SNP-C95G related to spikelet number per ear of wheat and application of SNP-C95G

Abstract

The invention discloses SNP-C95G related to the number of spikelet per panicle of wheat and application of the SNP-C95G. An SNP site corresponds to the 95th basic group from the 5'tail end of a sequence shown in SEQ ID NO.1, and when the site is C / C homozygous, the corresponding genotype is A, and when the site is C / C homozygous, the corresponding genotype is B; when the site is G / G homozygous, the corresponding genotype is B; the spikelet number of each spike is as follows: the genotype A homozygous wheat is greater than or candidate to be greater than the genotype B homozygous wheat. The SNP has high effectiveness and potential application value, wheat with the large spikelet number per spike can be found by detecting the SNP, and the SNP has important value in research or application of cultivation of high-yield wheat varieties.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, in particular to SNP-C95G related to the number of spikelets per ear of wheat and application thereof. Background Art

[0002] Wheat (Triticum aestivum L) is the second largest staple food crop in my country and plays a vital role in ensuring my country's food security. Improving wheat yield is an important way to meet the increasing demand for food this year, and it is also a strategic goal to ensure food security. The number of grains per ear is one of the three elements of wheat yield, and the number of spikelets per ear and the number of florets per spikelet jointly determine the number of grains per ear. Therefore, exploring excellent allelic variation that regulates the number of spikelets per ear and developing functional markers are of great practical significance in improving wheat grain number per ear and breeding for high and stable yields of wheat.

[0003] At present, researchers have located a large number of QTLs that regulate the number of spikelets per ear. Ma et al. created a recombinant inbred line population containing 199 lines by crossing the winter wheat line '20828' with the nationally approved wheat Sichuan Agricultural University 16 and used wheat 55K SNP chips and SSR markers for genotyping, and found five stable QTLs on chromosomes 2D, 4B, 5A, 5B and 5D. Zheng et al. used wheat 55K SNP chips to type a recombinant inbred line population containing 126 lines and identified two major loci for wheat spikelet number. Long et al. used wheat 55K SNP chips to type the constructed double haploid population of Sichuan wheat 42 (CM42) / Kecheng wheat 1 (K1), constructed a high-density genetic map, and identified a new major QTL locus for spikelet number, QTsn / Fsn.cib-3D, on the long arm of wheat chromosome 3D. Zhang et al. used a doubled haploid population to detect four additive QTLs located on chromosomes 1B, 4A, 5D and 7A, respectively.

[0004] Although a large number of QTLs related to the number of spikelets per ear of wheat have been located, it is difficult to apply these QTLs to the genetic improvement of the number of spikelets per ear of wheat because the phenotypic contribution rate of most of these QTLs is small and the repeatability between different years and environments is poor. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide SNP-C95G related to the number of spikelets per ear of wheat and application thereof.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] A SNP site associated with the number of spikelets per ear of wheat, the SNP site corresponds to the 95th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the number of spikelets per ear is: the wheat homozygous for genotype A is greater than or is candidate greater than the wheat homozygous for genotype B.

[0008] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the number of spikelets per ear of wheat, which is used to detect the SNP site described in claim 1, and the reagent or kit contains a PCR amplification specific primer combination and enzyme cutting component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0009] As a preferred technical solution of the present invention, the target DNA fragment amplified by PCR in the reagent or kit is designed to be 74-217 bp at the 5' end of SEQ ID NO.1.

[0010] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0011] As a preferred technical solution of the present invention, the enzyme cutting component is the restriction endonuclease NotI.

[0012] On the other hand, the present invention also includes a primer combination for detecting the single nucleotide polymorphism of the following SNP site in the wheat genome, wherein the SNP site corresponds to the 95th base from the 5' end of the sequence shown in SEQ ID NO.1, and when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ IDNO.5; this primer combination is used to detect the SNP site described in claim 1.

[0013] On the other hand, the present invention also includes a method for identifying or assisting in identifying wheat genotypes, wherein any DNA fragment in the wheat genomic DNA to be tested, including the SNP site described in claim 1, is amplified by PCR, and the PCR amplification product is identified by enzyme digestion.

[0014] As a preferred technical solution of the present invention, the DNA fragment amplified by PCR is 74-217bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0015] As a preferred technical solution of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 100 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using the restriction endonuclease NotI to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is G / G and the genotype is B; the number of spikelets per ear is: the wheat homozygous for genotype A is greater than or the candidate is greater than the wheat homozygous for genotype B.

[0016] In the last aspect, the present invention also includes the use of the SNP site in identifying or assisting in identifying the trait of spikelet number per ear of wheat.

[0017] The beneficial effect of adopting the above technical scheme is that the research team of the present invention discloses a SNP site related to the number of spikelets per ear of wheat and its application. The present invention analyzes the genetic variation of the exon region of the gene of the natural variation population of wheat and finds that there is a SNP, corresponding to the 95th position from the 5' end of Sequence Table 1. The SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis proves that in the homozygous types of these two genotypes, the number of spikelets per ear is: the wheat homozygous for genotype A is greater than or the candidate is greater than the wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of spikelets per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in agricultural practice and / or related scientific research for cultivating high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the electrophoresis detection result of the SNP development dCAPS marker digestion product of the present invention; wherein, M is used as a molecular weight standard; lane C is a band cut by NotI, and lane G is a band that cannot be cut by NotI;

[0019] Figure 2 It is a schematic diagram of the association analysis of the number of spikelets per ear of the present invention. DETAILED DESCRIPTION

[0020] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can be obtained from commercial sources. It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the present specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0021] As used in the specification of the present application and the appended claims, the term "if" can be interpreted as "when..." or "once" or "in response to determination" or "in response to detection" according to the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once it is determined" or "in response to determination" or "once [the described condition or event] is detected" or "in response to detection [the described condition or event]" according to the context. In addition, in the description of the specification of the present application and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. The reference "one embodiment" or "some embodiments" described in the specification of the present application means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Thus, the sentences "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in the specification are not necessarily all referring to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "include", "comprising", "having" and variations thereof all mean "including but not limited to", unless specifically emphasized otherwise.

[0022] Example 1: Detection of SNPs related to the number of spikelets per wheat ear and their PCR-enzyme polymorphism

[0023] 1. Specific primers for amplifying the genome fragment containing the wheat SNP and sequence analysis

[0024] A SNP was found on the wheat genome, corresponding to the 95th position from the 5' end of the sequence shown in SEQ ID NO.1; this site has two genotypes in the natural variation population of wheat:

[0025] Genotype A: C

[0026] Genotype B: G

[0027] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0028] F1:ATGGCGGCCTTTCGAGATGTG(SEQ ID NO.2)

[0029] R1: TCAAGAAACAGACTTTTCGTCAGGAG (SEQ ID NO.3)

[0030] F2:ATGATAATATGCGAGCGGCCG(SEQ ID NO.4)

[0031] R2:TCAGGAGAAGAGGCACATGATCCG (SEQ ID NO.5)

[0032] The target sequence amplified by PCR using F1 and R1 as primers is the 1-759 sequence shown in Sequence 1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 74-217 sequence shown in Sequence 1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by NotI respectively.

[0033] 2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0034] 1) Extracting genomic DNA of wheat to be tested;

[0035] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (10 μL) was: ddH2O μL, 1 μL 10×PCRBuffer, 0.3 μL each of primer F1 (5 μmol / L) and primer R1 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0036] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0037] 3) The PCR product of step 2) was diluted 100 times and used as a template for PCR amplification with primers F2 and R2. The PCR amplification system (10 μL) was: ddH2O μL, 1 μL 10×PCR Buffer, 0.3 μL each of primer F2 (5 μmol / L) and primer R2 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0038] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 10 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0039] 4) The PCR product obtained in step 3) is digested with NotI to obtain the digestion product, and then the digestion product is detected by 4% agarose gel electrophoresis. It is recorded whether the PCR product is cut into two fragments, and the situation of the wheat to be tested at the said site is determined and recorded according to the following method:

[0040] If the enzyme cleavage product is two fragments, the wheat to be tested is C homozygous (expressed as C / C) at the site ( Figure 1 Lane C in the figure);

[0041] If the enzyme cleavage product is a fragment, the wheat to be tested is homozygous for G at the site (expressed as G / G) ( Figure 1 Lane G in Figure 5).

[0042] According to the result of step 4), the wheat is divided into two types, I and II, as follows:

[0043] I: C / C (i.e., homozygous for genotype A);

[0044] II: G / G (i.e., homozygous for genotype B);

[0045] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0046] 3. Use dCAPs markers to genotype natural populations and conduct association analysis with the number of spikelets per ear

[0047] Each wheat in the natural population consisting of 320 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0048] Table 1 The situation of the polymorphic sites in natural wheat populations

[0049]

[0050]

[0051]

[0052]

[0053] Example 2

[0054] Our technical team conducted exon capture sequencing on 385 materials and performed specific genotyping on these materials. The genotyping included two situations: genotype A homozygous C / C and genotype B homozygous G / G.

[0055] In addition, 320 of these 385 materials have multi-year and multi-point agronomic trait data, while the remaining 65 materials do not have sufficient data to meet the requirements of subsequent analysis. Therefore, as shown in Table 2, only these 320 data were used in the association analysis between the status of natural population gene polymorphism sites and the number of spikes per plant. However, among these 320 data, 78 materials were not genotyped, so the actual number of samples for association analysis was 242.

[0056] In 2019, the above natural population wheat was planted in the dryland of Hengshui Experimental Farm, Agricultural Resources Research Center, Chinese Academy of Sciences (Hengshui, Hebei), and in 2020 in the dry-hot land and dryland of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The number of spikelets per ear of each wheat variety was investigated, and the Tassel2.1 software was used to perform association analysis on the number of spikelets per ear and the polymorphic loci. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P<0.05 as the significance level. The results are shown in Table 2 and Table 3. Figure 2 shown.

[0057] Table 2 Results of association analysis between the status of gene polymorphisms in natural populations and the number of spikelets per ear

[0058]

[0059] The results of association analysis in Table 2 show that the differences in the number of spikelets per ear of the two types formed by the natural population composed of 320 hexaploid wheats shown in Table 1 reached a significant level (P<0.05). Among them, the number of spikelets per ear of wheat in type II is higher than that of wheat in type I. In several environments, the number of spikelets per ear of wheat materials in type II is 0.34, 0.35 and 0.37 higher than that of wheat in type I, respectively. Studies on natural populations have shown that type II is an excellent genotype for increasing the number of spikelets per ear of wheat.

[0060] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0061] From the above embodiments, it can be seen that the present invention has found a SNP through genetic variation analysis of gene promoters of natural variation populations of wheat, corresponding to the 95th position from the 5' end of sequence 1 in the sequence table, and the SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis has shown that in the homozygous types of these two haplotypes, the number of spikelets per ear is: the wheat homozygous for genotype B is greater than or is a candidate greater than the wheat homozygous for genotype A. Experiments have shown that by detecting the SNP, wheat with a relatively high number of spikelets per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties and research.

[0062] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A SNP locus associated with the number of spikelets per ear of wheat, characterized in that: The SNP site corresponds to the 95th base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the number of spikelets per ear is: the wheat homozygous for genotype A is greater than or is candidate greater than the wheat homozygous for genotype B.

2. A reagent or kit for identifying or assisting in identifying the trait of spikelet number per ear of wheat, characterized in that: The reagent or kit is used to detect the SNP site described in claim 1, and the reagent or kit comprises a PCR amplification specific primer combination and an enzyme cutting component corresponding to the SNP site, as well as a template DNA, a buffer, dNTPs and other necessary components for gene detection.

3. The reagent or kit according to claim 2, characterized in that: The target DNA fragment amplified by PCR in the reagent or kit is designed to be 74-217 bp at the 5' end of SEQ ID NO.

1.

4. The reagent or kit according to claim 2, characterized in that: The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

5. The reagent or kit according to claim 2, characterized in that: The enzyme cutting component is the restriction endonuclease NotI.

6. A primer combination, characterized in that: Used to detect the single nucleotide polymorphism of the following SNP site in the wheat genome, the SNP site corresponds to the 95th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; the primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence table, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; this primer combination is used to detect the SNP site described in claim 1.

7. A method for identifying or assisting in identifying wheat genotypes, characterized in that: A DNA fragment containing the SNP site of claim 1 in any section of the wheat genomic DNA to be tested is amplified by PCR, and the PCR amplification product is identified by enzyme digestion.

8. The method for identifying or assisting in identifying wheat genotypes according to claim 7, characterized in that: The DNA fragment amplified by PCR is 74-217 bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

9. The method for identifying or assisting in identifying wheat genotypes according to claim 7, characterized in that: The enzyme digestion comprises the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 100 times, using it as a template, and using primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using restriction endonuclease NotI to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is G / G and the genotype is B; the number of spikelets per ear is: the number of wheat homozygous for genotype A is greater than or the candidate number is greater than the number of wheat homozygous for genotype B.

10. Use of the SNP locus according to claim 1 in identifying or assisting in identifying the trait of the number of spikelets per ear in wheat.

Images