Multiplex qPCR primer-probe set, detection system, kit and application for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus

Abstract

The present invention provides a multiplex qPCR primer-probe set, a detection system, a kit and an application for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, belonging to the technical field of virus detection. The multiplex qPCR detection primer-probe set of the present invention includes an upstream primer DEV-F, a downstream primer DEV-R and a fluorescent probe DEV-Probe for detecting duck enteritis virus; an upstream primer GPV-F, a downstream primer GPV-R and a fluorescent probe GPV-Probe for detecting goose parvovirus, and an upstream primer MDPV-F, a downstream primer MDPV-R and a fluorescent probe MDPV-Probe for detecting Muscovy duck parvovirus. The primer-probe set of the present invention has good specificity and sensitivity, can simultaneously detect 3 pathogens of waterfowl infectious diseases, there is no cross-reaction among the 3 pathogens, and has high stability, and its coefficient of variation is below 10%.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and particularly relates to a multiplex qPCR primer-probe set, a detection system, a kit and an application for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus. Background Art

[0002] Duck viral enteritis is an acute infectious disease caused by duck enteritis virus (DEV), also known as duck plague, which affects various waterfowl species such as ducks, geese and swans, and is widely spread between continents through migratory waterfowl. Its characteristics are the invasion of blood vessels, erosion of the digestive tract mucosa, tissue hemorrhage, lesions of lymphoid organs and degenerative lesions of its parenchymal organs. Recovered ducks may still carry and excrete the virus, resulting in the widespread transmission of the disease in duck flocks, seriously affecting the development of the duck farming industry. Gosling plague is an acute septicemic infectious disease caused by goose parvovirus (GPV). The pathological characteristics of this disease are large areas of necrosis, shedding of the small intestinal mucosa surface and fibrin exudate coagulating into embolisms or pseudomembranes wrapping the surface of intestinal contents, blocking the intestinal lumen to form "intestinal embolisms". It mainly affects goslings and Muscovy ducklings. This disease can occur throughout the year, with a fast transmission speed, high incidence and mortality rates, and is one of the important infectious diseases endangering the goose farming industry, causing heavy losses to the goose farming industry. With the recombination or continuous mutation of goose parvovirus, the infection spectrum is also continuously expanding. Muscovy duck parvovirus (MDPV), which is also a parvovirus family like gosling plague, also affects the waterfowl industry. Its clinical symptoms include dyspnea, pancreatic necrosis, diarrhea caused by exudative enteritis, etc. The mortality rate of infected Muscovy ducks can reach 10% - 80%. Since the two are not only extremely similar in terms of virus size, morphology, structural proteins, physicochemical properties and nucleic acid types, but also extremely similar in terms of epidemiology, clinical symptoms and pathological changes, gosling plague is easily confused with Muscovy duck parvovirus disease clinically.

[0003] The establishment of virus detection methods is crucial for the prevention and control of waterfowl infectious diseases. Common virus detection methods include molecular biology detection, pathogen isolation and identification, and serological detection, etc. Molecular biology detection techniques such as PCR (Polymerase Chain Reaction) can quickly and accurately detect the nucleic acid of the virus, which is of great significance for the early detection of virus infection. Serological detection judges whether poultry has ever been infected with a certain virus by detecting the antibody level in the serum, and it is a commonly used epidemiological investigation method. However, the above two methods have disadvantages such as complex operation, time-consuming and laborious, and poor sensitivity. Especially when waterfowl are co-infected with multiple pathogens, it is difficult to conduct early rapid detection and differential diagnosis using conventional methods. However, the simultaneous detection of DEV, MDPV, and GPV based on TaqMan probes has not been reported. Therefore, in order to promptly discover the emergence of diseases and take effective prevention and control measures, it is very necessary to develop a convenient, rapid, and effective method for simultaneously detecting DEV, MDPV, and GPV. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a multiplex qPCR primer-probe set for detecting Duck enteritis virus, Goose parvovirus, and Muscovy duck parvovirus. The primer-probe set can simultaneously detect 3 pathogens of waterfowl infectious diseases, there is no cross-reaction among the 3 pathogens, and it has high stability.

[0005] The purpose of the present invention is also to provide a multiplex qPCR detection system for Duck enteritis virus, Goose parvovirus, and Muscovy duck parvovirus.

[0006] The purpose of the present invention is also to provide a multiplex qPCR kit for detecting Duck enteritis virus, Goose parvovirus, and Muscovy duck parvovirus.

[0007] In order to achieve the above-mentioned invention purposes, the present invention provides the following technical solutions:

[0008] The present invention provides a multiplex qPCR primer-probe set for detecting Duck enteritis virus, Goose parvovirus, and Muscovy duck parvovirus. The primer-probe set includes an upstream primer DEV-F for detecting Duck enteritis virus, a downstream primer DEV-R, and a fluorescent probe DEV-Probe; an upstream primer GPV-F for detecting Goose parvovirus, a downstream primer GPV-R, and a fluorescent probe GPV-Probe; and an upstream primer MDPV-F for detecting Muscovy duck parvovirus, a downstream primer MDPV-R, and a fluorescent probe MDPV-Probe;

[0009] The nucleotide sequence of the upstream primer DEV-F for detecting Duck enteritis virus is as shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer DEV-R is as shown in SEQ ID NO.2, and the nucleotide sequence of the fluorescent probe DEV-Probe is as shown in SEQ ID NO.3;

[0010] The nucleotide sequence of the upstream primer GPV-F for detecting goose parvovirus is shown in SEQ ID NO.5, the nucleotide sequence of the downstream primer GPV-R is shown in SEQ ID NO.6, and the nucleotide sequence of the fluorescent probe GPV-Probe is shown in SEQ ID NO.7;

[0011] The nucleotide sequence of the upstream primer MDPV-F for detecting muscovy duck parvovirus is shown in SEQ ID NO.10, the nucleotide sequence of the downstream primer MDPV-R is shown in SEQ ID NO.11, and the nucleotide sequence of the fluorescent probe MDPV-Probe is shown in SEQ ID NO.12.

[0012] Preferably, the 5' end of the fluorescent probe in the primer-probe group is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quenching group.

[0013] More preferably, the fluorescent reporter group includes one of HEX, CY5 or FAM; the fluorescent quenching group includes BHQ1 or BHQ2.

[0014] The present invention also provides a multiplex qPCR kit for detecting duck enteritis virus, goose parvovirus and muscovy duck parvovirus, and the kit contains the above-mentioned multiplex qPCR primer-probe group.

[0015] The present invention also provides a detection system for multiplex qPCR of duck enteritis virus, goose parvovirus and muscovy duck parvovirus, and the detection system for multiplex qPCR contains the above-mentioned multiplex qPCR primer-probe group.

[0016] Preferably, based on a total volume of 25 μL, the detection system for multiplex qPCR includes the following components: 12.5 μL of Probe qPCR Mix, 2 μL of mixed template, 0.6 μL of the upstream primer DEV-F at 8 - 12 μM, 0.6 μL of the downstream primer DEV-R at 8 - 12 μM, 0.8 μL of the fluorescent probe DEV-Probe at 8 - 12 μM; 0.8 μL of the upstream primer GPV-F at 8 - 12 μM, 0.8 μL of the downstream primer GPV-R at 8 - 12 μM, 1 μL of the fluorescent probe GPV-Probe at 8 - 12 μM; 0.6 μL of the upstream primer MDPV-F at 8 - 12 M, 0.6 μL of the downstream primer MDPV-R at 8 - 12 μM, 0.8 μL of the fluorescent probe MDPV-Probe at 8 - 12 μM; 3.9 μL of ddH 2 O.

[0017] More preferably, in the mixed template, the three pathogen templates of duck enteritis virus, goose parvovirus and muscovy duck parvovirus are mixed in an equal volume ratio.

[0018] The present invention also provides a multiplex qPCR detection method for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus for non-diagnostic purposes, comprising the following steps:

[0019] Extract the RNA of the sample to be tested and reverse transcribe it into cDNA;

[0020] Using the above cDNA as a template, perform multiplex qPCR amplification with the multiplex qPCR primer-probe set, or the kit, or the detection system described above;

[0021] After the reaction, judge whether DEV, GPV and MDPV in the sample to be tested are positive according to the amplification curve.

[0022] Preferably, the judgment criteria are as follows: if an amplification curve appears in the detection of the sample to be tested and Ct ≤ 35, it is determined as positive; if 35 < Ct ≤ 38 in the fluorescence channel, it is determined as suspicious and needs to be retested; if there is no amplification curve in the fluorescence channel or Ct value > 38, it is determined as negative.

[0023] Preferably, the reaction procedure of the multiplex qPCR amplification is as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 48°C for 30 s, extension at 72°C for 20 s, 40 cycles.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides a primer-probe set for detecting three pathogens of waterfowl infectious diseases, namely duck enteritis virus DEV, goose parvovirus GPV and Muscovy duck parvovirus MDPV. The primer-probe set is used to detect the three pathogens of waterfowl infectious diseases, and has good specificity and sensitivity. Compared with the currently widely used PCR detection, pathogen isolation and identification, and serological detection, it has quite high detection sensitivity. The primer-probe set of the present invention can simultaneously detect three pathogens of waterfowl infectious diseases, there is no cross-reaction among the three pathogens, and it has high stability, and its coefficient of variation is all below 10%. The present invention also establishes a multiplex qRT-PCR system and method for simultaneously detecting DEV, GPV and MDPV. Using the multiplex qRT-PCR detection system and method provided by the present invention, the three viruses of DEV, GPV and MDPV can be quickly detected, which can provide effective prevention for these three viruses and is expected to reduce the economic losses in waterfowl breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a graph showing the optimization result of the annealing temperature for the multiplex qPCR detection of the present invention;

[0027] Figure 2qPCR fluorescence quantitative sensitivity amplification curves and standard curves for the detection of a single waterfowl infectious disease pathogen. In the figure, A represents the sensitivity amplification curve and standard curve of DEV, B represents the sensitivity amplification curve and standard curve of GPV, and C represents the sensitivity amplification curve and standard curve of MDPV;

[0028] Figure 3 qPCR fluorescence quantitative sensitivity amplification curves and standard curves for the detection of three waterfowl infectious disease pathogens. In the figure, A represents the sensitivity amplification curves of three waterfowl infectious disease pathogens, and B represents the standard curves of three waterfowl infectious disease pathogens;

[0029] Figure 4 Specific detection result diagram of multiplex qPCR. In the figure, 1 - 3: plasmid standard templates DEV, GPV, and MDPV, 1' - 3': DEV, GPV, and MDPV virus templates, 4 - 9: DTMUV, NDRV, DHAV - 1, DHAV - 3, NDV, and AIV virus templates;

[0030] Figure 5 Systematic calibration of each determination criterion of the established method using different brands of qPCR instruments for the multiplex qPCR detection system of the present invention. In the figure, A represents the sensitivity amplification curve and standard curve of DEV, B represents the sensitivity amplification curve and standard curve of GPV, C represents the sensitivity amplification curve and standard curve of MDPV; D represents the specific result diagram of each virus under the triple system provided by the present invention;

[0031] Figure 6 Detection of serum and lesion tissue samples under the multiplex qPCR detection system of the present invention. In the figure, purple represents MDPV; blue represents GPV; green represents DEV. Detailed implementation mode

[0032] The present invention provides a multiplex qPCR primer - probe set for detecting duck enteritis virus, goose parvovirus, and muscovy duck parvovirus. The present invention designs the primer - probe set according to the UL6 gene of duck enteritis virus DEV, the NS gene of goose parvovirus GPV, and the VP gene of muscovy duck parvovirus MDPV; the primer - probe set includes an upstream primer DEV - F, a downstream primer DEV - R, and a fluorescent probe DEV - Probe for detecting duck enteritis virus; an upstream primer GPV - F, a downstream primer GPV - R, and a fluorescent probe GPV - Probe for detecting goose parvovirus; and an upstream primer MDPV - F, a downstream primer MDPV - R, and a fluorescent probe MDPV - Probe for detecting muscovy duck parvovirus;

[0033] The nucleotide sequence of the upstream primer DEV-F for detecting Duck enteritis virus is preferably GGCCAGGGAGTTTATAATTCGG (SEQ ID NO.1), the nucleotide sequence of the downstream primer DEV-R is preferably GCTATATGTCGTGCATCTAACCC (SEQ ID NO.2), and the nucleotide sequence of the fluorescent probe DEV-Probe is preferably CTGCCATACGWCAAATCCAGGCGAC (SEQ ID NO.3); where W is a degenerate base, and its corresponding base is A or T. In a specific embodiment of the present invention, the nucleotide sequence of the fluorescent probe DEV-Probe for detecting Duck enteritis virus is more preferably CTGCCATACGACAAATCCAGGCGAC (SEQ ID NO.4);

[0034] The nucleotide sequence of the upstream primer GPV-F for detecting Goose parvovirus is preferably AATTGTTCYCATCAGTYGCTC (SEQ ID NO.5), the nucleotide sequence of the downstream primer GPV-R is preferably ARTTTGCYTTCTCACATTCCATAC (SEQ ID NO.6), and the nucleotide sequence of the fluorescent probe GPV-Probe is preferably CCTGTGACTCCTCAGAACTCCCCT (SEQ ID NO.7); where Y and R are degenerate bases, the base corresponding to Y is C or T, and the base corresponding to R is A or G; In a specific embodiment of the present invention, the nucleotide sequence of the upstream primer GPV-F for detecting Goose parvovirus is more preferably AATTGTTCTCATCAGTCGCTC (SEQ ID NO.8), and the nucleotide sequence of the downstream primer GPV-R is more preferably AGTTTGCTTTCTCACATTCCATAC (SEQ ID NO.9),

[0035] The nucleotide sequence of the upstream primer MDPV-F for detecting Muscovy duck parvovirus is AAGCTACAACAACCACATSTAC (SEQ ID NO.10), the nucleotide sequence of the downstream primer MDPV-R is GGCAGTGRAATCTGTTGAAAT (SEQ ID NO.11), and the nucleotide sequence of the fluorescent probe MDPV-Probe is ATCACAAGCGGAACAAACCCAGAC (SEQ ID NO.12), where S and R are degenerate bases, the base corresponding to S is G or C, and the base corresponding to R is A or G; in a specific embodiment of the present invention, the nucleotide sequence of the upstream primer MDPV-F for detecting Muscovy duck parvovirus is more preferably AAGCTACAACAACCACATCTAC (SEQ ID NO.13), and the nucleotide sequence of the downstream primer MDPV-R is more preferably GGCAGTGGAATCTGTTGAAAT (SEQ ID NO.14).

[0036] The present invention designs fluorescent probes and primers based on gene chip technology. Factors such as the size of the fluorescent probe and the length of the target DNA will affect the hybridization signal. Generally, when the oligonucleotide probe is 16 - 25bp, the sensitivity and specificity of the chip can be taken into account. At the same time, the smaller the target fragment, the higher the amplification efficiency, but when the length is too low, its stability is poor, which may cause a decrease in the hybridization signal. In the present invention, the length of each probe is 24 - 25bp, the target fragment of the DEV target gene is 161bp, the target fragment of the GPV target gene is 153bp, and the target fragment of the MDPV target gene is 119bp, ensuring a stable and clear response signal.

[0037] In the present invention, the fluorescent probe is an oligonucleotide, the 5' end of the fluorescent probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quenching group. In the extension stage of PCR amplification, the 5'-3' exonuclease activity of Taq enzyme cleaves and degrades the fluorescent probe, separating the reporter fluorescent group and the quenching fluorescent group. The fluorescence monitoring system can receive the fluorescent signal, presenting curves of different fluorescent colors to distinguish three kinds of waterfowl infectious disease pathogens. In the present invention, the fluorescent reporter group preferably includes one of HEX, CY5 or FAM; the fluorescent quenching group preferably includes BHQ1 or BHQ2.

[0038] The primer-probe group provided by the present invention is used to detect three kinds of waterfowl infectious disease pathogens, has good specificity and sensitivity, can detect three kinds of waterfowl infectious disease pathogens simultaneously, there is no cross-reaction among the three pathogens, and has high stability, and its coefficient of variation is all below 10%.

[0039] The present invention also provides a multiplex qPCR kit for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, and the kit contains the above-mentioned multiplex qPCR primer-probe group.

[0040] The present invention also provides a multiplex qPCR detection system for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, and the multiplex qPCR detection system comprises the above-mentioned multiplex qPCR primer-probe set.

[0041] In the present invention, preferably based on a total volume of 25 μL, the multiplex qPCR detection system comprises the following components: 12.5 μL of Probe qPCR Mix, 2 μL of mixed template, 0.6 μL of upstream primer DEV-F at 8-12 μM, 0.6 μL of downstream primer DEV-R at 8-12 μM, 0.8 μL of fluorescent probe DEV-Probe at 8-12 μM; 0.8 μL of upstream primer GPV-F at 8-12 μM, 0.8 μL of downstream primer GPV-R at 8-12 μM, 1 μL of fluorescent probe GPV-Probe at 8-12 μM; 0.6 μL of upstream primer MDPV-F at 8-12 μM, 0.6 μL of downstream primer MDPV-R at 8-12 μM, 0.8 μL of fluorescent probe MDPV-Probe at 8-12 μM; 3.9 μL of ddH 2 O. In the present invention, the molar concentrations of the respective primers and fluorescent probes are more preferably 10 μM. The present invention determines the concentrations and addition amounts of the respective primers and fluorescent probes in the detection system through orthogonal experiments to ensure that the detection results have good stability.

[0042] In the present invention, the three pathogen templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus in the mixed template are preferably mixed in an equal volume ratio. In the present invention, the three pathogen templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus are more preferably mixed according to a volume ratio of 1:1:1. As an implementable method, 1-3 μL of each of the three pathogen templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus are respectively sucked and fully mixed, and the mixed template is sucked as the mixed template.

[0043] The present invention also provides a multiplex qPCR detection method for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus for non-diagnostic purposes, preferably comprising the following steps:

[0044] Extract the RNA of the sample to be detected and reverse-transcribe it into cDNA;

[0045] Using the above cDNA as a template, perform multiplex qPCR amplification by using the above-mentioned multiplex qPCR primer-probe set, or the above-mentioned kit, or the above-mentioned detection system;

[0046] After the reaction is completed, judge whether DEV, GPV and MDPV in the sample to be detected are positive according to the amplification curve situation.

[0047] The present invention does not make special limitations on the methods for extracting sample RNA and reverse transcription. Conventional means well-known in the art can be used to extract RNA from the sample to be tested and perform reverse transcription; or a conventional commercially available kit can be used to extract RNA from the sample to be tested and perform reverse transcription. The detection method established by the present invention can simultaneously and rapidly detect three viruses, namely DEV, GPV, and MDPV, and can also perform single detection of each virus.

[0048] The detection instrument used in the present invention can collect fluorescence-labeled probe signals of different wavelengths, and the corresponding primer probes can be located according to different well positions and fluorescence signals. In the present invention, the judgment criteria are preferably as follows: if an amplification curve appears in the detection of the sample to be tested and Ct ≤ 35, it is determined as positive; if 35 < Ct ≤ 38, it is determined as suspicious and needs to be retested; if there is no amplification curve or Ct value > 38, it is determined as negative. In the present invention, as an implementable method, if it is still suspicious after retesting and excluding environmental pollution, it is determined as weak positive for the viral nucleic acid in the corresponding channel.

[0049] In the present invention, the reaction program of the multiplex qPCR amplification is preferably as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 48°C for 30 s, extension at 72°C for 20 s, for 40 cycles. The present invention optimizes the annealing temperature through orthogonal experiments to determine the annealing temperature in the amplification reaction program of the present invention to ensure that the amplification reaction has good stability.

[0050] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0051] In the following embodiments, Duck enteritis virus (DEV), Goose parvovirus (GPV), Muscovy duck parvovirus (MDPV), Duck Tembusu virus (DTMUV), Novel duck reovirus (NDRV), Duck hepatitis A virus type 1 (DHAV-1), Duck hepatitis A virus type 3 (DHAV-3), Newcastle disease virus (NDV Lasota strain), and Avian influenza H9 (AIV-H9) were provided by the China Institute of Veterinary Drug Control.

[0052] The virus genomic DNA extraction kit, virus genomic RNA extraction kit, and rapid plasmid miniprep kit were all purchased from Tiangen Biochemical Technology Co., Ltd. The DH5α competent cells were purchased from Novizan, and the MiniBEST Agarose Gel DNA Extraction Kit, One Step PrimeScript TM III RT-qPCR Mix, with UNG, pMD TM 19-T Vector Cloning Kit was purchased from TAKARA Co., Ltd.

[0053] Example 1 Establishment of multiplex qPCR detection method

[0054] 1. Design of primers and probes

[0055] To ensure the detection performance of the primers and probes used in the multiplex qRT-PCR method, all available DEV, GPV, and MDPV sequences were obtained from GenBank and analyzed. Primers and probes for DEV, GPV, and MDPV were designed based on the UL6 gene of DEV, the NS gene of GPV, and the VP gene of MDPV, as shown in Table 1.

[0056] Table 1 Multiplex fluorescence quantitative RT-qPCR primers and probes

[0057]

[0058]

[0059] 2. Preparation of recombinant positive plasmids of three viruses

[0060] 2.1 Nucleic acid extraction of samples

[0061] According to the instructions of the Tiangen virus genomic DNA extraction kit, nucleic acids of 3 virus samples were extracted respectively.

[0062] 2.2 Amplification of target fragments of each virus

[0063] Fragments with a length of 110 - 161 bp amplified by the primers of each pathogen in Table 2 were used as the target fragments for inserting into the T vector, and PCR amplification reactions were carried out to obtain the target products. Using the nucleic acids extracted in 2.1 as templates, the reaction system was: 25 μL of 2×TaqMasterMix, 2 μL of each upstream and downstream primer in Table 2, 4 μL of a single virus template, and 17 μL of double-distilled water ddH 2 O. The reaction program was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 48°C for 30 s, extension at 72°C for 30 s, for 35 cycles; 72°C for 7 min, and stored at 4°C.

[0064] Table 2 Amplification primers

[0065]

[0066] 2.3 Construction of recombinant T vectors and extraction of recombinant positive plasmids

[0067] Operate according to the instructions of the MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 from TAKARA to purify the target product of PCR. Then, construct the T-vector according to the instructions of the pMD TM 19-T Vector Cloning Kit from TARAKA, coat it on the Amp-resistant medium. Select the bacterial liquid samples with positive PCR for sequencing, use NCBI Nucleotide Blast to compare the sequencing results, and finally operate according to the instructions of the Tiangen Fast Plasmid Mini Kit to extract the recombinant positive plasmids of each virus.

[0068] 3. Optimization of multiplex qPCR amplification conditions

[0069] To establish the multiplex qPCR method, use the recombinant positive plasmids extracted in 2.3 as plasmid standards and perform serial dilutions. The copy numbers after dilution are as follows:

[0070] DEV: 1.16×10 9 copies / μL~1.16×10 0 copies / μL;

[0071] GPV: 9.8×10 8 copies / μL~9.8×10 0 copies / μL;

[0072] MDPV: 1.48×10 9 copies / μL~1.48×10 0 copies / μL.

[0073] Mix all the primers, probes and serially diluted plasmid standards of DEV, GPV and MDPV with 12.5 μL Probe qPCR Mix and sterile ddH 2 O in a 25 μL reaction system. Finally, optimize the concentrations of each primer and probe. Determine the optimal concentrations of the primers and probes and the optimal annealing temperature through orthogonal experiments. The determination of the optimal primer and probe dosage and annealing temperature should be based on the best amplification curve and lower CT value at a certain value during the orthogonal process to determine the optimal primer and probe dosage and annealing temperature. The specific primer and probe sequences are shown in Table 3.

[0074] Table 3 Sequences of primers and probes for multiplex fluorescence quantitative RT-qPCR

[0075]

[0076] According to Figure 1The results in Tables 4 to 6 show that the optimal primer concentrations and probe concentrations for DEV, GPV, and MDPV are as follows: 0.6 μL of the upstream primer DEV-F at 10 μM, 0.6 μL of the downstream primer DEV-R at 10 μM, and 0.8 μL of the fluorescent probe DEV-Probe at 10 μM; 0.8 μL of the upstream primer GPV-F at 10 μM, 0.8 μL of the downstream primer GPV-R at 10 μM, and 1 μL of the fluorescent probe GPV-Probe at 10 μM; 0.6 μL of the upstream primer MDPV-F at 10 μM, 0.6 μL of the downstream primer MDPV-R at 10 μM, and 0.8 μL of the fluorescent probe MDPV-Probe at 10 μM. The reaction system is 12.5 μL of Probe qPCR Mix, 2 μL of mixed template, 0.6 μL each of 10 μM DEV-F and DEV-R primers, 0.8 μL of 10 μM DEV-Probe probe; 0.6 μL each of 10 μM MDPV-F and MDPV-R primers, 0.8 μL of 10 μM MDPV-Probe probe; 0.8 μL of 10 μM GPV-F and GPV-R primers, 1 μL of 10 μM GPV-Probe probe; ddH 2 O, 3.9 μL. The optimization results of the annealing temperature show that 48 °C is the optimal annealing temperature, and the reaction amplification conditions are 95 °C for 30 s, 95 °C for 5 s, 48 °C for 30 s, 72 °C for 20 s, for 40 cycles.

[0077] Table 4 Optimization of Primer and Probe Concentrations for Duck Enteritis Virus (CT Values)

[0078]

[0079] Table 5 Optimization of Primer and Probe Concentrations for Goose Parvovirus (CT Values)

[0080]

[0081] Table 6 Optimization of Primer and Probe Concentrations for Muscovy Duck Parvovirus (CT Values)

[0082]

[0083]

[0084] 4. Construction of Standard Curve

[0085] The plasmid standards of the three viruses obtained in Step 2.3 of Example 1 were serially diluted 10-fold to establish a standard curve for each virus. In analytical chemistry experiments, the standard curve method is commonly used for quantitative analysis. The scales of the abscissa and ordinate of the graph paper used to draw the standard curve and the size of the experimental points should not be too large or too small, and should approximately reflect the measurement accuracy. Therefore, the plasmid standards of the three viruses were diluted 107 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL, 7 concentrations were used as templates respectively to prepare the standard curves of three viruses. ddH 2 O was used as the negative control template for TaqMan fluorescence quantitative RT-qPCR amplification ( Figure 2 ), and the standard curves were drawn according to the final results ( Figure 3 ). The standard curve of DEV was y = -3.5197x + 40.21, the standard curve of GPV was y = -3.436x + 37.718, and the standard curve of MDPV was y = -3.5135x + 39.464; the multiple qPCR standard curves all showed good correlation coefficients and amplification efficiencies: DEV (R 2 = 0.9921, Eff% = 91); GPV (R 2 = 0.994, Eff% = 89); MDPV (R 2 = 0.994, Eff% = 93).

[0086] 5. Result determination

[0087] The instrument collected the fluorescence-labeled probe signals at different wavelengths. After being processed by software, the amplification curves of three fluorescence channels, FAM, VIC, and CY5, were presented. According to the different well positions and fluorescence signals, the corresponding primer probes could be located. The results were as Figure 4 shown. If an amplification curve appeared in the sample detection and ct ≤ 35, it was determined as positive; if 35 < Ct ≤ 38 in the corresponding channel, it was determined as suspicious and needed to be retested; if it was still suspicious after retesting and environmental pollution was excluded, it was determined as weak positive for the viral nucleic acid in the corresponding channel; if there was no amplification curve in the corresponding channel or Ct value > 38, it was determined as negative for the nucleic acid in that channel.

[0088] Example 2 Sensitivity detection of multiple qPCR

[0089] To analyze the sensitivity of the established multiple RT-qPCR detection, the plasmid standard products obtained in step 2.3 of Example 1 were mixed and then serially diluted 10-fold in sterile ddH 2 O. The final concentrations after dilution were from 10 8 to 10 0Between copies / μL, these diluted standard plasmids were used as templates for RT-qPCR amplification. The single-template sensitivities of the three viruses were detected under a mixed system. The single-detection sensitivity of DEV was 11.6 copies / μL, that of GPV was 95 copies / μL, and that of MDPV was 14.8 copies / μL( Figure 2 ). The sensitivities of the three viruses for detecting mixed templates were detected under a mixed system. The multiplex detection sensitivities of DEV, GPV, and MDPV were 116 copies / μL, 95 copies / μL, and 14.8 copies / μL respectively( Figure 3 , Table 7).

[0090] Table 7 Sensitivity of multiplex fluorescence quantitative RT-qPCR

[0091]

[0092]

[0093] Example 3 Specific detection of multiplex qPCR

[0094] Using the cDNA of 9 waterfowl viruses, DEV, MDPV, GPV, DTMUV, DHAV-1, DHAV-3, NDRV, AIV-H9, and NDV, as amplification templates, the specificity of the multiplex RT-qPCR established in Example 1 was evaluated. Sterile ddH 2 O was used as a negative control template (see Figure 4 ). The results showed that DEV, GPV, and MDPV were successfully detected; no signals were detected for NDRV, DHAV-1, DHAV-3, DTMUV, AIV-H9, and NDV, and no signals were detected for the negative control either.

[0095] Example 4 Repeatability of multiplex qPCR

[0096] To evaluate the repeatability of multiplex qPCR, 10-fold serial dilutions of the plasmid standards prepared in step 2.3 of Example 1 were used to detect the coefficient of variation (CV) of RT-qPCR. All tests were repeated three times to evaluate the repeatability within batches. To evaluate the repeatability between batches, the tests were repeated three times at different locations (see Tables 8-10). The coefficient of variation within batches of DEV was 0.21-2.28%, and that between batches was 0.28-3.25%. The coefficients of variation of GPV amplification within and between batches were 0.17-2.17% and 0.24-3.45% respectively. The coefficients of variation of MDPV amplification within and between batches were 0.02-2.30% and 0.55-3.34% respectively. The results showed that the multiplex qPCR detection system of the present invention had good repeatability.

[0097] Table 8 Coefficient of variation within and between batches of duck enteritis virus

[0098]

[0099] Table 9 Coefficient of variation within and between batches of goose parvovirus

[0100]

[0101]

[0102] Table 10 Coefficient of variation within and between batches of Muscovy duck parvovirus

[0103]

[0104] Example 5 Calibration of different brand qPCR instrument systems

[0105] All reactions established for the multiplex qPCR method in the present invention were carried out on a QuantStudio 7Flex qPCR instrument system (Thermo Fisher SCIENTIFIC). To improve the adaptability of the present invention, the construction method of the standard curve in Example 1, the sensitivity detection in Example 2, and the specificity detection in Example 3 were carried out on a Bio-Rad CFX 384 qPCR instrument system for method construction. The standard curve results showed that the DEV standard curve was y = -3.3354x + 36.81, the GPV standard curve was y = -3.3019x + 35.49, and the MDPV standard curve was y = -3.5759x + 36.345; the multiplex qPCR standard curves all showed good correlation coefficients and amplification efficiencies: DEV (R 2 = 0.9976, Eff% = 99); GPV (R 2 = 0.9989, Eff% = 200); MDPV (R 2 = 0.9998, Eff% = 90). The sensitivity results showed that the single detection sensitivity of DEV was 11.6 copies / μL, the single detection sensitivity of GPV was 95 copies / μL, and the single detection sensitivity of MDPV was 14.8 copies / μL. The specificity results showed that DEV, GPV, and MDPV were successfully detected; no signals were detected for NDRV, DHAV-1, DHAV-3, DTMUV, AIV-H9, and NDV, and no signals were detected for the negative control (see Figure 5 ). The results indicate that the multiplex qPCR detection method established in the present invention shows good results through two different models of instruments, has strong adaptability, and can be applied to a variety of detection instruments.

[0106] Example 6 Detection of Sample Diversity by Multiplex qPCR

[0107] To cope with the diversity of clinical samples, 83 waterfowl lesion tissues (Table 11) and 12 healthy serum samples collected from Nanchang, Jiangxi were collected, and the detection was carried out according to the steps of Example 1. The results showed that 34 positives were detected in 83 lesion tissue samples, including 18 positives for GPV, 4 positives for MDPV, and 12 positives for DEV. At the same time, the serum samples of healthy waterfowl were detected, and no positive amplification occurred (see Figure 6 ).

[0108] Table 11 Summary of Information on the Collection of 83 Waterfowl Lesion Tissue Samples

[0109] Collection Location Quantity Fujian 34 Guangxi 8 Anhui 6 Guangdong 7 Jiangsu 3 Jiangxi 12 Shandong 13

[0110] Example 7 Application of Multiplex qPCR in the Detection of Clinical Samples

[0111] In this example, a total of 142 clinical samples from pathogen-positive or suspected waterfowl were collected. The clinical samples were prepared into an amplification system according to Example 1, and multiplex qPCR detection was carried out. The results were judged by the result judgment method in Example 1, and the positive rate was calculated. At the same time, the common PCR detection technology was used for co-detection to analyze the consistency of the detection results. The multiplex qPCR method established by the present invention detected 18 DEV samples, 20 GPV samples, and 12 MDPV samples in total.

[0112] Table 12 Detection Results of Clinical Samples

[0113] Pathogen qPCR Positive Rate (%) PCR Kappa Test DEV 12 / 215 5.5％ 12 / 215 1.000(p＜0.001) GPV 25 / 215 11.6％ 24 / 215 0.977(p＜0.001) MDPV 10 / 215 4.6％ 10 / 215 1.000(p＜0.001)

[0114] In the table, Kappa test:

[0115]

[0116] That is: κ = (agreement of two observations - chance agreement of two observations) / (1 - chance agreement of two observations); κ ≤ 0.40 means poor agreement, 0.40 < κ ≤ 0.60 means moderate agreement, 0.60 < κ ≤ 0.80 means relatively high agreement, and κ > 0.80 means excellent agreement.

[0117] According to the results shown in Table 12, the positive rate detected by the multiplex qPCR detection method established by the present invention is relatively consistent with the positive rate detected by the PCR detection technology, and the two have good consistency through Kappa test calculation.

[0118] In summary, the present invention has established a multiplex qPCR system and method for simultaneously detecting DEV, GPV, and MDPV. By using the multiplex qPCR detection system and method provided by the present invention, these three viruses, namely DEV, GPV, and MDPV, can be quickly detected, which can provide effective prevention for these three viruses and is expected to reduce the economic losses in waterfowl farming.

[0119] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A multiplex qPCR primer probe set for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, characterized in that: The primer probe group includes an upstream primer DEV-F, a downstream primer DEV-R and a fluorescent probe DEV-Probe for detecting duck enteritis virus; an upstream primer GPV-F, a downstream primer GPV-R and a fluorescent probe GPV-Probe for detecting goose parvovirus; and an upstream primer MDPV-F, a downstream primer MDPV-R and a fluorescent probe MDPV-Probe for detecting Muscovy duck parvovirus; The nucleotide sequence of the upstream primer DEV-F for detecting duck enteritis virus is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer DEV-R is shown in SEQ ID NO.2, and the nucleotide sequence of the fluorescent probe DEV-Probe is shown in SEQ ID NO.4; The nucleotide sequence of the upstream primer GPV-F for detecting goose parvovirus is shown in SEQ ID NO.8, the nucleotide sequence of the downstream primer GPV-R is shown in SEQ ID NO.9, and the nucleotide sequence of the fluorescent probe GPV-Probe is shown in SEQ ID NO.7; The nucleotide sequence of the upstream primer MDPV-F for detecting Muscovy duck parvovirus is shown in SEQ ID NO. 13, the nucleotide sequence of the downstream primer MDPV-R is shown in SEQ ID NO. 14, and the nucleotide sequence of the fluorescent probe MDPV-Probe is shown in SEQ ID NO.

12.

2. The multiplex qPCR primer probe set according to claim 1, characterized in that: The 5' end of the fluorescent probe in the primer probe set is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

3. The multiplex qPCR primer probe set according to claim 2, characterized in that: The fluorescent reporter group includes one of HEX, CY5 or FAM; the fluorescent quencher group includes BHQ1 or BHQ2.

4. A multiplex qPCR kit for detecting duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, characterized in that: The kit comprises the multiplex qPCR primer probe set according to any one of claims 1 to 3.

5. A multiplex qPCR detection system for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus, characterized in that: The multiplex qPCR detection system comprises the multiplex qPCR primer probe set according to any one of claims 1 to 3.

6. The multiplex qPCR detection system according to claim 5, characterized in that: The multiplex qPCR detection system includes the following components in a total volume of 25 μL: 12.5 μL Probe qPCR Mix, 2 μL mixed template, 0.6 μL of 10 μM upstream primer DEV-F, 0.6 μL of 10 μM downstream primer DEV-R, 0.8 μL of 10 μM fluorescent probe DEV-Probe; 0.8 μL of 10 μM upstream primer GPV-F, 0.8 μL of 10 μM downstream primer GPV-R, 1 μL of 10 μM fluorescent probe GPV-Probe; 0.6 μL of 10 μM upstream primer MDPV-F, 0.6 μL of 10 μM downstream primer MDPV-R, 0.8 μL of 10 μM fluorescent probe MDPV-Probe; 3.9 μL ddH2O.

7. The multiplex qPCR detection system according to claim 6, characterized in that: In the mixed template, three pathogenic templates of duck enteritis virus, goose parvovirus and Muscovy duck parvovirus are mixed in equal volume ratio.

8. A multiplex qPCR detection method for duck enteritis virus, goose parvovirus and Muscovy duck parvovirus for non-diagnostic purposes, characterized in that: The steps include: Extract RNA from the sample to be tested and reverse transcribe it into cDNA; Using the above cDNA as a template, perform multiplex qPCR amplification with the multiplex qPCR primer-probe set described in any one of claims 1 to 3, or the kit described in claim 4, or the detection system described in any one of claims 5 to 7; After the reaction, determine whether DEV, GPV, and MDPV in the test sample are positive according to the amplification curve.

9. The multiplex qPCR detection method according to claim 8, characterized in that: The judgment criteria are as follows: If an amplification curve appears in the test sample and Ct ≤ 35, it is determined to be positive; if 35 < Ct ≤ 38, it is determined to be suspicious and needs to be retested; if there is no amplification curve or Ct value > 38, it is determined to be negative.

10. The multiplex qPCR detection method according to claim 8, characterized in that: The reaction program of the multiplex qPCR amplification is as follows: denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 48°C for 30 s, extension at 72°C for 20 s, 40 cycles.

Images