Application of a Cas protein in edible oil identification

Abstract

The present invention relates to the technical field of edible oil identification, and discloses an application of a Cas protein in edible oil identification, wherein the amino acid sequence of the Cas protein is shown in SEQ ID NO. 1. The Cas protein of the present invention has good cleavage activity and is sensitive to the conformation of small molecules contained in different edible oils; the slight difference in the conformation of small molecules can be reflected by the enzyme activity signal of the Cas protein, and the fluorescence value is used as a standard to identify various types of edible oils, thereby solving the problem of edible oil adulteration in the current market.

Description

Technical Field

[0001] The present invention relates to the technical field of edible oil identification, and in particular to an application of Cas protein in edible oil identification. Background Art

[0002] Edible oil is a necessity in daily diet. It can provide calories and fatty acids for the body and also promote the absorption of fat-soluble vitamins. Adding cheap vegetable oil to high-priced vegetable oil poses a threat to people's health. The adulterated vegetable oil is usually difficult to distinguish in appearance and physical properties. Conventional sensory, physical, chemical and other detection methods can no longer meet the detection needs. Although technologies such as gas chromatography and gas chromatography-mass spectrometry can realize multi-component determination of substances, they have the disadvantages of cumbersome operation, expensive instruments and limited application range. Therefore, a low-cost, simple and rapid detection method is needed to quickly identify whether edible oil is adulterated.

[0003] The CRISPR-Cas system was originally derived from a natural immune mechanism in bacteria and archaea to resist the invasion of foreign genetic material, such as plasmids and bacteriophages. In recent years, the CRISPR-Cas system has attracted widespread attention in the field of biological sciences as a revolutionary gene editing technology. With its simplicity and efficiency, this technology provides a powerful tool for gene editing, gene regulation, and nucleic acid detection. The system uses Cas nucleases and crRNAs to guide the recognition and cutting of specific DNA sequences, and has extremely high target specificity.

[0004] As an emerging detection method, CRISPR-Cas detection technology has shown great application potential in the fields of virus detection, disease diagnosis, metal ion detection, fungal toxin detection, etc. However, since Cas12a variants still face insufficient cleavage activity, their promotion in practical applications is limited. Therefore, it is necessary to discover or improve the existing Cas12a protein and find a new Cas12a protease with better cleavage activity and more convenient use. CRISPR-Cas detection technology is used to identify whether edible oil is adulterated. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides an application of Cas protein in edible oil identification. The Cas protein of the present invention has good cleavage activity and is sensitive to the small molecule conformations contained in different edible oils. The slight differences in the small molecule conformations can be reflected by the enzymatic activity signal of the Cas protein. Each edible oil has a corresponding fluorescence value. The fluorescence value is used as a standard to identify various types of edible oils, thereby solving the problem of edible oil adulteration on the market.

[0006] The present invention provides an application of Cas protein in edible oil identification, the application comprising: dispersing a solution of Cas protein, a solution of target nucleic acid, a solution of guide RNA (crRNA), a solution of nucleic acid probe, nuclease-free water and a ribonuclease inhibitor in a buffer, adding edible oil to be identified, incubating, performing fluorescence intensity detection, and performing cluster analysis on the detected fluorescence intensity.

[0007] Furthermore, the amino acid sequence of the Cas protein is shown in SEQ ID NO.1.

[0008] Furthermore, the sequence of the nucleic acid probe is TTAATT, the N-terminus of the nucleic acid probe is modified with a fluorescent group, and the C-terminus of the nucleic acid probe is modified with a quenching group.

[0009] Furthermore, the fluorescent group is 5'-FAM.

[0010] Furthermore, the quenching group is 3'-BHQ1.

[0011] Furthermore, the target nucleic acid has a fragment that can bind to the guide RNA.

[0012] Furthermore, the target nucleic acid has a fragment that specifically binds to the Cas protein.

[0013] Furthermore, when the target nucleic acid, Cas protein and guide RNA are combined, the Cas protein is activated and can cut the single-stranded DNA in the nucleic acid probe.

[0014] Furthermore, the sequence of the target nucleic acid is shown in SEQ ID NO.2.

[0015] Furthermore, the sequence of the guide RNA is shown as SEQ ID NO.3.

[0016] Furthermore, by volume, the ratio of the solution of Cas protein, the solution of guide RNA, the solution of nucleic acid probe, nuclease-free water, buffer, the solution of target nucleic acid and the ribonuclease inhibitor is 2:2:1:22:2:1:1.

[0017] Furthermore, the molar concentration of the Cas protein solution is 20 nM.

[0018] Furthermore, the method for preparing the solution of the Cas protein is specifically as follows: dissolving and dispersing the Cas protein in nuclease-free water.

[0019] Furthermore, the molar concentration of the target nucleic acid solution is 125 nM.

[0020] Furthermore, the method for preparing the target nucleic acid solution is specifically: dissolving and dispersing the target nucleic acid in nuclease-free water.

[0021] Furthermore, the molar concentration of the guide RNA solution is 20 nM.

[0022] Furthermore, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0023] Furthermore, the molar concentration of the nucleic acid probe solution is 200 nM.

[0024] Furthermore, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0025] Furthermore, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0026] Furthermore, the ribonuclease inhibitor in the present invention was purchased from Sangon Biotech (Shanghai) Co., Ltd., and the CAS number of the product is B600478.

[0027] Furthermore, the preparation method of the buffer solution is: 10mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10mM magnesium chloride, 10mM sodium chloride, 100g / mL bovine serum albumin solution (BSA).

[0028] Furthermore, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0029] Furthermore, the incubation temperature is 36° C.-38° C., and the incubation time is 14 min-16 min.

[0030] Furthermore, the fluorescence intensity is detected using an enzyme marker with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0031] Furthermore, the edible oil includes one or more of olive oil, rapeseed oil, sunflower oil, camellia oil, soybean oil, corn oil, linseed oil, pecan oil, red palm oil, palm oil, peanut oil, sesame oil, and fish oil.

[0032] Furthermore, the edible oil includes one or more of olive oil, rapeseed oil, sunflower oil, camellia oil, soybean oil, corn oil, linseed oil, pecan oil, red palm oil, palm oil, and sesame oil.

[0033] The embodiments of the present invention have the following technical effects:

[0034] 1. In the present invention, when the target nucleic acid, crRNA and Cas protein form a ternary complex, the cleavage activity of the Cas protein will be activated, and the fluorescent group on the nucleic acid probe will be cleaved by the Cas protein, thereby obtaining fluorescence intensity; in the present invention, the Cas protein has high activity and is very sensitive to the small molecule conformation contained in different edible oils. The small molecule conformation will change the activity of the Cas protein, so the slight difference in the small molecule conformation can be reflected by the enzyme activity signal of the Cas protein, so that each edible oil has a corresponding fluorescence value, and the fluorescence value is used as a standard for cluster analysis, so as to identify whether the edible oil is adulterated.

[0035] 2. The Cas protein obtained in the present invention has high cleavage activity and can be successfully applied to the identification of edible oils. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0037] Figure 1 The Cas protein provided in the embodiments of the present invention has cutting activity.

[0038] Figure 2 This is a result diagram of using the Cas protein provided in an embodiment of the present invention to identify different edible oils.

[0039] Figure 3 This is a result diagram of the use of the control group Lbcas12a protein in the present invention for identifying different edible oils.

[0040] Figure 4 This is the result of using the Cas protein provided in the embodiment of the present invention to identify adulterated edible oil. DETAILED DESCRIPTION

[0041] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0042] In a first aspect, some embodiments of the present invention provide an application of Cas protein in edible oil identification, the application comprising: dispersing a solution of Cas protein, a solution of target nucleic acid, a solution of guide RNA (crRNA), a solution of nucleic acid probe, nuclease-free water and a ribonuclease inhibitor in a buffer, adding the edible oil to be identified, incubating, performing fluorescence intensity detection, and performing cluster analysis on the detected fluorescence intensity.

[0043] In some embodiments, the amino acid sequence of the Cas protein is as shown in SEQ ID NO.1.

[0044] In some embodiments, the sequence of the nucleic acid probe is TTAATT, the N-terminus of the nucleic acid probe is modified with a fluorescent group, and the C-terminus of the nucleic acid probe is modified with a quenching group.

[0045] In some embodiments, the fluorescent group is 5'-FAM.

[0046] In some embodiments, the quenching group is 3'-BHQ1.

[0047] In some embodiments, the target nucleic acid has a segment that can bind to the guide RNA.

[0048] In some embodiments, the target nucleic acid has a fragment that specifically binds to the Cas protein.

[0049] In some embodiments, when the target nucleic acid, Cas protein and guide RNA are combined, the Cas protein is activated and can cut the single-stranded DNA in the nucleic acid probe.

[0050] In some embodiments, the sequence of the target nucleic acid is shown as SEQ ID NO.2.

[0051] In some embodiments, the sequence of the guide RNA is as shown in SEQ ID NO.3.

[0052] In some embodiments, the ratio of the solution of Cas protein, the solution of guide RNA, the solution of nucleic acid probe, nuclease-free water, buffer, the solution of target nucleic acid and ribonuclease inhibitor is 2:2:1:22:2:1:1 by volume.

[0053] In the present invention, the guide RNA and the target nucleic acid can be adjusted by those skilled in the art according to actual conditions, as long as the target nucleic acid, crRNA and Cas protein can form a ternary complex and activate the activity of the Cas protein.

[0054] In some embodiments, the molar concentration of the Cas protein solution is 20 nM.

[0055] In some embodiments, the method for preparing the solution of the Cas protein is specifically: dissolving and dispersing the Cas protein in nuclease-free water.

[0056] In some embodiments, the molar concentration of the target nucleic acid solution is 125 nM.

[0057] In some embodiments, the method for preparing the target nucleic acid solution is specifically: dissolving and dispersing the target nucleic acid in nuclease-free water.

[0058] In some embodiments, the molar concentration of the guide RNA solution is 20 nM.

[0059] In some embodiments, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0060] In some embodiments, the molar concentration of the nucleic acid probe solution is 200 nM.

[0061] In some embodiments, the method for preparing the guide RNA solution is specifically: dissolving and dispersing the guide RNA in nuclease-free water.

[0062] In some embodiments, the concentration of the ribonuclease inhibitor is 40 U / μL.

[0063] In some embodiments, the ribonuclease inhibitor in the present invention is purchased from Sangon Biotech (Shanghai) Co., Ltd., and the CAS number of the product is B600478.

[0064] In some embodiments, the buffer solution is prepared by: 10 mM Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), 10 mM magnesium chloride, 10 mM sodium chloride, and 100 g / mL bovine serum albumin solution (BSA).

[0065] In some embodiments, the method for preparing the bovine serum albumin solution is specifically to disperse the bovine serum albumin solution in deionized water.

[0066] In some embodiments, the incubation temperature is 36° C.-38° C., and the incubation time is 14 min-16 min.

[0067] In some embodiments, the fluorescence intensity is detected using an enzyme reader with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

[0068] In some embodiments, the edible oil includes one or more of olive oil, rapeseed oil, sunflower oil, camellia oil, soybean oil, corn oil, linseed oil, pecan oil, red palm oil, palm oil, peanut oil, sesame oil, and fish oil.

[0069] In some embodiments, the edible oil includes one or more of olive oil, rapeseed oil, sunflower oil, camellia oil, soybean oil, corn oil, linseed oil, pecan oil, red palm oil, palm oil, and sesame oil.

[0070] The following is described in conjunction with specific embodiments:

[0071] Embodiment 1:

[0072] (1) Construction of Cas protein plasmid

[0073] Using LbCas12a as the seed sequence, bioinformatics analysis was performed in the metagenomic data, and Cas12a from the Butyrivibrio_Asp000431815 bacterium was discovered and named Cas protein.

[0074] The nucleotide sequence corresponding to the amino acid sequence of the synthetic Cas protein. The plasmid for synthesizing the Cas protein was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the plasmid vector was pET-28a(+);

[0075] Amino acid sequence of Cas protein (SEQ ID NO.1):

[0076]

[0077] (2) Purification of Cas protein:

[0078] The Cas protein plasmid obtained in (1) was transformed into E. coli BL21 (DE3) competent cells, spread on E. coli culture medium (commercially available) (Kan+) and cultured overnight at 37°C. Then, a single clone was picked and inoculated into 100 mL of E. coli liquid culture medium (Kan+) and cultured at 37°C and 220 rpm with shaking until OD 600 =0.6, to obtain a Cas protein plasmid solution; add isopropylthiogalactoside (IPTG) to the Cas protein plasmid solution until the final concentration of isopropylthiogalactoside is 0.5 mmol / L, and induce for 20 hours at 16°C and 200 rpm to obtain an induced bacterial solution;

[0079] The induced bacterial solution was centrifuged, and the bacterial solution precipitate was collected. The bacteria were resuspended in 20 mL of buffer A (20 mM tris(hydroxymethyl)aminomethane hydrochloride, pH 8.0, 500 mM sodium chloride, 5% glycerol), and the resuspended bacterial solution was ultrasonically disrupted at 350 W power. After centrifugation for 1 h, the supernatant was taken for affinity purification, and the purified target protein was obtained after liquid exchange and concentration through a 10K ultrafiltration tube.

[0080] Nucleic acid probe preparation:

[0081] The structure of the nucleic acid probe is: the N-terminus is modified with a 5'-FAM group, the C-terminus is modified with a 3'-BHQ1 quenching group, and it was commissioned to Sangon Biotech (Shanghai) Co., Ltd. for synthesis. The sequence of the nucleic acid probe is TTAATT.

[0082] Target nucleic acid preparation:

[0083] The 30 bp nucleic acid sequence is shown in SEQ ID NO.2: GGGGGCACGGGAGGTTGCATCGAGCGGTGG.

[0084] Preparation of guide RNA, designing the guide sequence according to the characteristics of the target nucleic acid, as shown in SEQ ID NO.3:

[0085] The guide RNA sequence is UAAUUUCUACUAAGUGUAGAUAUGCAACCUCCCGUGCCCCC.

[0086] Identification of cleavage activity:

[0087] The target nucleic acid was used as the target site to detect the trans-cleavage activity of the Cas protein on the nucleic acid probe. The guide RNA sequence was (UAAUUUCUACUAAGUGUAGAUAUGCAACCUCCCGUGCCCCC). Specifically, 2 μL of Cas protein solution with a molar concentration of 20 nM was taken, and 2 μL of guide RNA with a molar concentration of 20 nM, 2 μL of buffer (10 mM tris(hydroxymethyl)aminomethane hydrochloride, 10 mM magnesium chloride, 10 mM sodium chloride, 100 g / mL bovine serum albumin), 1 μL of nucleic acid probe with a molar concentration of 200 nM, 1 μL of target nucleic acid with a molar concentration of 125 nM, 1 μL of ribonuclease inhibitor (concentration of 40 U / μL) and 22 μL of nuclease-free water (dd H 2 O), and finally use ultrapure water to make up to 40 μL. Using the control without Cas protein (i.e., the concentration of Cas protein is 0 nmol / L), incubate at 37°C for 30 min, and record the results under the microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 530 nm. The test results are as follows Figure 1 shown.

[0088] Figure 1 The results show that the Cas protein obtained in the present invention has cutting activity.

[0089] Edible oil identification application:

[0090] Specifically, 2 μL of Cas protein solution with a molar concentration of 20 nM was taken, and 2 μL of guide RNA with a molar concentration of 20 nM, 2 μL of buffer (10 mM tris(hydroxymethyl)aminomethane hydrochloride, 10 mM magnesium chloride, 10 mM sodium chloride, 100 g / mL bovine serum albumin), 1 μL of nucleic acid probe with a molar concentration of 200 nM, 1 μL of target nucleic acid with a molar concentration of 125 nM, 1 μL of ribonuclease inhibitor (concentration of 40 U / μL) and 22 μL of nuclease-free water (dd H 2 O), and finally use ultrapure water to make the volume 40μL, prepare 13 groups of different oils, add one edible oil (olive oil, rapeseed oil, sunflower oil, camellia oil, soybean oil, corn oil, linseed oil, pecan oil, red palm oil, palm oil, peanut oil, sesame oil, fish oil) to each group, and repeat the test 6 times for each oil, incubate at 37℃ for 30min, and record the results under the microplate reader at the excitation wavelength of 480nm and the emission wavelength of 530nm. Cluster analysis was performed according to the results of the detected fluorescence intensity, and the clustering results are shown in the figure. Figure 2 Taking Lbcas12a (commercially available) as a control, different edible oils were tested using the method of the present invention. The results are shown in Figure 3 shown.

[0091] Different edible oils have their own unique small molecule conformations or small molecules in different proportions, and different small molecule conformations have completely different effects on the Cas protein in the present invention, so that the enzyme activity signal of the Cas protein is finally reflected in the fluorescence intensity. Cluster analysis is performed on the fluorescence intensity of similar edible oils, and cluster analysis is generated. Figure 2 It can be found that different types of edible oils are aggregated at different positions in the figure, thereby realizing the clustering and differentiation of different edible oils by fluorescence intensity. It can be seen that the Cas protein of the present invention has strong activity and can react sensitively to the conformation of small molecules, thereby realizing the classification of different edible oils by fluorescence intensity; Figure 3 It was found that due to the poor activity of Lbcas12a protein, Lbcas12a protein did not respond significantly to the small molecule conformation of different oils, resulting in overlap in the fluorescence intensity of different edible oils. Further preferably, the edible oil is olive oil, rapeseed oil, sunflower oil, camellia oil, soybean oil, corn oil, linseed oil, pecan oil, red palm oil, palm oil, and sesame oil.

[0092] The Cas protein of the present invention was used to detect adulterated soybean oil or olive oil, and the results were as follows: Figure 4 As shown, it can be found that when soybean oil or olive oil is adulterated with other oils, the fluorescence intensity of the adulterated edible oil will deviate from that of the unadulterated soybean oil or olive oil after cluster analysis. It can be seen that the method of the present invention can successfully identify adulteration of edible oil.

[0093] It should be noted that the terms used in the present invention are only for describing specific embodiments, rather than limiting the scope of the present application. As shown in the present specification, unless the context clearly indicates an exception, the words "one", "a", "a kind of" and / or "the" do not specifically refer to the singular, but may also include the plural. The terms "include", "comprise" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method or device including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, method or device. In the absence of more restrictions, the elements defined by the sentence "include one..." do not exclude the presence of other identical elements in the process, method or device including the elements.

[0094] It should also be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside", etc., indicating the orientation or positional relationship, are based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention. Unless otherwise clearly specified and limited, the terms "installed", "connected", "connected", etc. should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be an indirect connection through an intermediate medium, or it can be a connection between the two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present invention.

Claims

1. An application of Cas protein in edible oil identification, characterized in that: The Cas protein solution, the target nucleic acid solution, the guide RNA solution, the nucleic acid probe solution, the nuclease-free water and the ribonuclease inhibitor are dispersed in a buffer solution, and then the edible oil to be identified is added, incubated, and the fluorescence intensity is detected, and the detected fluorescence intensity is clustered and analyzed; The amino acid sequence of the Cas protein is shown in SEQ ID NO.1; The sequence of the nucleic acid probe is TTAATT, the N-terminus of the nucleic acid probe is modified with a fluorescent group, and the C-terminus of the nucleic acid probe is modified with a quenching group; the fluorescent group is 5'-FAM; and the quenching group is 3'-BHQ1.

2. The use according to claim 1, characterized in that: The target nucleic acid has a segment that can bind to the guide RNA; The target nucleic acid has a fragment that specifically binds to the Cas protein; When the target nucleic acid, Cas protein and guide RNA are combined, the Cas protein is activated and can cut the single-stranded DNA in the nucleic acid probe.

3. The use according to claim 1, characterized in that: The sequence of the target nucleic acid is shown in SEQ ID NO.2; The sequence of the guide RNA is shown in SEQ ID NO.

3.

4. The use according to claim 1, characterized in that: The ratio of the solution of Cas protein, the solution of guide RNA, the solution of nucleic acid probe, nuclease-free water, buffer, the solution of target nucleic acid and ribonuclease inhibitor is 2:2:1:22:2:1:1 by volume; The molar concentration of the Cas protein solution is 20 nM; The molar concentration of the target nucleic acid solution is 125 nM; The molar concentration of the guide RNA solution is 20 nM; The molar concentration of the nucleic acid probe solution is 200 nM; The concentration of the ribonuclease inhibitor is 40 U / μL.

5. The use according to claim 1, characterized in that: The incubation temperature is 36° C.-38° C., and the incubation time is 14 min-16 min.

6. The use according to claim 1, characterized in that: The fluorescence intensity was detected using an enzyme marker, with an excitation wavelength of 480nm-500nm and an emission wavelength of 510nm-540nm.

7. The use according to claim 1, characterized in that: The edible oil includes one or more of olive oil, rapeseed oil, sunflower seed oil, camellia oil, soybean oil, corn oil, linseed oil, pecan oil, red palm oil, palm oil, peanut oil, sesame oil, and fish oil.

Images