Geranylgeranyl diphosphate synthase gene as well as encoding protein and application thereof

Abstract

The invention discloses a geranyl geranyl diphosphate synthase gene as well as an encoding protein and an application thereof, and relates to an application of a PpatGGPPS1 protein and an encoding gene thereof in metabolism of phyll and carotenoid of physcion. The nucleotide sequence of the gene is shown as Seq ID No: 1 in a sequence table. The amino acid sequence of the gene is shown as Seq ID No: 2 in a sequence table. Gene transcriptional coding geranylgeranyl diphosphate synthase PpatGGPPS1 can synthesize geranylgeranyl diphosphate, so that pigments such as chlorophyll and carotene can be synthesized in the acidichrocephalum leptosphaerens, the gene can be used in acidichrocephalum leptosphaerens terpene substance metabolism genetic engineering, and accumulation of beta-carotene and terpene substances in the acidichrocephalum leptosphaerens is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to the application of a geranylgeranyl diphosphate synthase gene PpatGGPPS1 and a protein encoded therein in chlorophyll metabolism and carotenoid metabolism of Physcomitrella patens. Background Art

[0002] Physcomitrella patens belongs to the genus Physcomitrella of the family Cucurbitaceae. It is distributed in Europe, Asia, Africa and Oceania. It is one of the earliest higher plants to land and occupies a special position in the plant evolutionary tree (Rensing et al., 2020). Physcomitrella patens was discovered about 40 years ago. Since then, it has become an important object of plant phylogenetic research. It is also the first non-seed plant to be sequenced, and its genome information is public and complete (Rensing et al., 2008); foreign genes can be successfully transferred into the genome of Physcomitrella patens by homologous recombination, and mature genetic transformation methods have been established around it (Strepp et al., 1998); in addition, Physcomitrella patens also has important advantages such as a short reproductive cycle (Cove et al., 1997), and is an important model organism in molecular biology research. Research around it covers many directions and fields such as plant hormones, plant nutrition, plant topography, and plant photosensitivity (Rensing et al., 2020). Since Physcomitrella patens is the earliest non-vascular plant to land, its habitat is different from that of primitive aquatic plants and later evolved higher plants, and Physcomitrella patens has a unique light protection system (Alessandro Alboresia, 2010).

[0003] During photosynthesis, plants need to cope with the ever-changing light intensity. During the evolution process, they develop light protection mechanisms to cope with fluctuating light, especially high light. When plants perform photosynthesis, the light-harvesting pigment protein complex of photosystem II absorbs light energy with the help of photosensitive pigments such as chlorophyll and carotene and transfers the energy to the light reaction center to provide energy for photosynthesis. In this process, the excess energy is quenched by carotenoids (Ostroumov et al., 2014). Studies on the photoprotection mechanism of Physcomitrella patens have found that it not only has the energy quenching mechanism of green algae that depends on LHCSR, but also has the energy quenching mechanism of higher plants that depends on NPQ. Studies on the two mechanisms have shown that either of them can meet the needs of plants for quenching residual light energy. The coexistence of the two mechanisms reveals the evolution of the light protection mechanism of plants during the landing process. Among them, the NPQ mechanism is closely related to the xanthophyll cycle in carotenoids (Gerotto et al., 2012).

[0004] Geranylgeranyl diphosphate (GGPP) is the product of geranylgeranyl diphosphate synthase (GGPPS), which supplies multiple primary and secondary metabolite streams in plants, including carotenoids and their derivatives (abscisic acid, strigolactones), chlorophyll, tocopherol, gibberellins, plastoquinones and other important terpenoids (Tholl, 2015). The functions of the GGPPS family have been identified in important crops such as peppers, tomatoes, rice, and tobacco. A series of genetic experiments conducted around them have confirmed that GGPPS is involved in the synthesis of photosynthetic pigments such as chlorophyll and carotene in plants in vivo (Zhou et al., 2017; Wang et al., 2018; Zhou and Pichersky, 2020). In the higher model plant Arabidopsis, the functions of the GGPPS family have also been annotated in detail. Researchers have found that although there are 12 GGPPS homologous proteins in Arabidopsis, only one of them plays a major role in GGPP synthesis, and it interacts at the physical level with downstream proteins related to carotene synthesis (Ruiz-Sola et al., 2016). In snapdragon, mint, and lavender, it was found that GGPPS is also closely related to the synthesis of plant volatiles, and can be applied to the genetic improvement of volatile-related crops (Orlova et al., 2009; Adal and Mahmoud, 2020); Several multifunctional GGPPS were identified in gymnosperms such as Abies grandiflora, which can simultaneously synthesize geranyl diphosphate (GPP), the precursor of volatile monoterpenes, and GGPP (Schmidt et al., 2010). The research progress of plant GGPPS shows that the functional research of GGPPS in non-seed terrestrial plants is blank. The functional research of Physcomitrella patens GGPPS can not only provide a basis for the research related to pigment metabolism, but also has the application prospect of crop genetic improvement. Summary of the invention

[0005] Purpose of the invention: In order to overcome the deficiencies in the prior art, the present invention provides a geranylgeranyl diphosphate synthase gene and its encoded protein and application. The gene transcription encodes geranylgeranyl diphosphate synthase PpatGGPPS1, which can synthesize geranylgeranyl diphosphate, thereby enabling the synthesis of pigments such as chlorophyll and carotene in Physcomitrella patens.

[0006] Technical solution: To achieve the above purpose, the technical solution adopted by the present invention is:

[0007] A geranylgeranyl diphosphate synthase gene PpatGGPPS1, whose nucleotide sequence is shown in Seq ID No: 1 in the sequence table.

[0008] A protein encoded by a geranylgeranyl diphosphate synthase gene, the amino acid sequence of which is shown in Seq ID No: 2 in the sequence table.

[0009] The geranylgeranyl diphosphate synthase gene of the present invention is derived from Physcomitrella patens and is named PpatGGPPS1. Hereinafter, the gene is referred to as PpatGGPPS1.

[0010] A recombinant expression vector comprises a geranylgeranyl diphosphate synthase gene.

[0011] A transformant comprises a host cell containing a recombinant expression vector.

[0012] The host of the transformant is a microorganism, a plant or a transgenic cell line.

[0013] A method for obtaining a geranylgeranyl diphosphate synthase gene PpatGGPPS1 comprises the following steps:

[0014] Step 1. Extraction of total RNA

[0015] Total RNA of Physcomitrella patens was extracted using RNAiso kit (Takara), and the integrity and concentration of RNA were confirmed by UV spectrophotometer.

[0016] Step 2, cloning of the Physcomitrella patens geranylgeranyl diphosphate synthase gene (PpatGGPPS1) and construction of an expression vector.

[0017] 1 μg of total RNA obtained in step 1 was used as a reverse transcription template. According to the instructions of PrimeScript 1st Strand cDNA Synthesis Kit (Takara), after the first strand of cDNA was synthesized by reverse transcription, PCR amplification was performed using the forward transcription PCR program to obtain the full-length ORF of the geranylgeranyl diphosphate synthase gene PpatGGPPS1. At this time, the geranylgeranyl diphosphate synthase gene PpatGGPPS1 has pMAL-c5x homology arms, wherein:

[0018] The F-terminal primers are as follows:

[0019] gcggccgcgatatcgtcgac ATGGGTTCAACAGTGGTCTCATACA

[0020] The R-terminal primers are as follows:

[0021] taattacctgcagggaattc CTAATTCTGCCTGTAAGCGATGTAG

[0022] Among them, lowercase letters represent homology arm sequences, and uppercase letters are the sequences of genes used as primers.

[0023] Step 3, the gene fragment of the geranylgeranyl diphosphate synthase gene PpatGGPPS1 with the pMAL-c5x homology arm is homologously recombined according to the operating instructions of the ClonExpress II One Step Cloning Kit (Vazyme), and after sequencing and splicing, the geranylgeranyl diphosphate synthase gene PpatGGPPS1 with a complete coding region is obtained. The nucleotide sequence of the geranylgeranyl diphosphate synthase gene PpatGGPPS1 is shown in the sequence table SeqID No: 1.

[0024] Step 4, enzyme activity determination

[0025] The enzymatic activity of the geranylgeranyl diphosphate synthase gene PpatGGPPS1 of Physcomitrella patens was identified using the Escherichia coli pigment system. Escherichia coli can synthesize the substrate of geranylgeranyl diphosphate synthase, but cannot convert it into geranylgeranyl diphosphate; in addition, the pigment system uses the plasmid pAC-94N, which carries the phytoene synthase (CrtB, PSY), phytoene desaturase (CrtI, PDS / ZDS) and lycopene cyclase (CrtY, LCYB) of the Erwinia β-carotene metabolic pathway, but does not include the gene encoding GGPPS. Introducing the GGPP substrate into this system can make the Escherichia coli colonies or bacterial liquid appear bright yellow, so it can be used to detect whether the target protein has GGPPS enzyme activity. When detecting the enzymatic activity of the geranylgeranyl diphosphate synthase of Physcomitrella patens PpatGGPPS1, its expression vector pMAL-c5x-PpatGGPPS1 and PAC-94N plasmid need to be co-transformed into Escherichia coli. If the colonies appear orange-yellow, it indicates that the protein encoded by the transferred gene has the activity of geranylgeranyl diphosphate synthase. The empty vector and PAC-94N are co-transformed as negative controls, and the published rice geranylgeranyl diphosphate synthase OsatGGPPS is used as a positive control. The product is further detected by HPLC.

[0026] The PpatGGPPS1 geranylgeranyl diphosphate synthase gene of the invention is derived from Physcomitrella patens, and its genetic engineering receptor plant is suitable for plants such as rice.

[0027] The present invention discovers for the first time a key enzyme in the terpene metabolic pathway in Physcomitrella patens, namely, Physcomitrella patens PpatGGPPS1 geranylgeranyl diphosphate synthase, and confirms that the enzyme is involved in the metabolism of beta-carotene in Physcomitrella patens.

[0028] The invention obtains the gene sequence encoding the enzyme, and provides a theoretical basis for improving the content of beta-carotene and terpenoids in Physcomitrella patens or transgenic crops by using genetic engineering technology.

[0029] The invention discloses an application of a geranylgeranyl diphosphate synthase gene PpatGGPPS1, which is applied to the accumulation of beta-carotene and terpenoid substances in the genetic engineering of terpenoid metabolism of Physcomitrella patens.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] 1. The Physcomitrella patens PpatGGPPS1 geranylgeranyl diphosphate synthase gene of the present invention can be used as a target gene to construct a plant expression vector, and the CAM35S promoter of cauliflower mosaic virus, an ethanol-induced promoter, etc. can be used, and an enhancer can be included if necessary. In order to simplify the identification of transformed plants, a selective marker (such as an antibiotic enzyme) can be used. The expression vector used can use a Ti plasmid, a Ri plasmid, and a plant virus vector, etc. The transformation method can be transformed into plants using the Agrobacterium-mediated method or other methods.

[0032] 2. Through the PpatGGPPS1 geranylgeranyl diphosphate synthase gene and protein provided by the present invention, genetic engineering improvement of Ppatis patens can be carried out to enhance the accumulation of β-carotene and terpenoid substances in Ppatis patens, providing a theoretical basis for the improvement of economic crops.

[0033] 3. The PpatGGPPS1 geranylgeranyl diphosphate synthase gene of the present invention is derived from Physcomitrella patens, and its genetically engineered recipient plant is suitable for plants such as rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The nucleotide and deduced amino acid sequences of PpatGGPPS1; wherein "*" represents a stop codon.

[0035] Figure 2 This is a multiple sequence alignment of geranylgeranyl diphosphate synthases from different species, where Agra: Abies grandis; Osat: rice; Cann: pepper; Ntab: tobacco; Atha: Arabidopsis. The marked regions are the conserved arginine-rich substrate binding motifs FARM and SARM, and the cysteine-rich motif CXXXC.

[0036] Figure 3Phylogenetic tree analysis of geranylgeranyl diphosphate synthase in different species, including Agra: Abies grandis; Osat: Rice; Cann: Pepper; Ntab: Tobacco; Atha: Arabidopsis; Cros: Catharanthus roseus; Slyc: Tomato; Hsap: Human; Mmus: Mouse; Rsph: Rhodobacter sphaeroides; Pvul: Escherichia coli.

[0037] Figure 4 This is a schematic diagram of the 3D modeling structure of the geranylgeranyl diphosphate synthase from Physcomitrella patens.

[0038] Figure 5 The activity of geranylgeranyl diphosphate synthase from Physcomitrella patens was identified using the PAC-94N color complementation system. Figure 5 Figure A in the middle is the HPLC analysis chart of the experiment of PpatGGPPS1 in E. coli; among them, 1: pMAL-PpatGGPPS1: pMAL-PpatGGPPS1 and pAC-94N were co-transformed into E. coli; 2: pMAl-c5x: pMAL-c5x and pAC-94N were co-transformed into E. coli as negative control; 3: pMAL-AtGGPPS: pMAL-AtGGPPS and pAC-94N were co-transformed into E. coli as positive control. Figure 5 Figure B in the middle is a color complementation experiment diagram of PpatGGPPS1 in E. coli; among them, 1: pMAL-PpatGGPPS1: pMAL-PpatGGPPS1 and pAC-94N were co-transformed into E. coli; 2: pMAl-c5x: pMAL-c5x and pAC-94N were co-transformed into E. coli as a negative control; 3: pMAL-AtGGPPS: pMAL-AtGGPPS and pAC-94N were co-transformed into E. coli as a positive control. Figure 5 Figure C in the middle shows the absorption peak of β-carotene. DETAILED DESCRIPTION

[0039] The present invention is further explained below in conjunction with the accompanying drawings and specific embodiments. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art all fall within the scope defined by the claims attached to this application.

[0040] The method for obtaining the geranylgeranyl diphosphate synthase gene PpatGGPPS1 of this embodiment comprises the following steps:

[0041] 1) Identification of PpatGGPPS1 transcript and cloning of coding region in Physcomitrella patens

[0042] According to the open reading frame (ORF) of the Arabidopsis thaliana encoding GGPPS11 gene, the homologous sequence in Physcomitrella was searched in the Genbank database (https: / / www.ncbi.nlm.nih.gov / genbank / ) by proteinblast, and a transcript XM_024503933.1 in Physcomitrella was found. According to the transcript gene sequence, primers for amplifying the ORF with pMAL-c5x homology arms were designed. RNAiso reagent (Takara) was used to extract total RNA from Physcomitrella, and its purity and concentration were detected by UV spectrophotometer. 1 μg of total RNA was used as a template for reverse transcription, and cDNA was synthesized by reverse transcription using the PrimeScript 1stStrand cDNA Synthesis Kit (Takara). PCR amplification was performed using the high-fidelity enzyme PrimeSTARDNA polymerase (Takara). The PCR reaction procedure was as follows: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 2 min, and after 35 cycles, extension at 72°C for 5 min. After the reaction, the target fragment was homologously recombined with the linearized pMAL-c5x according to the operating instructions of the ClonExpressII One Step Cloning Kit (Vazyme). The ligation product was transformed into Escherichia coli (Top10), and positive clones were screened to obtain a recombinant vector carrying PpatGGPPS1, which was named pMAL-PpatGGPPS1. Figure 1 The gene coding region is 1164 bp in length, encoding a protein sequence containing 387 amino acid residues and a stop codon. Analysis showed that the N-terminus of the protein did not have a chloroplast transit peptide, which is consistent with the localization of GGPPS reported previously. The inferred protein sequence was compared with the homologous GGPPS sequences of other species ( Figure 2 ), indicating that the obtained PpatGGPPS1 is homologous to GGPPS of other species.

[0043] Systematic analysis

[0044] In order to determine the type to which the cloned PpatGGPPS1 belongs, we retrieved the amino acid sequences of the GGPPS family of other species and performed cluster analysis on them. All sequences were aligned using Clustal W and the neighbor tree was constructed using MEGA7. The analysis results showed that PpatGGPPS1 belongs to the Type II plant GGPPS family ( Figure 2 shown).

[0045] Homology modeling

[0046] In order to confirm whether PpatGGPPS1 has similar high-order sequences to GGPPS of other species, we searched the inferred target sequence in the PDB database, obtained the PDB file of plant GGPPS with existing crystal structure, and used it as a template for modeling and analysis of the PpatGGPPS1 3D structure. The results showed that PpatGGPPS1 has typical structural features of GGPPS, suggesting that it has the ability to synthesize GGPP.

[0047] Heterologous expression and functional characterization of PpatGGPPS1

[0048] The pMAL-PpatGGPPS1 vector and PAC-94N plasmid were co-transformed into BL21 Escherichia coli in the presence of carbenicillin (100 μg mL -1 ) and chloramphenicol (34 μg mL -1 ) overnight screening on LB solid medium. Rice GGPPS was constructed into the pMAL-c5x vector as a positive control, and the pMAL-c5x empty vector was used as a negative control. Single bacteria were transferred into LB liquid medium containing the same type and concentration and shaken overnight (5mL LB liquid medium). The next day, the transfer was carried out at a ratio of 1:50. When the OD600 of the bacterial solution reached the range of 0.6-0.8, 0.5mM isopropylβ-D-thiogalactopyranoside (IPTG) was added and placed in a 18℃ shaker overnight to induce protein expression. The cells were then enriched and the color of the cells was photographed and recorded. It was found that E. coli containing PpatGGPPS1 and rice OsGGPPS were both orange, indicating that PpatGGPPS1 had the same activity of catalyzing the synthesis of GGPP as the identified OsGGPPS, thereby causing E. coli to accumulate β-carotene.

[0049] Pigment extraction and HPLC analysis

[0050] The E. coli containing the PAC-94N and pMAL-PpatGGPPS1 dual vectors were enriched and the pigments were extracted, and HPLC analysis was performed on them. 5 mL of cells transferred into the expression vector pMAL-PpatGGPPS1 and the empty pigment expression strain were collected, centrifuged and enriched, and 400 μL of 80% acetone was added, and the mixture was shaken vigorously to fully mix to thoroughly extract the pigments in the material. Subsequently, 250 μL of ethyl acetate and 250 μL of water were added in sequence, and centrifuged at 13,400 g and 4°C for 20 min. The supernatant was aspirated and the extract was filtered with a 0.22 μm organic filter membrane. The extracted pigments were separated by reverse HPLC using a YMC Carotenoid (5 μm, 4.6×150 mm) column. The mobile phase elution program was: 0-5 min elution with pure methanol, 5-25 min elution with pure MTBE, 25-35 min elution with pure methanol, and the flow rate was 1 ml min -1 The column temperature was maintained at 30°C, the total run time was 35 min, and the detection wavelength of the detector was 440 nm. The identification of carotenoids was determined based on the characteristic absorption spectrum of each substance. All chemical reagents were chromatographically pure. The analysis results showed that when the pMAL-PpatGGPPS1 vector was co-transfected with PAC-94N, Figure 5 The E. coli in sample No. 3 produced a large amount of β-carotene; Figure 5 The results of the positive control of sample No. 2 were consistent. However, when the empty vector pMAL-c5x was co-transfected with PAC-94N, Figure 5 These results further confirmed that PpatGGPPS1 can synthesize GGPP ( Figure 4 shown).

[0051] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

[0052]

[0053]

[0054]

[0055]

[0056]

Claims

1. A geranylgeranyl diphosphate synthase gene, characterized in that: Its nucleotide sequence is shown in the sequence listing SeqID No:

1.

2. A protein encoded by a geranylgeranyl diphosphate synthase gene, characterized in that: Its amino acid sequence is shown in Seq ID No:

2.

3. The protein encoded by the geranylgeranyl diphosphate synthase gene according to claim 1 or 2, characterized in that: Geranylgeranyl diphosphate synthase is from Physcomitrella patens.

4. A recombinant expression vector, characterized in that: It comprises the geranylgeranyl diphosphate synthase gene as described in claim 1 or 2.

5. A transformant, characterized in that: A host cell comprising the recombinant expression vector of claim 4.

6. A transformant according to claim 5, characterized in that: Its hosts are microorganisms, plants or transgenic cell lines.

7. A method for obtaining the geranylgeranyl diphosphate synthase gene according to claim 1, characterized in that: The following steps are involved: Step 1, selecting Physcomitrella patens, and using a kit to extract total RNA from Physcomitrella patens; Step 2, using the total RNA obtained in step 1 as a reverse transcription template, synthesizing the first chain of cDNA by reverse transcription, and then performing PCR amplification using a forward transcription PCR program to obtain the full length of the ORF of the geranylgeranyl diphosphate synthase gene PpatGGPPS1. At this time, the geranylgeranyl diphosphate synthase gene PpatGGPPS1 carries a pMAL-c5x homology arm, wherein: The F-terminal primers are as follows: gcggccgcgatatcgtcgac ATGGGTTCAACAGTGGTCTCATACA The R-terminal primers are as follows: taattacctgcagggaattc CTAATTCTGCCTGTAAGCGATGTAG Among them, lowercase letters represent homology arm sequences, and uppercase letters are the sequences of genes used as primers; Step 3, homologously recombining the gene fragment of the geranylgeranyl diphosphate synthase gene PpatGGPPS1 with the pMAL-c5x homology arm, sequencing and splicing to obtain the Physcomitrella patens geranylgeranyl diphosphate synthase gene PpatGGPPS1 with a complete coding region, the nucleotide sequence of the geranylgeranyl diphosphate synthase gene PpatGGPPS1 is shown in the sequence table Seq ID No:

1.

8. An application of the geranylgeranyl diphosphate synthase gene according to claim 1, characterized in that: It is applied to the accumulation of β-carotene and terpenoid substances in the genetic engineering of terpenoid metabolism of Physcomitrella patens.

Images