Application of osralf6 gene and / or osralf6 protein in promoting rice growth
By targeting and editing the OsRALF6 gene in rice to reduce its expression level, an OsRALF6 loss-of-function mutant was constructed, which solved the problem of insufficient root and panicle growth and development in rice, and improved rice growth and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-10-22
- Publication Date
- 2026-05-19
AI Technical Summary
There are few reports on the effects of the OsRALF6 gene and OsRALF6 protein on the growth and development of rice roots and panicles in the existing technology, and the taproot degenerates within ten days after germination, affecting rice growth and yield.
The OsRALF6 gene was targeted and edited in rice using a genome-targeting editing system, resulting in OsRALF6 loss of function. Then, gRNA, CRISPR/CAS9 vector, and Agrobacterium EHA105 were used to reduce the expression levels of the OsRALF6 gene and protein, thus constructing OsRALF6 loss-of-function mutant rice.
It significantly promotes the growth of rice roots and panicles, increases taproot and panicle length, improves rice yield, and provides new molecular breeding resources.
Smart Images
Figure CN119242693B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to the application of the OsRALF6 gene and / or OsRALF6 protein in promoting rice growth. Background Technology
[0002] Plant roots are crucial not only for absorbing water and nutrients to sustain life but also for providing mechanical support and keeping the plant upright. Cereal plants have a fibrous root system, primarily composed of post-embryonic adventitious roots, also known as nodal roots or crown roots, which arise from the base of the stem nodes. During embryogenesis, the root apical meristem (RAM) differentiates, producing the radicle, followed by five crown roots emerging from the nodes of the coleoptile. The post-embryonic crown roots develop from the base of the nodes of the main stem and tillers. Both the taproot and crown roots can branch to produce two types of secondary roots: large lateral roots and small lateral roots. Small lateral roots do not produce further branches, while large lateral roots can produce even smaller lateral roots. The taproot plays a vital role for a period after seed germination, until about ten days later, when it degenerates and the crown roots begin to function. Although the taproot only functions for the first ten days after germination, its normal development is crucial for the growth of seedlings.
[0003] The elongation of the taproot is influenced by a variety of factors, including the rapid-alkalinization factor (RALF). The structure of the RALF mainly consists of a signal peptide at the N-terminus and a conserved RALF domain at the C-terminus. The RALF family is very large, and the functions of each member are complex and diverse. There are at least 35 RALF members in Arabidopsis thaliana, and each member has different effects on root growth. Some inhibit root growth to varying degrees, while others promote root development (Qiang Xiaonan, Li Xin, Chen Jia, Liao Hongdong, Yu Feng. Preliminary analysis of the functional diversity of the Arabidopsis thaliana RALF polypeptide family [J]. Biotechnology Bulletin, 2019, 35(1):2-10.).
[0004] Rice is one of my country's most important food crops, and its yield directly affects the country's food security. The growth and development of roots and panicles determine rice yield. Root length and panicle length are two important growth indicators, representing the growth of the underground part (root system) and the above-ground part (panicle) of the rice plant, respectively. Promoting root and panicle growth and development helps increase rice yield. There are over 40 RALF members in rice (OsRALFs); however, the effects of OsRALFs on root and panicle growth and development in rice have been rarely reported to date. Summary of the Invention
[0005] To address the aforementioned problems in the prior art, this invention provides the application of the OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.
[0006] The first objective of this invention is to provide the application of the OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.
[0007] A second objective of this invention is to provide the application of the OsRALF6 gene and / or OsRALF6 protein in promoting root and / or panicle growth in rice.
[0008] A third objective of this invention is to provide the application of the OsRALF6 gene and / or OsRALF6 protein in increasing rice yield.
[0009] A fourth objective of this invention is to provide the application of reagents that inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.
[0010] A fifth objective of this invention is to provide the application of reagents that inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein in promoting root and / or panicle growth in rice.
[0011] The sixth objective of this invention is to provide the application of reagents that inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein in increasing rice yield.
[0012] The seventh objective of this invention is to provide a method for promoting rice growth.
[0013] To achieve the above objectives, the present invention is implemented through the following solution:
[0014] This invention utilizes a genome-targeting editing system to target and edit the OsRALF6 gene in rice, causing mutations in the target gene. These mutations result in base deletions and additions, preventing the production of the normally encoded OsRALF6 protein, thus obtaining OsRALF6 loss-of-function mutant rice. Compared to wild-type rice, the OsRALF6 loss-of-function mutant rice exhibits significantly different growth phenotypes, such as increased root length and increased panicle length.
[0015] This invention seeks protection for the following:
[0016] Application of OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.
[0017] Application of the OsRALF6 gene and / or OsRALF6 protein in promoting root and / or panicle growth in rice.
[0018] Application of OsRALF6 gene and / or OsRALF6 protein in improving rice yield.
[0019] Application of reagents that inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein in promoting rice growth.
[0020] Application of reagents that inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein in promoting root and / or panicle growth in rice.
[0021] Application of reagents that inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein in improving rice yield.
[0022] The reagent used to inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein causes the OsRALF6 gene to undergo base deletion, addition, or substitution, preventing it from properly encoding the OsRALF6 protein, resulting in reduced expression or absence of the OsRALF6 protein.
[0023] Preferably, the reagent includes gRNA, recombinant expression vector, or recombinant microorganisms targeting the OsRALF6 gene and / or OsRALF6 protein.
[0024] More preferably, the nucleotide sequence of the target site of the gRNA, recombinant expression vector, or recombinant microorganism is as shown in SEQ ID NO: 3, the completely complementary sequence of the sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, or the completely complementary sequence of the sequence shown in SEQ ID NO: 4.
[0025] More preferably, the gRNA comprises a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 5 or a completely complementary sequence to the sequence shown in SEQ ID NO: 5.
[0026] More preferably, the recombinant expression vector includes a CRISPR / CAS9 vector.
[0027] More preferably, the CRISPR / CAS9 vector is the pYLCRISPR / Cas9-MH vector in the prior art “CN115011618A”.
[0028] More preferably, the recombinant microorganism includes Agrobacterium.
[0029] More preferably, the Agrobacterium is EHA105.
[0030] A method to promote rice growth by reducing the expression levels of the OsRALF6 gene and / or OsRALF6 protein in rice.
[0031] Preferably, rice is treated with a reagent that inhibits the expression of the OsRALF6 gene and / or OsRALF6 protein.
[0032] The reagent used to inhibit the expression of the OsRALF6 gene and / or OsRALF6 protein causes the OsRALF6 gene to undergo base deletion, addition, or substitution, preventing it from properly encoding the OsRALF6 protein, resulting in reduced expression or absence of the OsRALF6 protein.
[0033] More preferably, the reagent includes gRNA, recombinant expression vector, or recombinant microorganisms targeting the OsRALF6 gene and / or OsRALF6 protein.
[0034] More preferably, the nucleotide sequence of the target site of the gRNA, recombinant expression vector, or recombinant microorganism is as shown in SEQ ID NO: 3, the completely complementary sequence of the sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, or the completely complementary sequence of the sequence shown in SEQ ID NO: 4.
[0035] More preferably, the gRNA comprises a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 5 or a completely complementary sequence to the sequence shown in SEQ ID NO: 5.
[0036] More preferably, the recombinant expression vector includes a CRISPR / CAS9 vector.
[0037] More preferably, the CRISPR / CAS9 vector is the pYLCRISPR / Cas9-MH vector in the prior art “CN115011618A”.
[0038] More preferably, the recombinant microorganism includes Agrobacterium.
[0039] More preferably, the Agrobacterium is EHA105.
[0040] Compared with the prior art, the present invention has the following beneficial effects:
[0041] This invention reveals for the first time the function of the rice rapid alkalization factor OsRALF6 gene. Inhibiting the expression of the OsRALF6 gene and protein in rice significantly promotes root and panicle growth. A stable homozygous mutant with the OsRALF6 gene knocked out was constructed. This invention provides a new molecular breeding resource for promoting rice growth and cultivating high-yielding rice varieties, and has significant application value in agricultural planting and production. Attached Figure Description
[0042] Figure 1The following shows the editing status of the OsRALF6 gene. a) is a schematic diagram of the OsRALF6 gene structure. The OsRALF6 gene has only one exon. Two gene editing target sites, T1 and T2, were selected from its exon as the target editing sites. b) shows the gene editing status of the four stable OsRALF6 gene mutant lines obtained. Bold text indicates that there is a base insertion at the gene editing target site, and * indicates that there is a base deletion at the gene editing target site.
[0043] Figure 2 Phenotypic and statistical data of increased taproot length in osralf6 mutant; a) Photograph of rice taproot after 5 days of culture, scale bar = 1cm; b) Quantitative statistical results of taproot length in ZH11 and ralf6 mutants, statistical sample n = 20, error bar ±SD, asterisk represents significance (one-way ANOVA, *** indicates extremely significant difference, P ≤ 0.0001).
[0044] Figure 3 The spectrum of the PET-32a(+) carrier.
[0045] Figure 4 The results of SDS-PAGE gel coomassie blue staining for identification of recombinant OsRALF6 fusion protein are shown. All three lanes are elution samples.
[0046] Figure 5 Phenotypic and statistical graphs of the inhibitory effect of exogenous OsRALF6 protein on rice taproot; a is a photograph of rice taproot after 7 days of culture, scale bar = 1 cm; b is the statistical results of taproot length in a, statistical sample n = 8, error bar is ±SD (one-way ANOVA, *** indicates extremely significant difference, P≤0.0001).
[0047] Figure 6 Phenotypic and statistical graphs of panicle length in mature ZH11 and ralf6 mutants; a is a photograph of mature rice panicle length, scale bar = 5cm; b is a statistical graph of panicle length in a, statistical sample n = 6, error bar is ±SD (one-way ANOVA, ** indicates significant difference, P≤0.01). Detailed Implementation
[0048] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0049] Example 1: Construction and identification of rice OsRALF6 gene deletion mutant
[0050] 1. Construction of gene editing vectors
[0051] According to such Figure 1 The reference sequence (SEQ ID NO: 1) of the OsRALF6 gene in rice (variety: ZH11, LOC_Os01g25560) shown in a was identified, and gene editing target 1 (i.e. T1, nucleotide sequence: 5'-CTGCTCATCGCGCTGGCCAC-3' (SEQ ID NO: 3)) and gene editing target 2 (i.e. T2, nucleotide sequence: 5'-AGCTGGGAGCTCGGGGTTGT-3' (SEQ ID NO: 4)) for knocking out OsRALF6 protein (SEQ ID NO: 2) were determined.
[0052] Following the method described in the existing technology “CN115011618A”, a gRNA expression cassette (linked with gRNA (nucleotide sequence: 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAGAGCTTGGAGTGGAT GGACC-3' (SEQ ID NO: 5)) was constructed and ligated into the pYLCRISPR / Cas9-MH vector. The cassette was then transformed into E. coli competent cells (DH5α) using conventional methods. After cloning culture and sequencing identification, plasmids were extracted from the positive clones that were identified as correct, thus obtaining the gene editing fusion vector pYLCRISPR / Cas9-OsRALF6.
[0053] 2. Conversion Screening
[0054] The embryonic formation of callus in wild-type rice (ZH11) was induced over a period of approximately one month. The pYLCRISPR / Cas9-OsRALF6 vector was introduced into the callus via Agrobacterium tumefaciens (EHA105) infection. The callus was then incubated in the dark at 28°C for two days. Afterward, the infected callus was thoroughly washed with sterile water and dried in a laminar flow hood. Following standard procedures, positive transgenic regenerated seedlings were obtained through screening (2 weeks), pre-differentiation (2 weeks), differentiation (1 month), and rooting (2 weeks).
[0055] 3. Identification of transgenic plants
[0056] Sequencing primers RALF6-F and RALF6-R were designed in the UTR region of the RALF6 gene. The positive transgenic regenerated seedlings obtained in the previous screening were sequenced and identified using primers RALF6-F (5'-CCAATTCCTCCTCCTCCTCC-3') and RALF6-R (5'-CGGACACATGTACAGTGTACAT-3'). Four stable genetic OsRALF6 gene deletion mutants (i.e., ralf6 mutants) were obtained: ralf6-L1, ralf6-L5, ralf6-L10, and ralf6-L11. Their gene editing details are as follows: Figure 1 As shown in b, all four ralf6 mutants exhibited the absence of normal OsRALF6 protein due to gene editing that caused frameshifts or premature termination of the OsRALF6 protein, indicating that the ralf6 mutants were successfully constructed.
[0057] Example 2: Effect of OsRALF6 protein deficiency on rice root length
[0058] 1. Rice sowing and cultivation
[0059] The seeds of wild-type rice (ZH11) and the four ralf6 mutants (ralf6-L1, ralf6-L5, ralf6-L10 and ralf6-L11) constructed in Example 1 were dehulled, surface-sterilized with 25% sodium hypochlorite, and then sown in culture flasks containing 1 / 2 MS medium in a clean bench and cultured according to conventional methods.
[0060] Five days after the rice seedlings have grown, they are removed for photographing and taproot length measurement. Taproot length is measured using ImageJ software, and the data are analyzed for significance and plotted using Graphpad software.
[0061] 2. Root length statistics
[0062] like Figure 2 As shown in a and b, the taproot length of ZH11 seedlings was approximately 4 cm, while the taproot length of the four ralf6 mutant seedlings ranged from 5 to 5.3 cm. This indicates that the taproot length of the ralf6 mutants was significantly greater than that of ZH11. This suggests that the deletion of the OsRALF6 protein increases root length in rice and promotes root growth.
[0063] Example 3: Effect of OsRALF6 protein addition on rice root length
[0064] 1. Construction of the OsRALF6 protein recombinant expression vector
[0065] The RALF6 genome coding region (SEQ ID NO: 1) was ligated to... Figure 3The EcoRI and HindIII sites of the PET-32a(+) expression vector (containing a 6×His tag at both the N-terminus and C-terminus, and a TrxA colysin tag at the N-terminus) were then transformed into competent E. coli cells (DH5α). After cloning culture and sequencing identification, the positive clones with correct identification results were subjected to plasmid extraction to obtain the OsRALF6 protein recombinant expression vector, denoted as PET-32a-OsRALF6 vector.
[0066] 2. Prokaryotic expression and purification of recombinant OsRALF6 protein
[0067] The PET-32a-OsRALF6 vector was transformed into competent E. coli cells (BL21). Single colonies were picked and cultured in LB medium until OD = 0.6–0.8. IPTG was added to a final concentration of 1 mM, and induction was performed at 37°C and 160 rpm for 4 h. The culture supernatant containing the recombinant OsRALF6 fusion protein was collected and purified using Ni-NTA agarose. The eluent was collected and identified by SDS-PAGE gel electrophoresis and Coomassie blue staining. The results are as follows: Figure 4 As shown, the protein band size is as expected, indicating that the recombinant OsRALF6 fusion protein was successfully obtained.
[0068] 3. Rice sowing and cultivation
[0069] Wild-type rice (ZH11) seeds were dehulled, surface-sterilized with 25% sodium hypochlorite, and then sown in culture flasks containing 1 / 2 MS medium in a clean bench. Recombinant OsRALF6 fusion protein (i.e., +RALF6) was added to a final concentration of 0.5 μM and cultured. The control (i.e., MOCK) was used without the addition of recombinant OsRALF6 fusion protein.
[0070] Seven days after the rice seedlings have grown, they are removed for photographing and taproot length measurement. Taproot length is measured using ImageJ software, and the data are analyzed for significance and plotted using Graphpad software.
[0071] 4. Root length statistics
[0072] like Figure 5 As shown in a and b, compared with the control, the primary root of ZH11 was significantly shorter when OsRALF6 protein was applied. This indicates that OsRALF6 protein can significantly inhibit the growth of rice roots.
[0073] Example 4: Effect of OsRALF6 protein deficiency on rice panicle length
[0074] 1. Field cultivation
[0075] Wild-type rice (ZH11) and two ralf6 mutants (ralf6-L1 and ralf6-L11) constructed in Example 1 were transplanted into paddy fields for field cultivation after conventional sowing and seedling raising.
[0076] After the rice reached the yellow ripening stage, the main panicles were collected, photographed, and their length measured. Six data points were collected from each sample. The length of the main panicle was measured using ImageJ software, and the data were analyzed for significance and plotted using Graphpad software.
[0077] 2. Ear length statistics
[0078] like Figure 6 As shown in a and b, the average panicle length of ZH11 is approximately 18.9 cm, while the panicle lengths of ralf6-L1 and ralf6-L11 are 22.1 cm and 21.9 cm, respectively. This indicates that the panicle length of the ralf6 mutant is significantly greater than that of ZH11. This demonstrates that the deletion of the OsRALF6 protein increases panicle length in rice and promotes panicle growth.
[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. Inhibition OsRALF6 The application of reagents for gene and / or OsRALF6 protein expression in promoting panicle growth in rice, characterized by: The OsRALF6 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the OsRALF6 protein is shown in SEQ ID NO:
2.
2. The application according to claim 1, characterized in that, The reagent includes OsRALF6 Genes as targets: gRNA, recombinant expression vectors, or recombinant microorganisms.
3. The application according to claim 2, characterized in that, The nucleotide sequence of the target site of the gRNA, recombinant expression vector, or recombinant microorganism is shown in SEQ ID NO: 3, the completely complementary sequence of the sequence shown in SEQ ID NO: 3, or the completely complementary sequence of the sequence shown in SEQ ID NO:
4.
4. A method for promoting panicle growth in rice, characterized in that, reduce OsRALF6 The expression levels of the gene and / or OsRALF6 protein in rice, the OsRALF6 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the OsRALF6 protein is shown in SEQ ID NO: 2.