Molecular Marker of Gene npffr1 Related to the Spawning Amount of Female Sturgeon and Its Application

By detecting A/G polymorphism at 78bp of the sturgeon npffr1 gene, designing primer pairs to identify the egg-spawning traits of female sturgeons, solving the problem of low early breeding efficiency of female sturgeons in the prior art, and achieving early screening and rapid breeding of high egg-spawning traits.

CN119242817BActive Publication Date: 2025-07-18HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411552382.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-01
Publication Date
2025-07-18
Estimated Expiration
2044-11-01

AI Technical Summary

Technical Problem

In the prior art, there are no SNP molecular markers related to the sturgeon egg laying traits in the npffr1 gene regulatory region, resulting in low early breeding efficiency of female sturgeon egg laying traits and it is difficult to achieve early screening of high egg laying traits.

Method used

A SNP molecular marker of npffr1 gene related to egg laying of female sturgeons is provided. By detecting the A/G polymorphism at 78bp of the nucleotide sequence fragment of npffr1 gene, primer pairs are designed to amplify PCR and identify genotypes. Genotype AA is a high egg laying volume, and AG and GG are a low egg laying volume, which is used to breed female sturgeons in early stage.

Benefits of technology

It significantly improves the accuracy and efficiency of early breeding of egg-laying traits of female sturgeons, shortens breeding time, reduces reproduction costs, and promotes rapid breeding of high-laying varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119242817B_ABST
    Figure CN119242817B_ABST
Patent Text Reader

Abstract

A molecular marker of the gene npffr1 related to the egg production of female sturgeon and its application, belonging to the fields of sturgeon genetic breeding and sturgeon molecular marker-assisted selection and breeding. The SNP molecular marker for identifying the high or low egg production of sturgeon is located at the 78th bp of the nucleotide sequence fragment of the npffr1 gene; its polymorphism form is A / G, and among them, the genotypes of the base mutation sites include AA, AG or GG. Among them, female individuals with the genotype AA belong to high egg production individuals, and female individuals with the genotypes AG and GG belong to low egg production individuals. The molecular marker provided by the present invention can be used for the early selection of the egg production traits of female sturgeon, can be screened in female populations of various sturgeons such as Acipenser schrenckii, Huso dauricus, Acipenser baerii and hybrid sturgeon, and can significantly accelerate the artificial breeding process of breeding high egg production sturgeon varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of sturgeon genetic breeding and molecular marker-assisted selection of sturgeon, and particularly relates to a molecular marker of a gene npffr1 related to the egg production of female sturgeon and its application. Background Art

[0002] Caviar is made by salting sturgeon eggs, and has extremely high nutritional and economic value. It is known as "black gold" and is listed among the world's three major delicacies together with truffles and foie gras. It has always been a traditional luxury food in European and American countries. Therefore, the reproductive capacity of female sturgeon is the key factor determining the industrial development of caviar. Early selection of female sturgeon individuals with the trait of high egg production is the main task of current sturgeon genetic breeding. Neuropeptide FF receptor 1 (npffr1) is the main receptor of gonadotropin inhibitory hormone (GnIH) and plays an important role in regulating the reproductive physiology of animals. GnIH is a kind of hypothalamic neuropeptide and is also the only neuropeptide currently found that inhibits ovarian development. After binding to the G protein-coupled receptor npffr1, it directly participates in reproductive physiological processes such as sexual behavior, estrous cycle regulation, estrogen circulation, and follicle development through the "hypothalamus-pituitary-ovary" axis.

[0003] In recent years, with the rapid development of modern molecular biology techniques and the advent of the post-genomic era, single nucleotide polymorphism (SNP), as the third-generation molecular marker technology, has been widely used in the molecular breeding research of aquatic animals and also plays an important role in the breeding process of excellent varieties. Thus, developing molecular markers related to economic traits is of great significance for shortening the generation interval and improving the efficiency / accuracy of early selection of excellent traits. So far, there is no record in the prior art of SNP molecular markers related to the sturgeon egg production trait in the regulatory region of the npffr1 gene. Summary of the Invention

[0004] In order to facilitate the identification of the egg production trait of female sturgeon, the present invention provides a molecular marker of a gene npffr1 related to the egg production trait of female sturgeon and its application in artificial breeding. Using this SNP molecular marker, the egg production trait of female sturgeon can be identified. This SNP locus has an obvious correlation with the egg production trait of female sturgeon. Therefore, by identifying the genotype of this SNP locus in female sturgeon, it is possible to achieve early selection of female sturgeon individuals with the trait of high egg production.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides a molecular marker of the gene npffr1 related to the spawning amount of female sturgeon. The SNP molecular marker for identifying the high or low spawning amount of female sturgeon is located at the 78th bp of the nucleotide sequence fragment (SEQ ID NO: 1) of the npffr1 gene; its polymorphism form is A / G, and the genotypes of the base mutation sites include AA, AG or GG.

[0007] Furthermore, the nucleotide sequences of the primer pair for detecting the above SNP molecular marker are as follows:

[0008] Forward primer F: 5’-TTCAACACAGCCTTCGCTTAC-3’, namely SEQ ID NO: 2;

[0009] Reverse primer R: 5’-CGGCATTACAGAATAGCAA-3’, namely SEQ ID NO: 3.

[0010] An application of the said molecular marker or the said primer pair in identifying the high or low spawning amount of female sturgeon includes the following steps:

[0011] Step 1: Extract genomic DNA from the fin tissue of the sturgeon to be tested;

[0012] Step 2: Use the above primer pair to perform PCR amplification on the genomic DNA of the sturgeon to obtain the nucleotide sequence fragment of the npffr1 gene, namely SEQ ID NO: 1;

[0013] Step 3: Detect the genotype at the 78th bp of the PCR amplification product; among them, female individuals with the genotype AA belong to high spawning amount individuals (egg weight / body weight > 0.2), and female individuals with the genotypes AG and GG belong to low spawning amount individuals (egg weight / body weight < 0.15).

[0014] Compared with the prior art, the beneficial effects of the present invention are:

[0015] The present invention provides an SNP molecular marker associated with the fecundity trait of female sturgeon. The SNP molecular marker is located at the 11249th bp of the npffr1 gene on chromosome NC_081234.1 of sturgeon, that is, at the 78th bp of the nucleotide sequence fragment (SEQ ID NO: 1) of the npffr1 gene; there is an A / G base mutation on this molecular marker, which has a significant correlation with the fecundity trait of female sturgeon. Among them, the fecundity trait of individuals with the AA genotype is significantly higher than that of the AG and GG genotypes. At the same time, the genotyping result of this SNP molecular marker locus has a matching rate of up to 81.16% with the actual fecundity trait. The molecular marker provided by the present invention can be used for the early selection and breeding of the fecundity trait of female sturgeon, and can be screened in various female sturgeon individuals such as Acipenser schrenckii, Huso dauricus, Acipenser baerii, and hybrid sturgeon. This SNP molecular marker of the npffr1 gene related to the fecundity trait of sturgeon lays a foundation for molecular marker-assisted selection of sturgeon strains with high fecundity traits, and can significantly accelerate the artificial breeding process of high-fecundity varieties.

[0016] By detecting the dominant allele genotype of the SNP molecular marker, the present invention can significantly shorten the breeding time of artificially selecting female sturgeon with high fecundity, thereby reducing the breeding cost and effectively improving the economic benefits of the sturgeon aquaculture industry, so as to promote the progress of genetic improvement of the fecundity trait of sturgeon. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the sequencing peak map of three genotypes of the PCR amplification product in Example 1 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0018] The following will clearly and completely describe the technical solutions in the present invention in conjunction with the drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0019] Example 1:

[0020] Identification of Polymorphic Loci of the npffr1 Gene in Female Sturgeon

[0021] 1. Obtaining detection samples of female sturgeons with high and low egg production: All the fish used in this experiment were from Hangzhou Qiandao Lake Sturgeons Technology Co., Ltd. 69 healthy, uninjured and active female adult individuals with a body length of 143.60 ± 40.62 cm and a body weight of 29.26 ± 5.25 kg were selected. After dissection, egg collection and weighing, 20 female fish with an egg production rate higher than 20% were used as the high egg production group, and 49 female fish with an egg production rate lower than 15% were used as the low egg production group. The fin rays of the above sturgeons were cut as test samples for genomic DNA extraction and stored under frozen conditions at -20°C.

[0022] 2. Extracting genomic DNA from the fin ray tissues of the female sturgeons to be tested: The genomic DNA of fish fins was extracted using a column animal tissue genomic DNA extraction kit. Subsequently, 1% agarose gel electrophoresis was used to detect the quality and integrity of the DNA samples; a NanoDrop2000 ultra-micro spectrophotometer was used to measure the DNA concentration, and the genomic DNA samples that met the concentration requirements and had good integrity were stored in a -20°C refrigerator for standby.

[0023] 3. Amplifying nucleotide fragments containing SNP sites

[0024] 3.1 Primer design: The DNA sequence corresponding to the npffr1 gene (NCBI accession number: LOC117966090) was downloaded from the sturgeon reference genome database (https: / / www.ncbi.nlm.nih.gov / ), and detection primers were designed based on a partial nucleotide sequence of the npffr1 gene, including:

[0025] Forward primer F: 5’-TTCAACACAGCCTTCGCTTAC-3’ (SEQ ID NO:2);

[0026] Reverse primer R: 5’-CGGCATTACAGAATAGCAA-3’ (SEQ ID NO:3).

[0027] The amplified product length of this primer is 485 bp, and the sequence is as shown in SEQ ID NO:1, which contains a molecular marker site with an A / G mutation at the 78th bp.

[0028] SEQ ID NO:1

[0029] CGTGTCGGCAGTTTGTCTCTTTAGCACACTTCAGCCTTTTGATGACAGCACAGTTTGGCCCCCGTTGGGGATGAGAT[G / A]CGAAACTGTACAGTCTGAGCGTCAGTGGAAACCC CCTCCAGCTACACCTCGCCCAGCCTGGCCAGCTGAGCTAGACCAGGGACAGGCAGTGGAAACGAAGCATATGTGACCTGATCTGGACGGGTCTGGAAAAAACCCTTGGAAAGGGTTTATATCAATCAGTGCGGTACTGAATTGCTCACCATTGCAAAAAACAAGTCTGAACAGGCTAAGGTAAAAAAAAAAACAAAATGTTCCATGTCTCAATCCTCCTGCAAAACACTTAAGGTTATCTCTGCCCCTGCCGGAAGGATCGCTCACTGAAATGCATGCATTTGAAAAACGTTATCAATGCAAAAACCGATCTGCCCGGAAGGTGAATGTGAAGGTTATATAAAACTTGCTCGGGGGCAGCGCACGCCCCCCCG

[0030] 3.2 PCR amplification: The PCR reaction system was 20 μL, including: 10 μL of 2×TSINGKE MasterMix (Blue), 0.8 μL of forward primer (10 μmol / L), 0.8 μL of reverse primer (10 μmol / L), 1.0 μL of template DNA (≥100 ng / μL), and 7.4 μL of ddH2O. The conditions for the PCR reaction were: pre-denaturation at 95°C for 5 min, [denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s] for 35 amplification cycles, and finally extension at 72°C for 10 min.

[0031] 4. Detect the PCR amplification fragment and identify the genotype of the SNP molecular marker: Use the ABI 3730XL sequencing platform to perform Sanger sequencing on the PCR amplification product obtained in step 3. The genotype at the 78th bp of the PCR amplification product is the genotype of the SNP molecular marker. The sequencing peak diagrams of the three genotypes are as Figure 1 shown.

[0032] Example 2:

[0033] The polymorphic sites of the npffr1 gene of 69 samples to be tested were analyzed in an expanded population. The association analysis between SNP molecular markers and the spawning quantity trait was performed on 69 female sturgeons in the high spawning quantity group and the low spawning quantity group using a general linear model (Table 1), which verified that the genotype of the SNP molecular marker at this location was significantly positively correlated with the spawning quantity trait of sturgeon (P<0.05), and the matching rate between the genotyping results of this SNP molecular marker site and the actual spawning quantity trait was 81.16%.

[0034] Table 1 Genotype frequencies of SNP loci in high and low spawning groups of sturgeon

[0035]

[0036] Note: * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01).

[0037] In the process of artificially breeding female sturgeon varieties with high spawning capacity, individuals with genotype AA can be selected and retained, while individuals with genotypes AG and GG can be eliminated.

[0038] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. Application of a primer pair for detecting molecular markers of a gene npffr1 related to the spawning amount of female sturgeon in identifying the high or low spawning amount of female sturgeon, characterized in that: The SNP molecular marker for identifying the high or low spawning amount of sturgeon is located at the 78th bp of the nucleotide sequence fragment SEQ ID NO:1 of the npffr1 gene; its polymorphism form is A / G, and the genotypes of the base mutation sites include AA, AG or GG.

2. The application according to claim 1, characterized in that It includes the following steps: Step 1: Extract genomic DNA from the fin tissue of the sturgeon to be tested; Step 2: Use detection primers to perform PCR amplification on the genomic DNA of the sturgeon to obtain the nucleotide sequence fragment of the npffr1 gene, that is, SEQ ID NO:1; Step 3: Detect the genotype at the 78th bp of the PCR amplification product; among them, female individuals with the genotype AA belong to high spawning amount individuals, and female individuals with the genotypes AG and GG belong to low spawning amount individuals.

Citation Information

Patent Citations

  • Specific DNA fragment SSM2 for sex determination of sturgeons and application

    CN111471775A