A method for introducing an exogenous caffeic acid synthesis pathway to improve the light intensity of a plant

Abstract

The present application relates to a method for introducing an exogenous caffeic acid synthesis pathway to improve the light intensity of plants, and introducing TAL genes and P450 genes into plants to obtain a significant up-regulation effect of caffeic acid expression amount. This may be because the introduction of TAL genes and P450 genes promotes the deamination of L-DOPA, increases the accumulation amount of L-DOPA, and further effectively increases the caffeic acid expression amount in plants. Based on this pathway, the synthesis of luciferin in plants is increased to enhance the light intensity of plants.

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology technology and relates to a method for introducing an exogenous caffeic acid synthesis pathway to improve the luminescence intensity of plants. Background Technology

[0002] The process of catalytically generating luciferin using caffeic acid as a substrate is as follows:

[0003] Step 1: Caffeic acid reacts with propionyl-CoA to produce milk alkaloids.

[0004] Catalytic enzyme: Hispidin Synthase (Hisps)

[0005] Reaction description: Caffeic acid, catalyzed by milk alkaloid synthase, combines with propionyl-CoA to form milk alkaloid (hispidin).

[0006] Caffeic acid + 2 propionyl-CoA + 2ATP → milk alkaloids + 2CO2 + H2O + 2AMP

[0007] Step 2: Hydroxylation of milk alkaloids to generate 3-hydroxymilk alkaloids

[0008] Catalytic enzyme: Hispidin hydroxylase (H3H)

[0009] Reaction Description: Milk alkaloids undergo a hydroxylation reaction under the action of milk alkaloid hydroxylase to generate 3-hydroxymilk alkaloids.

[0010] Milk alkaloids + O2 + NADPH + H + →3-Hydroxymilk alkaloid + H2O + NADP +

[0011] Step 3: Oxidation of 3-hydroxymilk alkaloids to produce caffeoylpyruvic acid

[0012] Catalytic enzyme: Luciferase (LUZ)

[0013] Reaction description: 3-hydroxymilk alkaloids are oxidized to luciferin under the catalysis of luciferase, and luminescence is produced.

[0014]

[0015] Through these three steps, caffeic acid and pyruvate are converted into caffeoylpyruvate via an enzymatic reaction, thus achieving bioluminescence.

[0016] Step 4: Oxidation of 3-hydroxymilk alkaloids to produce caffeoylpyruvic acid

[0017] Catalytic enzyme: caffeoyl pyruvate hydrolase (CPH)

[0018] Reaction description: Caffeoylpyruvate is catalyzed by caffeoylpyruvate hydrolase to generate caffeic acid, thereby regenerating caffeic acid and achieving the purpose of cyclic luminescence.

[0019] Caffeoylpyruvic acid + H2O → Caffeic acid + Pyruvic acid.

[0020] This process has been applied in fungi and transgenic plants. Caffeic acid is an important substrate for catalyzing the production of luciferin, and the sufficiency of caffeic acid supply directly affects the luminescence intensity of luminescent plants. When the supply of endogenous caffeic acid in plants is insufficient, the luminescence intensity is greatly reduced.

[0021] The biosynthetic pathway of caffeic acid can be divided into two modules (such as...) Figure 1 As shown):

[0022] (1) L-tyrosine is synthesized from carbon sources via glycolysis, the pentose phosphate pathway, and the shikimate pathway. Figure 1 (A)

[0023] (2) Caffeic acid is produced by the continuous deamination and hydroxylation of L-tyrosine. Figure 1 (B)

[0024] Because the content of endogenous caffeic acid in plants is very low, and caffeic acid is a substrate for plant luminescence, the luminescence intensity is affected by the endogenous caffeic acid in plants, and the luminescence intensity is generally low. Summary of the Invention

[0025] In view of this, the purpose of the present invention is to provide a method for introducing an exogenous caffeic acid synthesis pathway to improve the luminescence intensity of plants.

[0026] To achieve the above objectives, the present invention provides the following technical solution:

[0027] A method for introducing an exogenous caffeic acid synthesis pathway to enhance plant luminescence intensity involves introducing the TAL gene (from Flavobacterium johnsoniae) and the P450 gene (from Beta vulgaris) into the plant. The nucleotide sequence of the TAL gene is shown in SEQ ID NO.1, and the nucleotide sequence of the P450 gene is shown in SEQ ID NO.2.

[0028] As one of the preferred technical solutions, the plant is Nicotiana benthamiana.

[0029] As one of the preferred technical solutions, the specific steps are as follows:

[0030] (1) Gene cloning and vector construction: The Luz gene, H3H gene, CPH gene, HispS gene, TAL gene and P450 gene were linked into the pCAMBIA2300 vector.

[0031] (2) Transformation and screening;

[0032] (3) Agrobacterium-mediated transformation;

[0033] (4) Plant transformation.

[0034] As one of the further preferred technical solutions, the specific method of step (1) is as follows:

[0035] (1-1) Design primers and use high-fidelity polymerase to amplify the gene by PCR;

[0036] (1-2) Double enzyme digestion, ligation reaction, vector transformation of Escherichia coli.

[0037] As a further preferred technical solution, in step (1-1), the primers are as follows:

[0038] Public-F: ACAGCTATGACCATGATTACGAATTC, as shown in SEQ ID NO.3;

[0039] Public-R: AGTCACGACGTTGTAAAACGACGG, as shown in SEQ ID NO.4.

[0040] As one of the further preferred technical solutions, the PCR amplification system and reaction conditions in step (1-1) are shown in Table 1.

[0041] Table 1. Gene Cloning Reaction System

[0042]

[0043] After the PCR reaction, the DNA was extracted and recovered using a gel according to the instructions of the Novizan gel extraction kit. The recovered product was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to determine the gene sequence. Primer sequences and detection sequences are shown in Table 2.

[0044] Table 2. Primer sequences and detection sequences

[0045]

[0046] As a further preferred technical solution, in step (1-2), double digestion is performed using restriction endonucleases EcoRI and HindIII.

[0047] As a further preferred technical solution, in step (1-2), a seamless cloning kit is used to ligate the amplified gene with the enzyme-digested vector, and each gene carries a 35S promoter and a CaMV poly(A) terminator.

[0048] As a further preferred technical solution, in step (1-2), the ligation product is transformed into competent Escherichia coli DH5α by heat shock, and positive clones are screened on LB plates containing 50 mg / L Kan.

[0049] As one of the further preferred technical solutions, the specific method of step (2) is as follows:

[0050] (2-1) Escherichia coli culture: Select positive clones and culture them in 10 ml of LB containing 50 mg / L kan;

[0051] (2-2) Plasmid extraction: Recombinant plasmids were extracted using a plasmid mini-extraction kit;

[0052] (2-3) Plasmid preservation: The plasmid was frozen in a refrigerator at -20℃ for later use.

[0053] As one of the further preferred technical solutions, the specific method of step (3) is as follows:

[0054] (3-1) Transform the plasmid into Agrobacterium GV3101 competent cells;

[0055] (3-2) Screening for transformed Agrobacterium: Transformed Agrobacterium was screened on YEP plates containing antibiotics (50 mg / L Kan, 25 mg / L Rif, 50 mg / L Gen).

[0056] As one of the further preferred technical solutions, the specific method of step (4) is as follows:

[0057] (4-1) Preparation of plant materials: Select tobacco leaves suitable for conversion and cut the leaves into 0.5cm*0.5cm pieces;

[0058] (4-2) Leaf disc transformation: Plant leaf discs were soaked in Agrobacterium suspension at 28°C for 30 minutes and then transferred to co-culture medium.

[0059] (4-3) Co-culture and screening: The culture was carried out in the dark at 28°C for 2 days on the co-culture medium, and then transferred to the selective medium containing selective antibiotics;

[0060] (4-4) Regeneration and rooting: After about 2-3 weeks, resistant shoots are selected and induced to root in rooting medium;

[0061] (4-5) Transplanting and growth of tobacco: After rooting, the tobacco plants were transplanted into the soil and managed in a greenhouse with a light intensity of 6000 Lx and 16 h / day.

[0062] (4-6) Transgenic identification: Samples of transplanted tobacco were taken and DNA was extracted using the CTAB method, and PCR was used for positive identification.

[0063] As one of the further preferred technical solutions, the reaction system and reaction conditions for PCR positive identification in steps (4-6) are shown in Table 3.

[0064] Table 3. Transgenic Identification

[0065]

[0066] The beneficial effects of this invention are as follows:

[0067] Since the content of endogenous caffeic acid in plants is very low, and caffeic acid is a substrate for plant luminescence, the intensity of luminescence is affected by the plant's endogenous caffeic acid. Introducing an exogenous caffeic acid synthesis pathway can enhance caffeic acid synthesis, thereby increasing the concentration of luminescent substrates and thus enhancing the intensity of plant luminescence.

[0068] To improve the expression level of caffeic acid in plants and achieve better luminescence, this invention introduces an additional caffeic acid synthesis pathway in addition to the caffeic acid synthesized by the plant itself, thereby increasing the content of caffeic acid, which is crucial in the synthesis of luciferin, and thus improving the luminescence intensity.

[0069] Specifically, this invention introduces the TAL gene and the P450 gene. The applicant discovered that, compared to introducing the TAL gene or the P450 gene alone, simultaneously introducing the TAL gene and the P450 gene into plants resulted in a significant upregulation of caffeic acid expression. This is likely because the introduction of the TAL gene and the P450 gene promotes the deamination of L-DOPA, increasing L-DOPA accumulation and thus effectively enhancing caffeic acid expression in plants. Based on this pathway, the synthesis of luciferin in plants increases, thereby enhancing plant luminescence intensity. Attached Figure Description

[0070] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0071] Figure 1 The biosynthetic pathway of caffeic acid is as follows: A: L-tyrosine is synthesized from a carbon source via glycolysis, pentose phosphate, and shikimate pathways; B: caffeic acid is generated from the successive deamination and hydroxylation of L-tyrosine.

[0072] Figure 2The caffeic acid content (A) and relative luminescence intensity (B) of different genes were introduced;

[0073] Figure 3 Photographs of plant bioluminescence with different genes are provided. In the image, A represents bioluminescence, B represents bioluminescence + P450, C represents bioluminescence + TAL, and D represents bioluminescence + P450 + TAL.

[0074] Figure 4 The gene structure is denoted as A, where A is FBP, B is FBP+P450, C is FBP+TAL, and D is FBP+TAL+P450.

[0075] Figure 5 DNA map of the pCAMBIA2300 vector.

[0076] Figure 6 To construct the T-DNA map of the vector, where A represents FBP, B represents FBP+P450, C represents FBP+TAL, and D represents FBP+TAL+P450. Detailed Implementation

[0077] The preferred embodiment of the pCAMBIA2300-FBP+P450 carrier construction of the present invention will now be described in detail with reference to the accompanying drawings.

[0078] Example:

[0079] 1. Gene cloning and vector construction

[0080] Gene Synthesis and Acquisition: The sequences of the Luz gene (SEQ ID NO.5), H3H gene (SEQ ID NO.6), CPH gene (SEQ ID NO.7), HispS gene (SEQ ID NO.8 and SEQ ID NO.9 sequentially linked), TAL gene (SEQ ID NO.1), and P450 gene (SEQ ID NO.2) were obtained through gene synthesis (Beijing Qingke Biotechnology Co., Ltd.). Primers were designed to ligate the genes into the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd., DNA map available). Figure 5 The 2× high-fidelity PCR mix above was purchased from Nanjing Novizan Biotechnology Co., Ltd. (Catalog No.: P520-01).

[0081] PCR amplification: Genes were amplified by PCR using high-fidelity polymerase. See Table 1 for details, where seq1 represents the FBP luminescent gene cluster + P450 gene + TAL gene.

[0082] After the PCR reaction, the DNA was extracted and recovered using a gel according to the instructions of the Novizan gel extraction kit. The recovered product was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to determine the gene sequence. See Table 2 for details.

[0083] Double digestion: The pCAMBIA2300 vector was double-digested with restriction endonucleases EcoRI and HindIII (the endonucleases were purchased from New England Biolabs). (Table 4)

[0084] Table 4. Double enzyme digestion of pCAMBIA2300 vector

[0085]

[0086]

[0087] Ligation reaction: The amplified genes were ligated with enzyme-digested vectors using a seamless cloning kit (purchased from Beijing Bomed Gene Technology Co., Ltd.). Each gene carried a 35S promoter and a CaMV poly(A) terminator.

[0088] Vector transformation of Escherichia coli: The ligation product was transformed into competent Escherichia coli DH5α (purchased from Beijing Bomed Gene Technology Co., Ltd.) by heat shock, and positive clones were screened on LB plates containing 50 mg / L.

[0089] The synthesized FBP+TAL+P450 has the nucleotide sequences SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21 linked sequentially, and its gene structure is as follows: Figure 4 As shown in D.

[0090] The constructed vector T-DNA sequence is SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35, and SEQ ID NO.36 linked sequentially, as shown in the diagram. Figure 6 As shown in D.

[0091] 2. Conversion and Screening

[0092] Escherichia coli culture: Select positive clones and culture them in 10 ml of LB containing 50 mg / L kan.

[0093] Plasmid extraction: Recombinant plasmids were extracted using a plasmid mini-extraction kit (the kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.).

[0094] Plasmid preservation: Store the plasmid frozen in a refrigerator at -20°C for later use.

[0095] 3. Microbial detection and Agrobacterium-mediated transformation

[0096] Transformation of Agrobacterium: The plasmid was transformed into Agrobacterium GV3101 competent cells (purchased from Beijing Bomaide Gene Technology Co., Ltd.) according to the instructions.

[0097] Screening for transformed Agrobacterium: Transformed Agrobacterium was screened on YEP plates containing antibiotics (50 mg / L Kan + 50 mg / L Gen + 25 mg / L Rif). (Kan, Kanamycin, Gen, Gentamicin, Rif, and Rif were all purchased from Beijing Coolerbot Technology Co., Ltd.)

[0098] Culture and suspension preparation of Agrobacterium: Positive Agrobacterium clones were selected for liquid culture. The concentration of the suspension was adjusted to OD using MS infection medium (pH 5.8, containing 100 μM acetylsuccinone) as needed. 600 =0.6-0.8.

[0099] 4. Plant transformation

[0100] Plant material preparation: Select tobacco leaves suitable for conversion and cut the leaves into 0.5cm*0.5cm pieces.

[0101] Leaf disc transformation: Plant leaf discs were soaked in Agrobacterium suspension at 28°C for 30 min and then transferred to co-culture medium (MS + 1 mg / L 6-BA + 30 g / L sucrose + 6 g / L agar powder + 100 μM acetylsalicylic acid, pH 5.8).

[0102] Co-culture and screening: The samples were incubated in the dark at 28°C for 2 days on co-culture medium, and then transferred to selective medium containing selective antibiotics (MS + 1 mg / L 6-BA + 30 g / L sucrose + 6 g / L agar powder + 100 mg / L Kan, pH 5.8).

[0103] Regeneration and rooting: After about 2-3 weeks, resistant shoots were selected and induced to root in rooting medium (MS + 0.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar powder + 100 mg / L Kan, pH 5.8).

[0104] Transplanting and growth of tobacco: After rooting, the tobacco plants were transplanted into soil (peat:vermiculite:perlite = 5:3:1) and managed in a greenhouse with a light intensity of 6000 Lx and 16 h / day.

[0105] Transgenic identification: Samples were taken from transplanted tobacco plants, and DNA was extracted using the CTAB method, followed by PCR positive identification. (Table 3)

[0106] Comparative Example 1:

[0107] Gene synthesis and acquisition: The sequences of Luz, H3H, CPH and HispS genes were obtained through gene synthesis. Primers were designed to ligate the genes into the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.). 2× high-fidelity PCR mix was purchased from Nanjing Novizan Biotechnology Co., Ltd. (product number: P520-01).

[0108] During PCR amplification, in Table 1, seq1 represents the FBP luminescent gene cluster.

[0109] The synthesized FBP has the nucleotide sequences SEQ ID NO.10 and SEQ ID NO.11 linked sequentially, and its gene structure is as follows: Figure 4 As shown in Figure A.

[0110] The constructed vector T-DNA sequence is SEQ ID NO.22, SEQ ID NO.23, and SEQ ID NO.24 linked sequentially, as shown in the diagram. Figure 6 As shown in Figure A.

[0111] The rest is the same as in the embodiment.

[0112] Comparative Example 2:

[0113] Gene synthesis and acquisition: The sequences of Luz, H3H, CPH, HispS and P450 genes were obtained through gene synthesis. Primers were designed to ligate the genes into the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.). 2× high-fidelity PCR mix was purchased from Nanjing Novizan Biotechnology Co., Ltd. (product number: P520-01).

[0114] During PCR amplification, in Table 1, seq1 represents the FBP luminescent gene cluster + P450 gene.

[0115] The synthesized FBP+P450 has the nucleotide sequences SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.14 linked sequentially, and its gene structure is as follows: Figure 4 As shown in B.

[0116] The constructed vector T-DNA sequence is SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, and SEQ ID NO.28 linked sequentially, as shown in the diagram. Figure 6 As shown in B.

[0117] The rest is the same as in the embodiment.

[0118] Comparative Example 3:

[0119] Gene synthesis and acquisition: The sequences of Luz, H3H, CPH, HispS and TAL genes were obtained through gene synthesis. Primers were designed to ligate the genes into the pCAMBIA2300 vector (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.). 2× high-fidelity PCR mix was purchased from Nanjing Novizan Biotechnology Co., Ltd. (product number: P520-01).

[0120] During PCR amplification, in Table 1, seq1 represents the FBP luminescent gene cluster + TAL gene.

[0121] The synthesized FBP+TAL has the nucleotide sequences SEQ ID NO.15, SEQ ID NO.16, and SEQ ID NO.17 linked sequentially, and its gene structure is as follows: Figure 4 As shown in C.

[0122] The constructed vector T-DNA sequence is SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, and SEQ ID NO.32 linked sequentially, as shown in the diagram. Figure 6 As shown in C.

[0123] The rest is the same as in the embodiment.

[0124] Experimental results

[0125] 1. Caffeic acid content detection

[0126] Leaves were collected from wild-type tobacco and transgenic plants. Immediately after collection, samples were frozen in liquid nitrogen, ground, and approximately 1g of frozen tissue was placed in a 50ml centrifuge tube for lyophilization. The lyophilized material was stored at -20°C. Each sample was prepared and analyzed three times.

[0127] Weigh approximately 50 mg of lyophilized powder and treat it in an ultrasonic bath for 30 minutes with 7 mL of 70% (v / v) ethanol aqueous solution, followed by centrifugation at 4,000 rpm for 10 minutes. Collect the supernatant, filter it through a Phenex GF / PVDF syringe filter (30 mm diameter, 0.45 μm pore size), and then analyze it on an LCMS instrument. Analysis was performed using a Shimadzu 8030 system, which consisted of HPLC coupled with PDA and triple quadrupole mass spectrometry (HPLC-DAD-ESI-TQ MS). Chromatographic separation was performed on a Discovery C18 column (4.6 × 150 mm, 5 μm) in gradient mode, with mobile phase components A (0.3% (v / v) acetic acid aqueous solution) and B (acetonitrile). The gradient run was as follows: 0–4 min 10–40% B, 4–5 min 40–80%, 5–10.5 min isocratic elution with 100% B, followed by return to initial conditions. The column temperature was 40℃, the flow rate was 1 ml / min, and the injection volume was 20 μl.

[0128] Test results are available Figure 2 The results showed that adding TAL or P450 genes alone could not increase the caffeic acid content in plants. Only when TAL and P450 genes were present together could the caffeic acid content in plants be significantly increased.

[0129] 2. Luminescence detection

[0130] Transgenic plants from Examples 1-3 were cultured to maturity. Using a LightScout full-spectrum quantum optical meter (Shanghai Zequan Technology), the detection port was aimed directly at the tobacco leaf (closely against the leaf) in a dark environment to measure the accumulation of photons at different times. Experimental results ( Figure 2 B, Figure 3 The results showed that the transgenic plants with the introduction of the exogenous caffeic acid synthesis pathway exhibited significantly enhanced luminescence intensity, which was at least 3 times higher than that of the non-transgenic control plants (shooting conditions: Huawei P30 Pro, ISO 6400, time-lapse photography 2s, aperture 1.6mm).

[0131] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. A method of introducing an exogenous caffeic acid synthesis pathway to increase the light intensity of a plant, characterized by, The TAL gene and the P450 gene are introduced into a plant body, the nucleotide sequence of the TAL gene is shown in SEQ ID NO. 1, and the nucleotide sequence of the P450 gene is shown in SEQ ID NO.

2.

2. The method of claim 1, wherein, The specific steps are as follows: (1) gene cloning and vector construction: Luz gene, H3H gene, CPH gene, HispS gene, TAL gene, P450 gene are connected on pCAMBIA2300 vector; (2) transformation and screening; (3) Agrobacterium transformation; (4) plant transformation.

3. The method of claim 2, wherein, The specific method of step (1) is: (1-1) design primers, use high-fidelity polymerase for PCR amplification of genes; (1-2) double enzyme digestion, ligation reaction, vector transformation of E. coli.

4. The method of claim 3, wherein, In step (1-1), the primers are as follows: Public-F: ACAGCTATGACCATGATTACGAATTC, as shown in SEQ ID NO. 3; Public-R: AGTCACGACGTTGTAAAACGACGG, as shown in SEQ ID NO.

4.

5. The method of claim 3, wherein, In step (1-2), double enzyme digestion is performed using restriction enzymes EcoRI and HindIII.

6. The method of claim 3, wherein, In step (1-2), the amplified genes are connected with the enzyme-digested vector using a seamless cloning kit, and each gene is provided with a 35S promoter and a CaMV poly(A) terminator.

7. The method of claim 3, wherein, In step (1-2), the ligation product is transformed into competent E. coli DH5α by heat shock method, and positive clones are screened on LB plates containing 50 mg / L kan.

8. The method of claim 2, wherein, The specific method of step (2) is: (2-1) E. coli culture: select positive clones and use 10 ml of LB containing 50 mg / L kan for liquid culture; (2-2) plasmid extraction: use plasmid extraction kit to extract recombinant plasmid; (2-3) plasmid preservation: freeze the plasmid in the refrigerator, store at -20℃, and reserve for use.

9. The method of claim 2, wherein, The specific method of step (3) is: (3-1) transform the plasmid into Agrobacterium GV3101 Agrobacterium competent cells; (3-2) screening of transformed Agrobacterium: screening of transformed Agrobacterium on YEP plates containing antibiotics.

10. The method of claim 2, wherein, The specific method of step (4) is: (4-1) plant material preparation: select suitable tobacco leaves for transformation, cut the leaves into 0.5 cm*0.5 cm size; (4-2) leaf disc transformation: use Agrobacterium suspension to soak the plant leaf discs at 28℃, soak for 30 min, and then transfer to co-culture medium; (4-3) co-culture and screening: 28℃ dark culture for 2 days on co-culture medium, and then transfer to selection medium containing selective antibiotics; (4-4) regeneration and rooting: after about 2-3 weeks, resistant sprouts are screened out and induced to root in rooting medium; (4-5) tobacco transplantation and growth: transplant the rooted tobacco into soil, and carry out greenhouse management with light intensity of 6000Lx, 16h / day; (4-6) transgenic identification: sample the transplanted tobacco, extract DNA by CTAB method, and perform PCR positive identification.

Images