fig.13 B) Determination of the types of chromatin assemblies. These data show that when the chromatin LC, HC, and HC-IL2 genes were inserted into landing pad A, low expression of individual chains and only a small amount of products considered to be fully assembled can be seen. In contrast, when the chromatin LC and HC-IL2 were targeted to landing pad A and the HC was targeted to landing pad B, expression of individual chains increased and more completely assembled products were detected. The reproducibility of this result (in replicate libraries) supports the opportunity to use a multi-site SSI approach to adjust the relative amounts of each chain to improve product quality. The genes required for bispecific assembly have been separated at two sites (and not filled at the second site) and show improved expression.

[0174] Phase 3: Aims to increase CHOK1SV GS-KO TM Expression of endogenous proteins that are secretory in cell lines has proven to be a reliable method to increase product potency. Candidates identified in PCT application WO2015018703A1 and those in Tables 10, 11, and 12 were evaluated in multisite SSI cell lines. To test this concept, a vector expressing etanercept targeting landing pad A was constructed ( Fig.14 A, B and C: pTC1). The vector was transfected into CHOK1SV GS-KO cells (in duplicate). TM In the SSI host ( Fig.14 ), and the library was selected in glutamine-free medium (see Example 2 for detailed transfection method).

[0175] pCM39-pCM45 contain expression units for auxiliary genes under the control of the human cytomegalovirus major immediate early (hCMV) promoter (with its first intron A) and targeted to landing pad B ( Fig.14 )(Tables 11 and 12). In pCM39-42, variants of stearoyl-CoA desaturase-1 (Scd1) and sterol regulatory element binding protein 1 (SREBF1) were targeted to the NL1 locus. In pCM43, 44 and 45, a short-lived GFP (or dsGFP) with a c-terminal PEST sequence (SEQ ID NO:38) from sequence gb:CQ871827 was constructed, and 6 copies of the miR target sequence were inserted into the 3'UTR of CPEB2A (pCM43), CEPB2B (pCM44) and SRPα (pCM45). These targeting vectors contain the neomycin phosphotransferase gene (NEO) and selection was achieved 24 hours after transfection (with pMF4) of each vector into a library transfected with duplicate pTC01, using medium supplemented with 400 μg / mL G418. After successful recovery of the library and at least one subculture, 8 batches of cultures were established. Viable cell concentrations were determined on days 4, 6, and 8 using a Vicell cell counter, and secreted mAb concentrations at harvest were determined by ForteBio Octet using a protein A sensor. The integral of the viable cell concentration (IVCC), cell-specific productivity (qP at harvest), and secreted etanercept concentrations are provided (see Fig.15 ). These data demonstrated that expression of mouse SCD1 (mSCD1) and sponge vectors with CEPB2A (dsGFP_6n CPEB2A), CPEB2B (dsGFP_6n CPEB2B), and SRPα (dsGFP_6n SRPα) miR binding sites in the 3'UTR increased the amount of secreted etanercept.

[0176] Table 11

[0177]

[0178] Table 12

[0179]

[0180] Example 5: Gene locus transfer between CHOK1SV and HEK293 cell lines

[0181] To generate the HEK293 SSI host, a BLAT search of CHOK1SV-derived vector integration sites and landing pad locations was performed using an independent copy of the University of California Santa Cruz (UCSC) human genome database against the human genome (version: March 2006 (NCBI36 / hg18). This identified sequences with 95% (and higher) similarity within at least 25 base pairs of the CHOK1SV sequence. Regions of similarity were displayed in the IGV viewer (Broad institute version 2.4). Crispr-Cas9 gRNAs were designed using an in-house Crispr-Cas9 design tool. The CHOK1SV and HEK293 loci are summarized in Table 1.

Claims

1. A hamster cell comprising at least two different recombination target sites, wherein the two recombination target sites are integrated into the chromosome within the NL1 locus or the NL2 locus, wherein the NL1 locus corresponds to within 10,000 base pairs of position 133,598 of the sequence of Cricetulus griseus NW_003615899.1, and the NL2 locus corresponds to within 10,000 base pairs of position 1313,999 of the sequence of Cricetulus griseus NW_003613834.

1.

2. The cell of claim 1, comprising two different recombination target sites.

3. The cell of claim 2, wherein the two different recombination target sites are chromosomally integrated within the NL1 locus.

4. The cell of claim 1, wherein the two different recombination target sites are chromosomally integrated within the NL2 locus.

5. The cell of claim 1, comprising four different recombination target sites.

6. The cell according to claim 5, wherein The four different recombination target sites are integrated at the same locus on the chromosome.

7. The cell according to claim 5, wherein The two recombination target sites are integrated at separate loci on the chromosome.

8. The cell according to claim 7, wherein The separate locus is the Fer1L4 locus.

9. The cell according to claim 5, wherein Two different recombination target sites are chromosomally integrated within the NL1 locus, and two different recombination target sites are chromosomally integrated within the NL2 locus.

10. The cell of claim 1, comprising six different recombination target sites.

11. The cell according to claim 10, wherein At least four different recombination target sites are integrated at the same locus on the chromosome.

12. The cell according to claim 10, wherein At least two recombination target sites are integrated at separate loci on the chromosome.

13. The cell according to claim 12, wherein The separate locus is the Fer1L4 locus.

14. The cell according to claim 10, wherein At least two different recombination target sites are chromosomally integrated within the NL1 locus, and at least two different recombination target sites are chromosomally integrated within the NL2 locus.

15. The cell according to claim 1, wherein At least one of the recombination target sites is an frt site, a lox site, a rox site or an att site.

16. The cell of claim 1, wherein At least one of the recombination target sites is selected from SEQ ID NOs: 1-30.

17. The cell of claim 1, wherein The hamster cells are Chinese hamster ovary (CHO) cells.

18. The cell according to claim 17, wherein The CHO cells are CHO-K1 cells, CHO-DXB11 cells, CHO-DG44 cells, including various variants of CHOK1SV TM cells, including various variants of CHOK1SV GS-KO TM (glutamine synthetase knockout) cells.

19. The cell of claim 1, further comprising a first gene of interest, wherein The first gene of interest is integrated on the chromosome.

20. The cell of claim 19, wherein The first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, or a combination thereof.

21. The cell of claim 20, wherein The gene of therapeutic significance comprises Fc fusion protein, enzyme, membrane receptor or monoclonal antibody.

22. The cell of claim 21, wherein The monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody.

23. The cell of claim 19, wherein The first gene of interest is located between two recombination target sites.

24. The cell of claim 19, wherein The first gene of interest is located within the NL2 locus.

25. The cell of claim 1, further comprising a second gene of interest, wherein The second gene of interest is integrated on the chromosome.

26. The cell of claim 25, wherein The second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, or a combination thereof.

27. The cell of claim 26, wherein The genes of therapeutic significance include genes encoding Fc fusion proteins, enzymes, membrane receptors or monoclonal antibodies.

28. The cell of claim 25, wherein The second gene of interest is located between the two recombination target sites.

29. The cell of claim 25, wherein The second gene of interest is located within the NL1 locus or the NL2 locus.

30. The cell of claim 25, wherein The first gene of interest is located within the NL1 locus, and the second gene of interest is located within the NL2 locus.

31. The cell of claim 1, further comprising a third gene of interest, wherein The third gene of interest is integrated on the chromosome.

32. The cell of claim 31, wherein The third gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic significance, or a combination thereof.

33. The cell of claim 31, wherein The third gene of interest is located between the two recombination target sites.

34. The cell of claim 31, wherein The third gene of interest is located within the NL1 locus or the NL2 locus.

35. The cell of claim 31, wherein The third gene of interest is located in a locus different from the NL1 locus and the NL2 locus.

36. The cell of claim 31, wherein The first gene of interest, the second gene of interest, and the third gene of interest are located in three separate loci.

37. The cell of claim 31, wherein a. at least one of the first gene of interest, the second gene of interest and the third gene of interest is located within the NL1 locus, and b. At least one of the first gene of interest, the second gene of interest, and the third gene of interest is located within the NL2 locus.

38. The cell of claim 1, further comprising a site-specific recombinase gene.

39. The cell of claim 38, wherein The site-specific recombinase gene is integrated into the chromosome.

40. A hamster cell comprising at least four different recombination target sites, wherein: The cell comprises: a. at least two different recombination target sites, which are integrated on the chromosome within the NL1 locus or the NL2 locus, wherein the NL1 locus corresponds to within 10,000 base pairs of position 133,598 of the sequence of Cricetulus griseus NW_003615899.1, and the NL2 locus corresponds to within 10,000 base pairs of position 1313,999 of the sequence of Cricetulus griseus NW_003613834.1; b. a first gene of interest, which is integrated between at least two recombination target sites of (a), wherein the first gene of interest comprises a reporter gene, a gene encoding a protein that is difficult to express, or a combination thereof; and c. A second gene of interest, which is integrated into a second chromosomal locus different from the locus of (a), wherein the second gene of interest comprises a reporter gene, a gene encoding a protein that is difficult to express, or a combination thereof.

41. A hamster cell comprising at least four different recombination target sites, wherein: The cell comprises: a. at least two different recombination target sites, which are integrated into the Fer1L4 locus on the chromosome; b. at least two different recombination target sites, which are integrated on the chromosome within the NL1 locus or the NL2 locus, wherein the NL1 locus corresponds to within 10,000 base pairs of position 133,598 of the sequence of Cricetulus griseus NW_003615899.1, and the NL2 locus corresponds to within 10,000 base pairs of position 1313,999 of the sequence of Cricetulus griseus NW_003613834.1; c. a first gene of interest, which is integrated into the Fer1L4 locus on a chromosome, wherein the first gene of interest comprises a reporter gene, a gene encoding a protein that is difficult to express, or a combination thereof; and d. A second gene of interest, which is integrated on the chromosome into the NL1 locus or the NL2 locus of (b), wherein the second gene of interest comprises a reporter gene, a gene encoding a protein that is difficult to express, or a combination thereof.

42. A hamster cell comprising at least six different recombination target sites, wherein: The cell comprises: a. at least two different recombination target sites and a first gene of interest, which is integrated into the Fer1L4 locus on the chromosome; b. at least two different recombination target sites and a second gene of interest, which are integrated on the chromosome within the NL1 locus, wherein the NL1 locus corresponds to within 10,000 base pairs of position 133,598 of the sequence of Cricetulus griseus NW_003615899.1; and c. at least two recombination target sites and a third gene of interest, which are integrated on the chromosome within the NL2 locus, and the NL2 locus corresponds to within 10,000 base pairs of position 1,313,999 of the sequence of Cricetulus griseus NW_003613834.

1.

43. A method for producing a recombinant protein producer cell, comprising: a. providing a hamster cell comprising at least four different recombination target sites and a gene encoding a site-specific recombinase, wherein at least two different recombination target sites are integrated on the chromosome within the NL1 locus and at least two different recombination target sites are integrated on the chromosome within the NL2 locus, wherein the NL1 locus corresponds to within 10,000 base pairs of position 133,598 of the sequence of Cricetulus griseus NW_003615899.1, and the NL2 locus corresponds to within 10,000 base pairs of position 1313,999 of the sequence of Cricetulus griseus NW_003613834.1; b. transfecting the cell of (a) with a first vector and a second vector, wherein the first vector comprises an exchangeable cassette encoding a first gene of interest and the second vector comprises an exchangeable cassette encoding a second gene of interest; c. integrating a first exchangeable cassette into the NL1 locus and integrating a second exchangeable cassette into the NL2 locus; and d. selecting a recombinant protein producer cell comprising the first exchangeable cassette and the second exchangeable cassette integrated into the chromosome.

44. The method of claim 43, wherein: The first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, or a combination thereof.

45. The method of claim 44, wherein: The genes of therapeutic significance include genes encoding Fc fusion proteins, enzymes, membrane receptors or monoclonal antibodies.

46. ​​The method of claim 45, wherein: The monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody.

47. The method of claim 43, wherein: The first gene of interest is located between two recombination target sites.

48. The method of claim 43, wherein: The second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, or a combination thereof.

49. The method of claim 43, wherein: The second gene of interest is located between the two recombination target sites.

50. A method for producing a recombinant protein producer cell, comprising: a. providing a hamster cell comprising at least four different recombination target sites and a gene encoding a site-specific recombinase, wherein at least two different recombination target sites are integrated on the chromosome within the Fer1L4 locus and at least two different recombination target sites are integrated on the chromosome within the NL1 locus or the NL2 locus, wherein the NL1 locus corresponds to within 10,000 base pairs of position 133,598 of the sequence of Cricetulus griseus NW_003615899.1, and the NL2 locus corresponds to within 10,000 base pairs of position 1313,999 of the sequence of Cricetulus griseus NW_003613834.1; b. transfecting the cell of (a) with a first vector and a second vector, wherein the first vector comprises an exchangeable cassette encoding a first gene of interest and the second vector comprises an exchangeable cassette encoding a second gene of interest; c. integrating the first exchangeable cassette into the Fer1L4 locus and integrating the second exchangeable cassette into the NL1 locus or the NL2 locus; and d. selecting a recombinant protein producer cell comprising the first exchangeable cassette and the second exchangeable cassette integrated into the chromosome.

51. The method of claim 50, wherein: The first gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, or a combination thereof.

52. The method of claim 51, wherein: The genes of therapeutic significance include genes encoding Fc fusion proteins, enzymes, membrane receptors or monoclonal antibodies.

53. The method of claim 52, wherein: The monoclonal antibody is a bispecific monoclonal antibody or a trispecific monoclonal antibody.

54. The method of claim 51, wherein: The first gene of interest is located between two recombination target sites.

55. The method of claim 51, wherein: The second gene of interest comprises a reporter gene, a selection gene, a gene of therapeutic interest, or a combination thereof.

56. The method of claim 51, wherein: The second gene of interest is located between the two recombination target sites.

57. A method for producing a recombinant protein producer cell, comprising: a. providing a hamster cell comprising at least six different recombination target sites and a gene encoding a site-specific recombinase, wherein at least two different recombination target sites are integrated on the chromosome within the Fer1L4 locus, at least two different recombination target sites are integrated on the chromosome within the NL1 locus, and at least two different recombination target sites are integrated on the chromosome within the NL2 locus, wherein the NL1 locus corresponds to within 10,000 base pairs of position 133,598 of the sequence of Cricetulus griseus NW_003615899.1, and the NL2 locus corresponds to within 10,000 base pairs of position 1313,999 of the sequence of Cricetulus griseus NW_003613834.1; b. transfecting the cell of (a) with a first vector, a second vector and a third vector, wherein the first vector comprises an exchangeable cassette encoding a first gene of interest, the second vector comprises an exchangeable cassette encoding a second gene of interest, and the third vector comprises an exchangeable cassette encoding a third gene of interest; c. integrating a first exchangeable cassette into the Fer1L4 locus, integrating a second exchangeable cassette into the NL1 locus, and integrating a third exchangeable cassette into the NL2 locus; and Recombinant protein producer cells are selected that contain the first, second and third exchangeable cassettes integrated into the chromosome.

Images