A method for creating cadmium-resistant rice with low cadmium accumulation in grains and its application

Abstract

The present invention discloses a method for creating cadmium-resistant rice with low cadmium accumulation in grains and its application. By using CRISPR-Cas9 to construct a double mutant of rice oshma3oslct1 expressing the cadmium-binding autophagy adaptor protein AIM-SpMTL-GFP, the present invention not only reduces the transport of cadmium from the xylem to the phloem and its accumulation in root vacuoles, but also the cadmium-binding autophagy adaptor protein AIM-SpMTL-GFP can accumulate cadmium in the vacuoles of leaf protoplasts. Without affecting the grain yield and quality of rice, it reduces the cadmium accumulation in grains and enriches cadmium in non-edible parts, such as straw, for convenient industrial treatment. The cadmium-resistant rice with low cadmium accumulation provided by the present invention can reduce cadmium pollution in the food chain, thereby reducing the harm of cadmium to the human body.

Description

Technical Field

[0001] The present invention relates to the technical fields of gene editing technology and crop breeding technology. Specifically, it relates to a method for creating cadmium-resistant rice with low cadmium accumulation in grains and its application. Background Art

[0002] Cadmium (Cd) is a heavy metal and environmental pollutant widely used in industrial production. Due to the continuous increase in the emissions of industrial waste water, waste gas, etc., and the excessive use of metal-containing pesticides and fertilizers, the cadmium content in farmland soil is continuously rising. Cadmium is easily accumulated in the human body and not easily excreted, with a long half-life. The half-life in the kidneys can reach 10 - 30 years. Long-term consumption of rice with excessive cadmium content will endanger human health and cause diseases such as liver disease, kidney damage, bone variation, and cancer. Reducing cadmium accumulation in rice grains and repairing cadmium pollution in soil are of great significance for ensuring food security and human health.

[0003] Rice is easily contaminated by cadmium because Cd 2+ is transported by metal transporters (MT) that transport essential metal elements such as Fe 2+ , Zn 2+ , Mn 2+ . Cadmium in the soil is transported by metal transporters into the symplast of root cells. Part of it is sequestered in the vacuoles of root cells by OsHMA3 (Heavy metal-transporting ATPase3, OsHMA3), and the other part is transported to the xylem by OsHMA2 and OsCCX2. After the transport from the xylem to the phloem and the phloem re-transport, it finally reaches the grains. The low-affinity cation transporter (OsLCT1) mainly expressed in the diffuse vascular bundles connected to the panicles in rice participates in the transfer of cadmium from the swollen large vascular bundles to the diffusion vascular bundles connected to the panicles, resulting in cadmium accumulation in the grains.

[0004] In recent years, various measures have been taken to prevent and control cadmium pollution in rice. Most of the methods for repairing cadmium-polluted rice have limitations. Field repair technologies, such as soil improvement, bioremediation, and hyperaccumulator plant repair, have a long cycle and low efficiency. In addition to field repair technologies, cultivating rice varieties with low cadmium accumulation is an economical and effective method to reduce cadmium pollution in the food chain. Most studies use technologies such as CRISPR-Cas9 to knock out the main cadmium transporter gene NRAMP5 in the roots, reducing the absorption of cadmium by rice. Similarly, manipulating mutations in OsHMA2 and OsLCT1 can reduce the xylem loading of Cd in rice and the long-distance transport and distribution between the underground and above-ground parts. Furthermore, co-overexpressing OsHMA3 can promote the compartmentalization of Cd in root cell vacuoles, thereby reducing the accumulation of Cd in grains. However, the loss of the above gene functions is also accompanied by the disturbance of the homeostasis of other mineral elements. For example, the loss of OsHMA2 function will reduce the content of Cd in grains while also reducing the content of Zn. Although gene editing can reduce the cadmium content in rice grains, it will also cause the loss of other essential metal elements for the human body, and cadmium pollution in the soil still exists.

[0005] To adapt to cadmium-polluted soil environments, rice has evolved various strategies to resist cadmium toxicity, including the deposition of cadmium in cell walls, vacuolar sequestration, chelation, and efflux. Vacuoles are the main organelles for sequestering cadmium in rice. At the same time, vacuoles are also the final destinations for transporting substances in the autophagy pathway in plants and yeasts. Autophagy is the process of wrapping damaged organelles, denatured or aging macromolecules, etc. in autophagosomes and transporting them to vacuoles (plants and yeasts) or lysosomes (mammals) for degradation or sequestration. The autophagy pathway is regulated by a series of conserved autophagy-related (ATG) genes, and ATG8 is regarded as a marker protein of the autophagy pathway. Autophagy can be divided into selective autophagy and non-selective autophagy according to the selectivity of the degradation substrates. Selective autophagy is mediated by the interaction between adaptor proteins and ATG8, which packages different substrates to be degraded into autophagosomes. The interaction between these adaptor proteins and ATG8 is mediated by the conserved AIM (ATG8-interacting motif) motif on the adaptor proteins. The core sequence of the AIM motif is W / Y / F-XX-L / I / V, where the first and fourth amino acids are conserved amino acids, and "X" can be any amino acid. This AIM promotes the binding to ATG8 by fitting into the conserved hydrophobic groove on the surface of ATG8, packaging the selective autophagy substrates into vesicles. Summary of the Invention

[0006] The technical problem to be solved by the present invention is the above-mentioned defects and deficiencies in the prior art, and to provide a method and application for creating cadmium-resistant rice with low cadmium accumulation in grains.

[0007] The first object of the present invention is to provide a composition.

[0008] The second object of the present invention is to provide the application of the above composition in creating cadmium-resistant rice.

[0009] The third object of the present invention is to provide a method for creating cadmium-resistant rice.

[0010] The fourth object of the present invention is to provide the application of the cadmium-resistant rice obtained by the above method in resisting cadmium pollution in rice.

[0011] In order to achieve the above objects, the present invention is realized through the following solutions:

[0012] The present invention first constructs a double mutant of rice oshma3 oslct1 and a double mutant plant of rice oshma3 oslct1 expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP through the CRISPR-Cas9 gene editing technology, and then uses a cadmium-specific dye to detect whether the Cd-binding autophagy adaptor protein AIM-SpMTL can enrich Cd in the vacuoles of leaf protoplasts, and detect the cadmium tolerance of the created double mutant of rice oshma3 oslct1 expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP.

[0013] Therefore, the present invention claims the following:

[0014] A composition, the composition comprising an sgRNA expression cassette specifically targeting the OsHMA3 gene, an sgRNA expression cassette specifically targeting the OsLCT1 gene, and a coding gene expressing an autophagy-related adaptor protein.

[0015] Preferably, the nucleotide sequence of the sgRNA expression cassette specifically targeting the OsHMA3 gene is as shown in SEQ ID NO: 1-2, the nucleotide sequence of the sgRNA expression cassette specifically targeting the OsLCT1 gene is as shown in SEQ ID NO: 3-4, and the nucleotide sequence of the coding gene expressing the autophagy-related adaptor protein is as shown in SEQ ID NO: 5.

[0016] Preferably, the upstream of the coding gene expressing the autophagy-related adaptor protein further contains a green tissue-specific expression promoter, that is, a coding gene expressing the autophagy-related adaptor protein containing a green tissue-specific expression promoter.

[0017] More preferably, the green tissue-specific expression promoter is GSSP3, and its nucleotide sequence is as shown in SEQ ID NO: 6, then the nucleotide sequence of the coding gene expressing the autophagy-related adaptor protein containing the green tissue-specific expression promoter is as shown in SEQ ID NO: 7.

[0018] Use of the above composition in creating cadmium-resistant rice, wherein the grains of the cadmium-resistant rice have low cadmium accumulation.

[0019] A method for creating cadmium-resistant rice, which comprises cloning the composition into a vector to construct a recombinant vector, transforming the recombinant vector into wild-type rice, and identifying the obtained transformed seedlings.

[0020] Preferably, the method for constructing the recombinant vector comprises the following steps:

[0021] S1. Assemble the sgRNA expression cassette specifically targeting the OsHMA3 gene and the sgRNA expression cassette specifically targeting the OsLCT1 gene into a vector to construct a dual-gene editing vector;

[0022] S2. Use a restriction endonuclease to digest the dual-gene editing vector obtained in step S1 to obtain a linearized dual-gene editing vector;

[0023] S3. Clone the coding gene expressing the autophagy-related adaptor protein into the linearized dual-gene editing vector obtained in step S2 to obtain the recombinant vector.

[0024] Preferably, the vector is the binary vector pYLCRISPR / Cas9P ubi -H, and its nucleotide sequence is shown in NCBI (txid1648237).

[0025] Preferably, the restriction endonuclease used in the assembly in step S1 is BsaⅠ, and the obtained dual-gene editing vector is a fragment with the nucleotide sequence shown in SEQ ID NO:8 inserted at the BsaⅠ site of pYLCRISPR / Cas9P ubi -H.

[0026] Preferably, the restriction endonuclease in step S2 is PmeI, and the obtained recombinant vector in step S3 is a fragment with the nucleotide sequence shown in SEQ ID NO:9 inserted at the PmeI site of the linearized dual-gene editing vector obtained in step S2.

[0027] Preferably, the coding gene expressing the autophagy-related adaptor protein in step S3 further contains a green tissue-specific expression promoter upstream, that is, the coding gene expressing the autophagy-related adaptor protein containing the green tissue-specific expression promoter.

[0028] More preferably, the green tissue-specific expression promoter is GSSP3, and its nucleotide sequence is as shown in SEQ ID NO:6. Then, the nucleotide sequence of the coding gene expressing the autophagy-related adaptor protein containing the green tissue-specific expression promoter is as shown in SEQ ID NO:7.

[0029] Preferably, the identification is carried out by using the DNA of the transformed seedlings as a template, designing primers for PCR amplification and sequencing to confirm the successful construction of the transformed seedlings.

[0030] More preferably, the identification method is to use the DNA of the transformed seedlings as a template, amplify the fragments with OsHMA3 T1 and T2 targets by using the primers with nucleotide sequences as shown in SEQ ID NO:24 - 25, amplify the fragments with OsLCT1 T1 and T2 targets by using the primers with nucleotide sequences as shown in SEQ ID NO:26 - 27, directly send the amplified fragments with OsHMA3 T1 and T2 targets and the fragments with OsLCT1 T1 and T2 targets for sequencing to determine the successful mutation of the double sites of oshma3 and oslct1; then use the primers with nucleotide sequences as shown in SEQ ID NO:36 - 37 to amplify the AIM-SpMTL fragment. If the AIM-SpMTL fragment can be amplified, it indicates the successful construction of the rice oshma3 oslct1 double mutant expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP.

[0031] Application of the cadmium-resistant rice obtained by any of the above methods in the resistance of rice to cadmium pollution.

[0032] Preferably, the resistance to cadmium pollution in rice is resistance to cadmium accumulation in rice grains and / or remediation of cadmium-polluted paddy fields.

[0033] The technical solution of the present invention has the following beneficial effects:

[0034] The present invention constructs a rice oshma3 oslct1 double mutant expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP through CRISPR-Cas9, which not only reduces the transport of Cd from the xylem to the phloem and the accumulation in the root vacuoles, but also the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP can accumulate cadmium in the protoplast vacuoles of the leaves. Without affecting the yield and quality of rice grains, it reduces the Cd accumulation in grains and enriches Cd to the non-edible part of the straw for convenient industrial treatment. The cadmium-resistant rice with low Cd accumulation provided by the present invention can reduce cadmium pollution in the food chain, thereby reducing the harm of cadmium to the human body. Brief Description of the Drawings

[0035] Figure 1 For the binary vector pYLCRISPR / Cas9Pubi -H schematic diagram.

[0036] Figure 2 It is a diagram of gene editing sites for OsHMA3 and OsLCT1 genes and a schematic diagram of the vector for constructing the rice oshma3 oslct1 double mutant by CRISPR-Cas9 gene editing technology. A: Diagram of gene editing sites for OsHMA3 and OsLCT1 genes; B: Schematic diagram of the vector for the oshma3 oslct1 double mutant and the vector for expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP, where the vector backbone is pYLCRISPR Cas9P ubi -H (KR029109), T1 on the vector schematic diagram is OsHMA3 target1, T2 is OsHMA3 target2, T3 is OsLCT1 target1, T4 is OsLCT1 target2, GSSP3 is a rice green tissue-specific promoter, AIM is the ATG8 interacting motif, SpMTL is Sedum plumbizincicola MT-like, and GFP is the green fluorescent protein.

[0037] Figure 3 It is an identification diagram of the oshma3 oslct1 double mutant. A: Mutation situation of the oshma3 oslct1 double mutant at the DNA level, and the part within the box is the position of the PAM sequence in the gene; B: Sequencing peak diagram of the mutation site of the oshma3 oslct1 double mutant; C: Electrophoresis detection results of AIM-SpMTL-GFP in the rice oshma3 oslct1 mutant plants expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP. Lane 1 is Marker, lane 2 is the electrophoresis detection results of AIM-SpMTL and Actin in wild-type rice DNA, lane 3 is the electrophoresis detection results of AIM-SpMTL and Actin in oshma3 oslct1 double mutant rice DNA, and lane 4 is the electrophoresis detection results of AIM-SpMTL and Actin in the DNA of rice oshma3 oslct1 mutant plants expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP.

[0038] Figure 4 It is a phenotypic diagram of cadmium-resistant rice with low cadmium accumulation in grains under cadmium treatment. A: Phenotypes of wild-type (WT) rice, oshma3 oslct1 mutant rice, and oshma3 oslct1 double mutant rice expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP, bar is 5 cm; B: Statistical chart of rice plant height; C: Statistical chart of rice root length.

[0039] Figure 5 For the case where cadmium is enriched in the vacuoles of leaves, where accc1 abcc2 is an Arabidopsis cadmium-sensitive mutant, and AIM-SpMTL-mCherry@accc1 abcc2 is an Arabidopsis cadmium-sensitive mutant expressing AIM-SpMTL-mCherry. Among them, a is the bright field of abcc1 abcc2 protoplasts, b is the subcellular localization of red fluorescence in abcc1 abcc2 protoplasts, c is the subcellular localization of green fluorescence in abcc1 abcc2 protoplasts, that is, the subcellular localization of Cd in abcc1 abcc2 protoplasts, d is the fusion expression of bright field, red fluorescence and green fluorescence in abcc1 abcc2 protoplasts, e is the bright field of AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts, f is the subcellular localization of red fluorescence in AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts, that is, the subcellular localization of Cd-binding autophagy adaptor AIM-SpMTL-mCherry, g is the subcellular localization of red fluorescence in AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts, that is, the subcellular localization of Cd in AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts, h is the fusion expression of bright field, red fluorescence and green fluorescence in AIM-SpMTL-mCherry@abcc1 abcc2 protoplasts. Bright is the bright field, mCherry emits red fluorescence, Leadmiumgreen is a cadmium-specific dye that emits green fluorescence, and bar is 20 μm. Specific implementation manners

[0040] The present invention will be further described below in conjunction with specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.

[0041] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0042] Example 1 Creation of oshma3 oslct1 double mutant rice

[0043] I. Experimental methods

[0044] 1. Construction of CRISPR-Cas9 vector for oshma3 oslct1 double mutant rice

[0045] (1) Determine the CRISPR-Cas9 gene editing sites

[0046] Obtain the genomic sequences of OsHMA3 (LOC4342783) and OsLCT1 (LOC9270091) from the NCBI database, and determine the CRISPR-Cas9 gene editing sites according to the CDS sequences in the genomic sequences through the website http: / / skl.scau.edu.cn / .

[0047] The OsHMA3 gene editing sites are located in CDS4 and CDS5, and the sequences are TGGAGGCGGCGCAGAACAGC (OsHMA3 target1, SEQ ID NO: 10) and AGCAGGAGTGGCCCTGATCC (OsHMA3 target2, SEQ ID NO: 11) respectively; the OsLCT1 gene editing sites are located in CDS3, and the sequences are GGCCATCGTCCCCATGTCGT (OsLCT1target1, SEQ ID NO: 12) and AAGGCGGCGATCGCGAG (OsLCT1 target2, SEQ ID NO: 13) respectively. Compare the gene editing sites with the NCBI database by Blast sequence to determine the specificity of the gene editing sites.

[0048] (2) Design primers

[0049] According to the above gene editing sites, design primers for constructing CRISPR-Cas9 vectors for editing OsHMA3 and OsLCT1 genes, and the primer sequences are shown in Table 1.

[0050] Among them, OsHMA3-T1-primer-F (SEQ ID NO: 14) and OsHMA3-T1-primer-R (SEQ ID NO: 15) are used to construct OsHMA3 target1 (SEQ ID NO: 10); OsHMA3-T2-primer-F (SEQ ID NO: 16) and OsHMA3-T2-primer-R (SEQ ID NO: 17) are used to construct OsHMA3target2 (SEQ ID NO: 11); OsLCT1-T1-primer-F (SEQ ID NO: 18) and OsLCT1-T1-primer-R (SEQ ID NO: 19) are used to construct OsLCT1target1 (SEQ ID NO: 12); OsLCT1-T2-primer-F (SEQ ID NO: 20) and OsLCT1-T2-primer-R (SEQ ID NO: 21) are used to construct OsLCT1 target2 (SEQ ID NO: 13).

[0051] Table 1 CRISPR-Cas9 Primers

[0052]

[0053] (3) Construction of OsHMA3 sgRNA Expression Cassette and OsLCT1 sgRNA Expression Cassette

[0054] ① Use Hipure plasmid kits plasmid extraction kit (Meiji, P1001-03C) to extract pYLsgRNA-OsU3, pYLsgRNA-OsU6a, pYLsgRNA-OsU6b, and pYLsgRNA-OsU6c plasmids respectively (the same as pYLsgRNA-OsU3, pYLsgRNA-OsU6a, pYLsgRNA-OsU6b, and pYLsgRNA-OsU6c in DOI: 10.1016 / j.molp.2015.04.007);

[0055] ② Using pYLsgRNA-OsU6a plasmid DNA as a template, with the universal primers U-F: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO:22) and OsHMA3-T1-primer-R (SEQ ID NO:15), use Phanta-max super-fidelity DNA polymerase high-fidelity enzyme (Novoprotein, P505-d3) to amplify the fragment by PCR to obtain the OsU6a fragment with the OsHMA3-T1 target. The PCR reaction system is (50 μL): Phanta-max super-fidelity DNA polymerase high-fidelity enzyme 1 μL, U-F 2 μL, OsHMA3-T1-primer-R 2 μL, 2×Phantamax buffer 25 μL, dNTP mix 1 μL, pYLsgRNA-OsU6a plasmid DNA 1 μL, ddH 2 O 18 μL;

[0056] ③ Use OsHMA3-T1-primer-F (SEQ ID NO:14) and the universal primer g-R: CGGAGGAAATTCCATCCAC (SEQ ID NO:23) to amplify the fragment by PCR using Phanta-max super-fidelity DNA polymerase (Vazyme, P505-d3) to obtain the OsHMA3-T1 sgRNA fragment. The PCR reaction system is (50 μL): Phanta-max super-fidelity DNA polymerase 1 μL, OsHMA3-T1-primer-F 2 μL, g-R 2 μL, 2×Phanta max buffer 25 μL, dNTP mix 1 μL, pYLsgRNA-OsU6a plasmid DNA 1 μL, ddH 2 O 18 μL;

[0057] ④ Then obtain the OsHMA3-T1 sgRNA expression cassette by overlap PCR. The PCR reaction system is (50 μL): Phanta-max super-fidelity DNA polymerase 1 μL, U-F 2 μL, g-R 2 μL, 2×Phanta max buffer 25 μL, dNTP mix 1 μL, 0.5 μL of the above-amplified OsU6a fragment with the OsHMA3-T1 target, 0.5 μL of the above-amplified OsHMA3-T1 sgRNA fragment, ddH 2 O 18 μL. The nucleotide sequence of the obtained OsHMA3-T1 sgRNA expression cassette is as shown in SEQ ID NO:1.

[0058] ⑤ Use the same method as in steps ② to ④ to obtain the OsHMA3-T2 sgRNA expression cassette using pYLsgRNA-OsU6b plasmid DNA as the template, the OsLCT1-T1 sgRNA expression cassette using pYLsgRNA-OsU6c plasmid DNA as the template, and the OsLCT1-T2 sgRNA expression cassette using pYLsgRNA-OsU3 plasmid DNA as the template:

[0059] (A): Using the pYLsgRNA-OsU6b plasmid DNA as a template, with the universal primers U-F (SEQ ID NO:22) and OsHMA3-T2-primer-R (SEQ ID NO:17), fragment amplification was carried out by PCR using the Phanta-max super-fidelity DNA polymerase (Vazyme, P505-d3) to obtain the OsU6b fragment with the OsHMA3-T2 target site. The PCR amplification system was as shown in step ②;

[0060] Then, using OsHMA3-T2-primer-F (SEQ ID NO:16) and the universal primer g-R (SEQ ID NO:23), fragment amplification was carried out by PCR using the Phanta-max super-fidelity DNA polymerase (Vazyme, P505-d3) to obtain the OsHMA3-T2 sgRNA fragment. The PCR amplification system was as shown in step ③;

[0061] Then, the sgRNA expression cassette of OsHMA3-T2 was obtained by the method of overlap PCR. The PCR amplification system was as shown in step ④;

[0062] The nucleotide sequence of the obtained OsHMA3-T2 sgRNA expression cassette is as shown in SEQ ID NO:2.

[0063] (B): Using the pYLsgRNA-OsU6c plasmid DNA as a template, with the universal primers U-F (SEQ ID NO:22) and OsLCT1-T1-primer-R (SEQ ID NO:19), fragment amplification was carried out by PCR using the Phanta-max super-fidelity DNA polymerase (Vazyme, P505-d3) to obtain the OsU6c fragment with the OsLCT1-T1 target site. The PCR amplification system was as shown in step ②;

[0064] Then, using OsLCT1-T1-primer-F (SEQ ID NO:18) and the universal primer g-R (SEQ ID NO:23), fragment amplification was carried out by PCR using the Phanta-max super-fidelity DNA polymerase (Vazyme, P505-d3) to obtain the OsLCT1-T1 sgRNA fragment. The PCR amplification system was as shown in step ③;

[0065] The sgRNA expression cassette of OsLCT1-T1 was obtained by the method of overlap PCR, and the PCR amplification system was as shown in step ④;

[0066] The nucleotide sequence of the obtained OsLCT1-T1 sgRNA expression cassette is as shown in SEQ ID NO:3.

[0067] (C): Using the pYLsgRNA-OsU3 plasmid DNA as a template, with the universal primers U-F (SEQ ID NO:22) and OsLCT1-T2-primer-R (SEQ ID NO:21), the Phanta-max super-fidelity DNA polymerase (Vazyme, P505-d3) was used to perform fragment amplification by PCR to obtain the OsU3 fragment with the OsLCT1-T2 target site, and the PCR amplification system was as shown in step ②;

[0068] Then, using OsLCT1-T2-primer-F (SEQ ID NO:20) and the universal primer g-R (SEQ ID NO:23), the Phanta-max super-fidelity DNA polymerase (Vazyme, P505-d3) was used to perform fragment amplification by PCR to obtain the OsLCT1-T2 sgRNA fragment, and the PCR amplification system was as shown in step ③;

[0069] The sgRNA expression cassette of OsLCT1-T2 was obtained by the method of overlap PCR, and the PCR amplification system was as shown in step ④;

[0070] The nucleotide sequence of the obtained OsLCT1-T2 sgRNA expression cassette is as shown in SEQ ID NO:4.

[0071] (4) Clone the OsHMA3-T1 sgRNA expression cassette (SEQ ID NO:1), OsHMA3-T2 sgRNA expression cassette (SEQ ID NO:2), OsLCT1-T1 sgRNA expression cassette (SEQ ID NO:3) and OsLCT1-T2 sgRNA expression cassette (SEQ ID NO:4) into pYLCRISPR / Cas9P ubi -H vector.

[0072] pYLCRISPR / Cas9P ubi -H vector is a binary vector for plant expression. In addition to expressing the CRISPR-Cas9 enzyme, it also contains other elements required for plant expression and a transgenic screening marker ( Figure 1) Extract the pYLCRISPR / Cas9P-H plasmid (identical to the pYLCRISPR / Cas9P-H in DOI: 10.1016 / j.molp.2015.04.007) using the HiPure Plasmid Kits (Meiji, P1001-03C). ubi -H plasmid (identical to the pYLCRISPR / Cas9P ubi -H in DOI: 10.1016 / j.molp.2015.04.007), and use the GoldenGate cloning method based on BsaⅠ digestion and ligation to assemble the OsHMA3-T1 sgRNA expression cassette (SEQ ID NO:1), OsHMA3-T2 sgRNA expression cassette (SEQ ID NO:2), OsLCT1-T1 sgRNA expression cassette (SEQ ID NO:3), and OsLCT1-T2 sgRNA expression cassette (SEQ ID NO:4) into pYLCRISPR / Cas9P ubi -H in sequence by the method of "cutting and ligating simultaneously" to obtain the pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector ( Figure 2 B in it), and the nucleotide sequence of the inserted fragment is as shown in SEQ ID NO:8;

[0073] Among them, the reaction system is (15 μL): 1.5 μL of 10×cutsmart, 1.5 μL of 10×T4 DNA ligase buffer, 1 μL of pYLCRISPR / Cas9P ubi -H plasmid, 0.5 μL of OsHMA3-T1 sgRNA expression cassette, 0.5 μL of OsHMA3-T2 sgRNA expression cassette, 0.5 μL of OsLCT1-T1 sgRNA expression cassette, 0.5 μL of OsLCT1-T2 sgRNA expression cassette, 0.5 μL of BsaI, 0.2 μL of T4 DNA ligase, ddH 2 O 8.3 μL.

[0074] The reaction program is: 37°C for 5 min, 10°C for 5 min, 20°C for 5 min as one cycle, and the number of cycles is 15. After the cycle ends, incubate at 37°C for another 5 min.

[0075] 2. Transform Escherichia coli DH5α

[0076] Transform the ligation product into Escherichia coli DH5α by heat shock at 42°C. Spread the bacterial solution on an LB solid medium containing 50 mg / mL Kan antibiotic and incubate it upside down in a 37°C incubator for 12 - 16 h.

[0077] 3. Vector identification

[0078] Pick out the single colonies grown on the plate and shake the bacteria to expand the culture. Use the bacterial solution as a template for PCR identification. The reaction system is (10 μL): 5 μL of 2×Taq master mix (dye plus), 0.5 μL of universal primer U-F, 0.5 μL of universal primer g-R, 1 μL of bacterial solution, ddH 2 O 3 μL. After the identification, extract the plasmid to obtain the constructed pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector.

[0079] 4. Obtain transgenic seedlings

[0080] Send the constructed pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector to the company for transformation of wild-type rice to obtain T 0 generation of gene-transformed seedlings. After planting the T 0 generation of transformed seedlings in the field and harvesting the seeds, spread the seeds on the MS medium containing 30 μg / mL hygromycin. If they can grow on the MS medium containing hygromycin, they are transgenic positive seedlings, thus screening out the T 1 generation of transgenic positive seedlings.

[0081] At about 30 days of the seedling stage, use the DNA of WT rice and oshma3 oslct1 double mutant rice as templates, use the primers shown in Table 2, and use 2×Taq Master Mix (Dye Plus) enzyme (Novoprotein, P112-03) to amplify the genomic sequences on both sides of the target by PCR and sequence. The PCR reaction system is: 5 μL of 2×Taq master mix (dye plus), 0.5 μL of upstream primer, 0.5 μL of downstream primer, 2 μL of DNA, ddH 2 O 2 μL; among them, primers OsHMA3-primer-F (SEQ ID NO:24) and OsHMA3-primer-R (SEQ ID NO:25) are used to amplify oshma3, primers OsLCT1-primer-F (SEQ IDNO:26) and OsLCT1-primer-R (SEQ ID NO:27) are used to amplify oslct1, and then compare with the wild-type genomic sequence to determine that the target has been knocked out.

[0082] Table 2 Primers used to identify oshma3 oslct1 double mutant lines

[0083]

[0084] II. Experimental results

[0085] The identification results of the oshma3 oslct1 double mutant lines are as follows Figure 3 shown in A of Figure 3 and B of Figure 3 as shown by oshma3 and oslct1. During the identification of the T1 generation, there were also cases of single mutations and failed mutations. Figure 3 Only the identification results of successful double mutations are shown in A of

[0086] Example 2 Creation of the rice double mutant oshma3oslct1 expressing the cadmium-binding autophagy adaptor protein AIM-SpMTL-GFP

[0087] I. Experimental methods

[0088] 1. Construction of the pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector

[0089] First, construct the pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector according to the method of Example 1. Using this as the vector backbone, digest it with PmeI enzyme. After digesting at 37°C for 3 h, use a gel recovery kit (Meiji, D2111-03) to recover the vector backbone.

[0090] 2. Amplification of the GSSP3::AIM-SpMTL-GFP fragment

[0091] GSSP3 is a rice green tissue-specific expression promoter that can initiate the specific expression of the cadmium-binding autophagy adaptor protein AIM-SpMTL-GFP in rice green tissues. Using the synthesized GSSP3 fragment as the template for GSSP3, Arabidopsis cDNA as the template for AIM, Sedum plumbizincicola cDNA as the template for SpMTL, and the plasmid containing GFP as the template for GFP, use the primers in Table 3 and the Phanta-max super-fidelity DNA polymerase high-fidelity enzyme (Vazyme, P505-d3) to perform fragment amplification by PCR to obtain the fragments GSSP3, AIM, SpMTL, and GFP.

[0092] Among them, the PCR reaction system is (50 μL): 1 μL of Phanta-max super-fidelity DNA polymerase high-fidelity enzyme, 2 μL of upstream primer, 2 μL of downstream primer, 25 μL of 2×Phanta max buffer, 1 μL of dNTP mix, 1 μL of template, ddH 218 μL of O; among them, GSSP3-F (SEQ ID NO:28) and GSSP3-R (SEQ ID NO:29) are used to amplify the GSSP3 fragment, AIM-F (SEQ ID NO:30) and AIM-R (SEQ ID NO:31) are used to amplify the AIM fragment, SpMTL-F (SEQ ID NO:32) and SpMTL-R (SEQ ID NO:33) are used to amplify the SpMTL fragment, and GFP-F (SEQ ID NO:34) and GFP-R (SEQ ID NO:35) are used to amplify the GFP fragment.

[0093] The above fragments were first ligated into AIM-SpMTL-GFP by the method of overlap PCR. The PCR reaction system was (50 μL): 1 μL of Phanta-max super-fidelity DNA polymerase (high-fidelity enzyme), 1.33 μL of AIM-F, 0.67 μL of SpMTL-R, 0.67 μL of SpMTL-F, 1.33 μL of GFP-R, 25 μL of 2×Phanta max buffer, 1 μL of dNTP mix, 0.33 μL of AIM fragment, 0.33 μL of SpMTL fragment, 0.33 μL of GFP fragment, ddH 2 18 μL of O. The nucleotide sequence of the obtained AIM-SpMTL-GFP fragment is as shown in SEQ ID NO:5.

[0094] Then, the fragment GSSP3 (SEQ ID NO:6) and AIM-SpMTL-GFP (SEQ ID NO:5) were ligated together again by the method of overlap PCR. The PCR reaction system was (50 μL): 1 μL of Phanta-max super-fidelity DNA polymerase (high-fidelity enzyme), 2 μL of GSSP3-F, 2 μL of GFP-R, 25 μL of 2×Phanta max buffer, 1 μL of dNTP mix, 0.5 μL of GSSP3 fragment, 0.5 μL of AIM-SpMTL-GFP, dH 2 18 μL of O. The nucleotide sequence of the obtained GSSP3::AIM-SpMTL-GFP fragment is as shown in SEQ ID NO:7.

[0095] Table 3 Primer sequences for amplifying the fragment GSSP3::AIM-SpMTL-GFP

[0096]

[0097]

[0098] 3. Homologous recombination

[0099] The fusion fragment GSSP3::AIM-SpMTL-GFP (SEQ ID NO:7) was constructed into the pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector by homologous recombination. The reaction system (10 μL) for homologous recombination was as follows: 0.1 ng of GSSP3::AIM-SpMTL-GFP fragment, 0.3 ng of linear pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector fragment, 2 μL of 5×TEDA, and made up to 10 μL with ddH 2 O to 10 μL.

[0100] 4. Transformation of Escherichia coli DH5α

[0101] The ligation product was transformed into Escherichia coli DH5α by heat shock at 42°C. The bacterial solution was spread on an LB solid medium containing 50 mg / mL Kan antibiotic and incubated upside down in a 37°C incubator for 12 - 16 h.

[0102] 5. Vector identification

[0103] Single colonies grown on the plate were picked and cultured with shaking for expansion. PCR identification was performed using the bacterial solution as a template. After identification, the plasmid was extracted to obtain the constructed pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector, and the nucleotide sequence of the inserted fragment is as shown in SEQ ID NO:9.

[0104] 6. Obtaining transgenic seedlings

[0105] The constructed pYLCRISPR / Cas9P ubi -H-OsHMA3 OsLCT1 gene editing vector expressing the Cd-binding autophagy adaptor protein AIM-SpMTL-GFP was sent to the company for transformation of wild-type rice to obtain T 0 -generation gene-transformed seedlings. The T 1 -generation seeds were sown on MS medium containing 30 μg / mL hygromycin. If they could grow on the MS medium containing hygromycin, they were transgenic positive seedlings, thus screening out T 1T0 transgenic positive seedlings. Similar to the identification of the oshma3 oslct1 double mutant lines, at about 30 days of the seedling stage, the genomic sequences on both sides of the target were amplified by PCR using the primers shown in Table 2 and Table 4 with 2×Taq Master Mix (Dye Plus) enzyme (Vazyme, P112-03) and sequenced, and then compared with the wild-type genomic sequence to determine that the target had been knocked out by CRISPR-Cas9. Based on this, the gene identification of the Cd-binding autophagy adaptor AIM-SpMTL-GFP was carried out.

[0106] Using the DNA of WT rice, oshma3 oslct1 double mutant rice, and oshma3 oslct1 double mutant rice expressing the Cd-binding autophagy adaptor AIM-SpMTL-GFP as templates, the fragment AIM-SpMTL was amplified using the primers AIM-SpMTL-F (SEQ ID NO:36) and AIM-SpMTL-R (SEQ ID NO:37) in Table 4; the fragment Actin was amplified using the primers Actin-F (SEQ ID NO:38) and Actin-R (SEQ ID NO:39) in Table 4.

[0107] Table 4 Primer sequences

[0108]

[0109] II. Experimental results

[0110] The fragments with OsHMA3 T1 and T2 targets were amplified using the primers OsHMA3-primer-F (SEQ ID NO:24) and OsHMA3-primer-R (SEQ ID NO:25), and the fragments with OsLCT1 T1 and T2 targets were amplified using the primers OsLCT1-primer-F (SEQ ID NO:26) and OsLCT1-primer-R (SEQ ID NO:27). The amplified fragments with OsHMA3 T1 and T2 targets and the fragments with OsLCT1 T1 and T2 targets were directly sent for sequencing. The DNA level identification results of the oshma3 oslct1 double mutant rice are as Figure 3 shown in A and B of. The fragment AIM-SpMTL with a size of 784 bp was amplified using the primers AIM-SpMTL-F (SEQ ID NO:36) and AIM-SpMTL-R (SEQ ID NO:37); the fragment Actin with a size of 332 bp was obtained using the primers Actin-F (SEQ ID NO:38) and Actin-R (SEQ ID NO:39) (as Figure 3 shown in C of).

[0111] Phenotype of the restorative rice with low cadmium accumulation in grains under cadmium treatment in Example 3

[0112] I. Experimental methods

[0113] (1) Disinfection and germination of rice seeds

[0114] Select plump WT rice seeds, oshma3 oslct1 double mutant rice seeds prepared in Example 1, and oshma3oslct1 double mutant rice seeds expressing Cd-binding autophagy adaptor protein AIM-SpMTL-GFP prepared in Example 2 respectively. After washing them with clean water, soak them in 10 mL of 75% alcohol (v / v) for disinfection for 2 min. Pour out the alcohol and rinse with deionized water for 3 - 5 times. Then put the rice seeds into 10 mL of 50% sodium hypochlorite solution and soak them with shaking for 10 min. Discard the sodium hypochlorite soaking solution and rinse with 10 mL of deionized water for more than 3 times to thoroughly wash away the residual soaking solution. Place the disinfected seeds on moist filter paper and culture them in the dark in an incubator at 28°C for 2 d to obtain germinated seeds.

[0115] (2) Cultivation of rice

[0116] Transfer the germinated seeds to a light incubator (12 h light, 28°C, 12 h dark, 22°C, light intensity is 300 μMol·m -2 ·s -1 , relative humidity 60%) for cultivation. After the rice seedlings grow to the two-leaf stage (about 3 - 5 d), thin out the seedlings. Select rice seedlings with similar growth vigor and culture them in a hydroponic box, and change the hydroponic solution (Coolaber, NS1040) every 3 d.

[0117] (3) Cd-treated hydroponics

[0118] After 14 d of seed germination, use a hydroponic solution with a Cd concentration of 2 μM for cultivation, change the hydroponic solution every 3 d, culture for 2 weeks, and measure the root length and plant height of the rice.

[0119] II. Experimental results

[0120] As Figure 4 shown, under cadmium stress, there are significant differences in the root length and plant height between the oshma3oslct1 double mutant rice expressing Cd-binding autophagy adaptor protein AIM-SpMTL-GFP and the oshma3 oslct1 double mutant rice, indicating that the expression of Cd-binding autophagy adaptor protein AIM-SpMTL-GFP in rice can endow rice with better cadmium tolerance.

[0121] Example 4 Cadmium-specific Dye Shows that Cd-binding Autophagy Adaptor AIM-SpMTL Enriches Cadmium in Leaf Vacuoles

[0122] I. Experimental Methods

[0123] The material used in this example was the Arabidopsis cadmium-sensitive mutant abcc1 abcc2 transfected with the Cd-binding autophagy adaptor AIM-SpMTL-mCherry. This material was constructed by homologous recombination of the fusion fragment AIM-SpMTL-mCherry into the pEGAD vector, and the homozygous plants were obtained by screening the seeds after Agrobacterium infection of the Arabidopsis cadmium-sensitive mutant abcc1 abcc2. AIM-SpMTL-mCherry was fused by overlap PCR of the fragments AIM-SpMTL and mCherry. The PCR reaction system was (50 μL): Phanta-max super-fidelity DNA polymerase (1 μL), AIM-F (2 μL), mCherry-R (2 μL), 2×Phanta max buffer (25 μL), dNTP mix (1 μL), mCherry fragment (0.5 μL), AIM-SpMTL (0.5 μL), dH 2 O (18 μL). The amplification primers for the mCherry fragment were: mCherry-FCTCGTGCAATTGCACTAGTATGGTGAGCAAGGGCGAG (SEQ ID NO:40), mCherry-R

[0124] TTATCTAGATCCGGTGGCTCCCTACTTGTACAGCTCGTCCATGCC (SEQ ID NO:41).

[0125] 1. Preparation of Protoplasts

[0126] (1) Vernalization

[0127] Seeds of the Arabidopsis cadmium-sensitive mutant abcc1 abcc2 and the homozygous lines of the Arabidopsis cadmium-sensitive mutant abcc1 abcc2 transfected with the Cd-binding autophagy adaptor AIM-SpMTL-mCherry were sterilized with chlorine gas (100 mL of 84 disinfectant and 3 mL of concentrated hydrochloric acid were mixed to generate chlorine gas through an oxidation-reduction reaction) for 4 h. After sterilization, the seeds were added with water and vernalized in a 4°C refrigerator for 2 days.

[0128] The vernalized seeds were spotted on MS solid medium containing 0.7% agarose and then germinated in a 22°C light incubator for 5 days. After 5 days, the seedlings on the MS medium were transplanted to soil culture. After 1 week of soil culture, ddH containing a Cd concentration of 50 μM2 Treat with O for one week (irrigate with 1 L of ddH containing Cd 2 O, irrigate twice a week), and use the treated Arabidopsis thaliana leaves to prepare protoplasts.

[0129] (2) Enzymolysis

[0130] Prepare the enzymolysis solution, and the preparation method is shown in Table 5.

[0131] Table 5 Formulation

[0132]

[0133] After mixing the solvent formulations in Table 5 in proportion, place them in an oven at 55 °C for 10 min. When the enzyme solution to be dissolved is transparent light brown, take it out. After cooling to room temperature, add 0.01 M CaCl 2 and BSA to obtain the enzymolysis solution for Arabidopsis thaliana protoplasts.

[0134] Use art tape and transparent tape to peel off the lower epidermis of the leaf, immerse the peeled side downward in the enzymolysis solution. Place it on a shaker and dissociate it in the dark at low speed (20 °C, 30 rpm) for 1 - 2 h. Use a cut 1 mL pipette tip to suck the enzymolyzed liquid into a round-bottom centrifuge tube, and centrifuge at 100 rcf for 3 min. Gently aspirate the supernatant, then add 5 mL of W5 solution (preparation method shown in Table 6) along the tube wall to wash, centrifuge at 100 rcf for 3 min, and repeat 2 times.

[0135] Table 6 Formulation of W5 Solution

[0136]

[0137] Then add 3 - 5 mL of W5 solution and incubate in an ice bath for 30 min. Finally, gently aspirate the supernatant and add 3 - 5 mL of MMg solution (preparation method shown in Table 7) to prepare protoplasts.

[0138] Table 7 Formulation of MMg Solution

[0139]

[0140] 2.Leadmium TM Staining of Arabidopsis thaliana Protoplasts with Green AM Dye

[0141] First, prepare the Leadmium TM Green AM Dye solution: Add 50 μg of Leadmium TM Green AMDye to each tube. Warm it to room temperature before use and keep it away from light. To the tube containing Leadmium TMAdd 50 μL of anhydrous DMSO to the centrifuge tube containing Green AM Dye, mix well in the dark to dissolve. Dilute the DMSO stock solution of the dye into a working solution at a volume ratio of 1:10 with 0.85% normal saline. Take 1 mL of the prepared protoplasts, add 5 μL of Leadmium TM working solution of Green AM Dye, incubate at 4 °C in the dark for 1 h, and gently shake and mix every 15 - 20 min. Finally, wash 2 - 3 times with 1 mL of MMg solution, centrifuge at 100 g for 2 min at 18 °C, and discard the supernatant. Resuspend the protoplasts in 1 mL of MMg solution and keep in the dark for half an hour. Detect under a fluorescence microscope.

[0142] II. Experimental Results

[0143] As Figure 5 shown, it was observed under the microscope that Cd in the leaf protoplasts of abcc1 abcc2 was present in the cytoplasm and did not enter the vacuole. However, in the leaf protoplasts of the cadmium-sensitive mutant abcc1 abcc2 transfected with the Cd-binding autophagy adaptor protein AIM-SpMTL-mCherry, green fluorescence appeared in the vacuole, indicating that Cd was localized in the vacuole, and red fluorescence also appeared in the vacuole, indicating that the Cd-binding adaptor protein AIM-SpMTL-mCherry was also localized in the vacuole. Such results show that the Cd-binding autophagy adaptor protein AIM-SpMTL-mCherry can successfully enter the plant leaf vacuole and can also bring Cd into the plant leaf vacuole, increasing the accumulation of Cd in plant leaves through the autophagy pathway.

[0144] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A method for creating cadmium - enriched rice straw resistant to cadmium, characterized in that, clone the composition into a vector to construct a recombinant vector, transform the wild - type rice with the recombinant vector, and identify the obtained transformed seedlings to obtain the cadmium - enriched rice straw resistant to cadmium; the composition comprises an sgRNA expression cassette specifically targeting the OsHMA3 gene, an sgRNA expression cassette specifically targeting the OsLCT1 gene, and a coding gene expressing an autophagy - related adaptor protein; the nucleotide sequence of the sgRNA expression cassette specifically targeting the OsHMA3 gene is as shown in SEQ ID NO:1 - 2, the nucleotide sequence of the sgRNA expression cassette specifically targeting the OsLCT1 gene is as shown in SEQ ID NO:3 - 4, and the nucleotide sequence of the coding gene expressing the autophagy - related adaptor protein is as shown in SEQ ID NO:5; the upstream of the coding gene expressing the autophagy - related adaptor protein further contains a green tissue - specific expression promoter.

2. The method according to claim 1, characterized in that, the green tissue - specific expression promoter is GSSP3.

3. The method according to claim 1 or 2, characterized in that, the identification is to use the DNA of the transformed seedlings as a template, design primers for PCR amplification and sequencing to confirm the successful construction of the transformed seedlings.

4. The method according to claim 1 or 2, characterized in that, The vector is the binary vector pYLCRISPR / Cas9P ubi -H.

5. Use of the cadmium - enriched rice straw resistant to cadmium obtained by the method according to any one of claims 1 - 4 in resisting cadmium pollution in rice.

6. The use according to claim 5, characterized in that, the resistance to cadmium pollution in rice is resistance to cadmium accumulation in rice grains and / or remediation of cadmium - polluted paddy fields.

Images