A SNP molecular marker related to weaning weight of yongdeng qishan goat and application thereof

Abstract

The application provides a SNP molecular marker related to weaning weight of Yongdeng seven goats, a detection kit and application thereof, and belongs to the technical field of SNP molecular markers. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, the mutation site is the base at the 5343313th site on the 3rd chromosome of the international sheep genome Oar_v4.0 version, and the high weaning weight trait of Yongdeng seven goats can be identified by selecting the advantageous allele of the site through typing of the site. The application further provides a method for identifying the weaning weight trait of Yongdeng seven goats, screening or breeding Yongdeng seven goats with high weaning weight traits based on the SNP molecular marker. The method has high accuracy, fast detection speed, low cost, and easy result interpretation, and has important application value in realizing large-scale molecular precision breeding of Yongdeng seven goats.

Description

TECHNICAL FIELD

[0001] The present application relates to molecular marker detection technology, and in particular to a SNP molecular marker related to weaning weight of Yongdeng seven goats and application thereof. BACKGROUND

[0002] Yongdeng seven goats are a local sheep population in Yongdeng County, Lanzhou City, Gansu Province. The population has consistent body shape and stable genetic performance, is good at climbing and long-distance grazing, is resistant to coarse feed and has strong disease resistance. Yongdeng seven goats have tender meat, interlaced fat and lean, are rich in high levels of protein and unsaturated fatty acids, and have rich mineral element types. The soup of the cooked meat is clear and transparent, the meat has strong aroma, is tender and delicious, is fatty but not greasy, is lean but not hard, has light mutton smell, and has good market prospects.

[0003] Weaning weight refers to the body weight of a lamb when it stops being fed with milk (weaning), is a key indicator for measuring the production performance of sheep, can reflect the level of early growth and development of lambs, and is an important basis for evaluating the vitality and resistance of lambs. Lambs with higher weaning weight usually have faster growth speed and better meat production performance in the subsequent growth process.

[0004] At present, molecular tests have proved that Yongdeng seven goats have obvious genetic differentiation from Tan sheep and Lanzhou big-tail sheep and other breeds raised in the surrounding area. However, there are few reports on the research on molecular markers related to economic traits of Yongdeng seven goats. Therefore, it is important to provide a SNP molecular marker related to weaning weight of Yongdeng seven goats and use the SNP molecular marker to improve the production performance of Yongdeng seven goats. SUMMARY

[0005] In order to solve the problems in the prior art, the purpose of the present application is to provide a SNP molecular marker related to weaning weight of Yongdeng seven goats, to realize genotyping of weaning weight of Yongdeng seven goats by detecting the base type of the SNP molecular marker, and to further identify weaning weight traits of Yongdeng seven goats and screen or breed Yongdeng seven goats with high weaning weight traits according to the genotypes.

[0006] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions.

[0007] The present application provides a SNP molecular marker related to weaning weight of Yongdeng seven goats, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1.

[0008] Preferably, when the base at position 289 of the SNP molecular marker is T, the genotype is TT or TC, and Yongdeng seven goats exhibit high weaning weight traits.

[0009] The present application also provides application of the above-mentioned SNP molecular marker in any of the following:

[0010] (1) identifying weaning weight of Yongdeng Qishan goat;

[0011] (2) screening Yongdeng Qishan goat with high weaning weight;

[0012] (3) breeding Yongdeng Qishan goat with high weaning weight.

[0013] The application further provides a primer pair for detecting the SNP molecular marker, wherein the sequence of the upstream primer is shown as SEQ ID NO: 2, and the sequence of the downstream primer is shown as SEQ ID NO: 3.

[0014] The application further provides a kit for identifying weaning weight of Yongdeng Qishan goat, comprising the primer pair.

[0015] Preferably, the kit further comprises a standard positive template.

[0016] The application further provides application of the primer pair or the kit in any of the following:

[0017] (1) identifying weaning weight of Yongdeng Qishan goat;

[0018] (2) screening Yongdeng Qishan goat with high weaning weight;

[0019] (3) breeding Yongdeng Qishan goat with high weaning weight.

[0020] The application further provides a method for identifying weaning weight of Yongdeng Qishan goat by using the SNP molecular marker, comprising the following steps:

[0021] (1) taking genomic DNA of Yongdeng Qishan goat to be detected as a template, and performing PCR amplification by using specific primers of the SNP molecular marker to obtain a PCR product;

[0022] (2) sequencing the PCR product;

[0023] (3) result judgment: when the base at the 289th position of the PCR product is T, and the genotype is TT or TC, the Yongdeng Qishan goat exhibits high weaning weight; and when the base at the 289th position of the PCR product is C, and the genotype is CC, the Yongdeng Qishan goat exhibits low weaning weight.

[0024] The application further provides a breeding method of Yongdeng Qishan goat with high weaning weight, comprising: selecting Yongdeng Qishan goat with high weaning weight by using the mutation of T / C at the 289th position from the 5' end, and selecting and keeping individuals carrying TT genotype or TC genotype.

[0025] Further preferably, the individual carrying the TT genotype is used as a breeding goat to breed Yongdeng Qishan goat offspring with high weaning weight. Further preferably, the individual carrying the TT genotype is used as a breeding goat to breed Yongdeng Qishan goat offspring with high weaning weight.

[0026] Compared with the prior art, the technical scheme of the present application has the following beneficial effects:

[0027] The present application first proposes a SNP molecular marker related to weaning weight of Yongdeng seven goats, and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1. When the base at position 289 of the SNP molecular marker is T, the genotype is TT or TC, and the Yongdeng seven goats show high weaning weight traits. When the base at position 289 of the SNP molecular marker is only C, the genotype is CC, and the Yongdeng seven goats show low weaning weight traits. The mutation site of the SNP molecular marker is at the base at position 5343313 on chromosome 3 in the international sheep genome Oar_v4.0 version. When the base T is mutated to C, there are two genotypes of TC and CC, wherein the genotype TC shows high weaning weight, and the genotype CC shows low weaning weight. The present application verifies that the weaning weight of Yongdeng seven goat individuals with genotypes TT and TC is significantly higher than that of individuals with genotype CC (P<0.05), and there is no significant difference between genotypes TT and TC (P>0.05), which all show high weaning weight traits.

[0028] The present application further provides a method for identifying weaning weight traits of Yongdeng seven goats, screening or breeding Yongdeng seven goats with high weaning weight traits based on the SNP molecular marker. The method has high accuracy, fast detection speed, low cost, and easy result interpretation. The present application uses PCR technology to detect nucleotide polymorphism related to weaning weight of Yongdeng seven goats, which can realize rapid and automatic detection of SNP site polymorphism related to weaning weight, retain Yongdeng seven goat individuals with genotypes TT and TC, and be used for early breeding selection, which has important application value in large-scale molecular precise breeding of Yongdeng seven goats. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 It is the result of agarose gel electrophoresis detection of amplification product;

[0030] Figure 2 It is the peak chart and sequence obtained by sequencing the PCR product;

[0031] Figure 3 It is a genotyping result chart according to sample clusters and fluorescence types. DETAILED DESCRIPTION

[0032] The application provides a SNP molecular marker related to weaning weight of Yongdeng Qishan goats, and the nucleotide sequence (632bp) of the SNP molecular marker is: ACCTAGCTTGCCGACTGCTGGTGGGGTGCATGCTCTCTGGTCGC CTGGGACCAGCCTGGGGGCTCCAGAGTCAGGCAGACGGGGGATGACCTGGGGCTCTGCCACCAACTAGCTGTAGGACCTCTAGCAAGTCACTTGGCCTCTCTGGGCTAGTCTGTTTTGTTTTTCCTCTTGTAACACAGGAATACTAGTGTCCACCTTCCAAGGGCTATTGTGAAGTCAGAGAGATGTTGTCTCACTGATGTACAATGCTGAGCAGGGTCCCTGCCACGTAGCGAGCCTTCAAGC T TCTGGGTTAGGAACTGGTCTTTTTTTACAAAGGCGGCAAAGACCTCTCTCCCTCTGAGTGACTCTTTCAGAAGCACCCACCTGCCCCCCTGAAGTCTGGCCCCTCCTCCATACCTGGCTGGTGAGAAGCCAGACCCCAGGAATCCTTAGTCTGGGGTTCCTTGTGGATTCCTGGCACTTCTCTTCCAGAATGTTCCACTCAGACCATGCAGCCACAGAGGAGGATGTCCCACACTGAGTCACATCCCACCTTCCCTGGGTGTGGCCATGGCGTGGCCCCACCCTGAACCTGGACGGATGCACGTGAAGTCGGGTGCAGAACGCACGGCGAGCAGGCATGTACC (The bold and underlined site is a mutation site, which is the 289th site of the sequence).

[0033] The SNP site in the application is located at the base of the 5343313th site on the 3rd chromosome in the international sheep genome Oar_v4.0 version, and the mutation base is T or C; when the base is T, the genotype is TT; when the base is mutated to C, the genotype is TC or CC; the weaning weight of Yongdeng Qishan goat individuals with the genotypes TT and TC is significantly higher than that of individuals with the genotype CC (P<0.05), and there is no significant difference between the genotypes TT and TC (P>0.05), and both of them show high weaning weight traits; the Yongdeng Qishan goat individuals with the genotype CC show low weaning weight traits.

[0034] The application further provides application of the above SNP molecular marker in any of the following:

[0035] (1) identifying the weaning weight traits of Yongdeng Qishan goats. The genotype of the SNP site can be identified to determine whether the weaning weight traits of Yongdeng Qishan goats are high or low in early stage;

[0036] (2) screening Yongdeng Qishan goats with high weaning weight traits. The genotype of the SNP site can be detected to screen Yongdeng Qishan goats with high weaning weight traits in early stage;

[0037] (3) breeding Yongdeng Qishan goats with high weaning weight traits. The genotype of the SNP site can be detected to select goats with genotype TT or TC, and Yongdeng Qishan goats with high weaning weight traits can be bred.

[0038] The application further provides a primer pair for detecting the above-mentioned SNP molecular marker, wherein the upstream primer is F: 5'-AGCAGGTCCACAGACTCCCAAGGAC-3', and the sequence is shown as SEQ ID NO: 2; and the sequence of the downstream primer is 5'-GAGAGACCACGGTACACTGCCTGCT-3', and the sequence is shown as SEQ ID NO: 3. The primer pair can be used to amplify the sequence containing the above-mentioned mutation site, including the sequence shown as SEQ ID NO. 1, with the genomic DNA of Yongdeng Qishan goats to be identified as the template, and the length of the amplified fragment is 632 bp, so as to be used for subsequent sequencing, so as to determine the genotype and weaning weight traits.

[0039] The application further provides a kit for identifying the weaning weight traits of Yongdeng Qishan goats, which comprises a DNA extraction kit, a PCR amplification kit and a sequencing kit; the PCR amplification kit comprises the above-mentioned primer pair. Preferably, the kit further comprises a standard positive template, which can be a marker or the nucleotide shown as SEQ ID NO. 1. The NDA extraction kit and the sequencing kit are not limited in the application, and conventional kits in the field can be used.

[0040] The application further provides the application of the above-mentioned primer pair or the above-mentioned kit in any of the following aspects:

[0041] (1) identifying the weaning weight traits of Yongdeng Qishan goats. The genotype of the SNP site can be identified to determine whether the weaning weight traits of Yongdeng Qishan goats are high or low in early stage;

[0042] (2) screening Yongdeng Qishan goats with high weaning weight traits. The genotype of the SNP site can be detected to screen Yongdeng Qishan goats with high weaning weight traits in early stage;

[0043] (3) Selecting and breeding Yongdeng No. 7 goats with high weaning weight. This invention can select breeding goats with genotype TC or TT by detecting the genotype of this SNP locus, and then breed Yongdeng No. 7 goats that exhibit high weaning weight.

[0044] This invention also provides a method for identifying the weaning weight of Yongdeng No. 7 goats using the above-mentioned SNP molecular markers, comprising the following steps:

[0045] (1) Using the genomic DNA of Yongdeng No. 7 goat to be tested as a template, PCR amplification was performed using the specific primers of the above-mentioned SNP molecular markers to obtain PCR products;

[0046] (2) Sequencing the PCR products;

[0047] (3) Result judgment: When the PCR product has a T base at position 289 and the genotype is TT or TC, it shows a high weaning weight trait; when the PCR product has a C base at position 289 and the genotype is CC, it shows a low weaning weight trait.

[0048] The genomic DNA of Yongdeng Qishan goats to be tested in this invention is preferably extracted from blood samples.

[0049] The preferred PCR amplification system of this invention is: 25 μL of 2×PARMS master mix, 1.5 μL each of forward and reverse primers, 5 μL of template, and ddH2O to a final volume of 50 μL. The PCR amplification program is: 94℃, 20 min, 1 cycle; 94℃, 20 s; 58℃, 30 s, 38 cycles; 72℃, 1 min. The obtained PCR products are detected by agarose gel electrophoresis. After passing the detection, sequencing is performed, preferably using direct sequencing. The sequencing results are analyzed. If the PCR product contains a T at position 289 from the 5' end, the genotype is TC or TT, indicating a high weaning weight trait. If the PCR product contains only a C at position 289 from the 5' end, the genotype is CC, indicating a low weaning weight trait.

[0050] The application also provides a breeding method of the high weaning weight Yongdeng Qishan goat, which comprises: selecting and retaining individuals carrying TT genotype or TC genotype by using the above-mentioned molecular marker of T / C mutation at the 289th site from the 5' end to select the high weaning weight trait. That is, the application selects and retains individuals carrying TT genotype or TC genotype as breeding goats by judging the genotype of individuals according to the sequencing result through the above-mentioned method for identifying the weaning weight of Yongdeng Qishan goat, and most of the offspring obtained by breeding carry TT genotype or TC genotype, and the part of the offspring represent the high weaning weight trait. Further preferably, the application selects and retains individuals carrying TT genotype (homozygous) as breeding goats, and all the Yongdeng Qishan goat offspring obtained by breeding represent the high weaning weight trait without considering the gene mutation.

[0051] The technical solutions in the application will be clearly and completely described below in combination with the embodiments in the application. Obviously, the described embodiments are only some of the embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the application.

[0052] In specific embodiments of the application, EDTA-K2 blood collection tubes are purchased from Gansu Shengruisi Biotechnology Co., Ltd.; blood genome extraction kits are purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer (Thermo Fisher Scientific Company), DL2000 Marker, agarose, nucleic acid dye are all from Beijing Solabio Technology Co., Ltd.; PARMS mix is purchased from Wuhan Jingpeibio Biotechnology Co., Ltd.; an electrophoresis instrument is purchased from Gansu Shengruisi Biotechnology Co., Ltd., and a PCR instrument is purchased from BioRad Company.

[0053] In the following examples, all are conventional methods unless otherwise specified.

[0054] In the following examples, the materials, reagents and the like used are commercially available unless otherwise specified.

[0055] Example 1

[0056] 1. Sample collection

[0057] 107 Yongdeng Qishan goat blood samples with complete production records from Yongdeng Qishan goat breeding base in Qishan Township, Yongdeng County, Lanzhou City, Gansu Province were collected, 5 mL of blood was collected from the jugular vein of all goats, and blood collection tubes containing EDTA-K2 anticoagulant were used to collect the blood, the sample number was recorded, and the samples were transported back to the laboratory within 24 h and stored at-80℃ for subsequent DNA extraction. The weaning weight data of each goat was provided by the Yongdeng Qishan goat breeding base.

[0058] 2. Method

[0059] 2.1 DNA extraction

[0060] The blood DNA of all Yungdon seven goat samples was extracted by blood genome extraction kit, and then the concentration and purity were detected by ultraviolet spectrophotometer. The concentration was > 20 ng / μL, OD 260 / OD 280 between 1.7 and 1.9, which met the experimental needs, and was stored at -80℃ for standby.

[0061] 2.2 Primer design

[0062] Based on the sequence of chromosome 3 of sheep reference genome Oar_4.0 version, specific primers were designed by Primer premier software. The sequence of the upstream primer F was 5'-AGCAGGTCCACAGACTCCCAAGGAC-3', as shown in SEQ ID NO: 2, and the sequence of the downstream primer was 5'-GAGAGACCACGGTACACTGCCTGCT-3', as shown in SEQ ID NO: 3. The specific primer contained g5343313T>C SNP site. The primer was synthesized by Wuhan Jingpeibio Technology Co., Ltd.

[0063] 2.3 PCR amplification and sequencing

[0064] PCR amplification 50 μL: 2xPARMS master mix 25 μL, upstream and downstream primers 1.5 μL each, template 5 μL, ddH2O to 50 μL.

[0065] PCR amplification program: 94℃, 20min, 1 cycle, 94℃, 20s, 58℃, 30s, 38 cycles, 72℃, 1min.

[0066] 2.4 PCR product sequencing and result analysis

[0067] The PCR product was detected by 1.5% agarose gel electrophoresis, and the electrophoresis map is shown in Figure 1 . In the figure, M is Marker, and 1-10 lanes are PCR amplification product bands of part of the samples. The results showed that the PCR product band was clear and bright, the PCR product fragment size was 632 bp, which met the expected size and could be used for subsequent sequencing.

[0068] The PCR product was recovered and purified, and then sequenced by direct sequencing method, and the sequencing was completed by Wuhan Jingpeibio Technology Co., Ltd. The peak map and sequence obtained by PCR product sequencing are shown in Figure 2 . The PCR product sequencing results were compared and analyzed by MEGA 11.0 software. The peak map is shown in Figure 2It can be seen that the g5343313T>C SNP site has a T-C mutation, and there are three genotypes of TT, TC and CC.

[0069] The genotyping results were viewed using SNPviewer2 software (LGC Genomics), and the results are shown in Figure 3 Figure 3 It is shown that the genotypes are divided into three types of TT, TC and CC according to sample clusters and fluorescence types.

[0070] According to the genotyping results, the number of individuals with different genotypes at the site was counted.

[0071] The g5343313T>C gene frequency, genotype frequency, effective allele number (Ne), and site heterozygosity (He) were calculated using Popgen software, and the polymorphic information content was calculated using PIC calculation software, and the results are shown in Table 1.

[0072] Table 1 Polymorphism of g5343313T>C SNP site on chromosome 3 of Yongdeng seven goats

[0073]

[0074] Through the analysis of the genotype and allele frequency of the g5343313T>C SNP site on chromosome 3 of Yongdeng seven goats, it was found that the genotype TC had the highest frequency and was the dominant genotype, and the T allele frequency was 51.4%, which was the dominant allele. The He of the site was 0.499, the Ne was 1.998, the PIC was 0.375, and it belonged to moderate polymorphism.

[0075] The association between different genotypes and weaning weight of Yongdeng seven goats was analyzed by IBM SPSS Statistic 27 software, and the results were expressed as "mean ± standard error", and the results are shown in Table 2.

[0076] Table 2 Association analysis of different genotypes and weaning weight of Yongdeng seven goats

[0077]

[0078] Note: The same row of data marked with different lowercase letters indicates significant difference (P<0.05).

[0079] ​The correlation between different genotypes of Yongdeng Qishan goats and weaning weight is analyzed by a general linear model in IBM SPSS Statistic 27 software, and the result shows that the weaning weight of Yongdeng Qishan goats with TT and TC genotypes is significantly higher than that of Yongdeng Qishan goats with CC genotype (P<0.05), and the difference between Yongdeng Qishan goats with TT and TC genotypes is not significant (P>0.05). The weaning weight of Yongdeng Qishan goats can be judged by detecting the base of the SNP site on the third chromosome of Yongdeng Qishan goats.

[0080] The above merely describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. The application of reagents for detecting SNP molecular markers associated with weaning weight in Yongdeng No. 7 goats in any of the following: (1) Identify the weaning weight trait of Yongdeng No. 7 goats; (2) Screening for Yongdeng No. 7 goats with high weaning weight; (3) Select and breed Yongdeng No. 7 goats with high weaning weight; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 289 of the SNP molecular marker exhibits a T / C polymorphism; when the base at position 289 of the SNP molecular marker is T and the genotype is TT or TC, Yongdeng Qishan goats exhibit the high weaning weight trait.

2. Application of primer pairs for detecting SNP molecular markers associated with weaning weight of Yongdeng No. 7 goats in any of the following: (1) Identify the weaning weight trait of Yongdeng No. 7 goats; (2) Screening for Yongdeng No. 7 goats with high weaning weight; (3) Select and breed Yongdeng No. 7 goats with high weaning weight; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 289 of the SNP molecular marker exhibits a T / C polymorphism; when the base at position 289 of the SNP molecular marker is T and the genotype is TT or TC, Yongdeng Qishan goats exhibit the high weaning weight trait. The sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO:

3.

3. The kit for detecting SNP molecular markers associated with weaning weight of Yongdeng No. 7 goats may be used in any of the following applications: (1) Identify the weaning weight trait of Yongdeng No. 7 goats; (2) Screening for Yongdeng No. 7 goats with high weaning weight; (3) Select and breed Yongdeng No. 7 goats with high weaning weight; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the base at position 289 of the SNP molecular marker exhibits a T / C polymorphism; when the base at position 289 of the SNP molecular marker is T and the genotype is TT or TC, Yongdeng Qishan goats exhibit the high weaning weight trait. The kit includes a DNA extraction kit, a PCR amplification kit, and a sequencing kit; the PCR amplification kit includes primer pairs for detecting SNP molecular markers associated with the weaning weight of Yongdeng Qishan goats; the sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO:

3.

4. Use according to claim 3, characterized in that, The PCR amplification kit also includes a standard positive template.

5. A method for identifying the weaning weight of Yongdeng seven goats, characterized by, Includes the following steps: (1) Using the genomic DNA of Yongdeng No. 7 goats to be tested as a template, PCR amplification was performed using primer pairs for detecting SNP molecular markers related to weaning weight of Yongdeng No. 7 goats to obtain PCR products; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, wherein the base at position 289 of the SNP molecular marker exhibits T / C polymorphism; the sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO: 3; (2) Sequencing the PCR products; (3) Result judgment: When the base at position 289 of the SNP molecular marker is T and the genotype is TT or TC, the high weaning weight trait is exhibited; when the base at position 289 of the SNP molecular marker is C and the genotype is CC, the low weaning weight trait is exhibited.

6. A breeding method for high weaning weight Yongdeng Qishan goats, characterized in that, The method includes: Using the genomic DNA of Yongdeng No. 7 goats as a template, PCR amplification was performed using primer pairs that detect SNP molecular markers associated with weaning weight of Yongdeng No. 7 goats to obtain PCR products; the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, wherein the base at position 289 of the SNP molecular marker exhibits T / C polymorphism; the sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 2, and the sequence of the downstream primer is shown in SEQ ID NO: 3; Sequencing of PCR products; Individuals carrying the SNP molecular marker as either the TT or TC genotype were selected.

7. The breeding method according to claim 6, characterized in that, Individuals carrying the SNP molecular marker TT genotype were used as breeding sheep to breed offspring of Yongdeng Qishan goats with high weaning weight.

Images