Methods and compositions for rapid detection and analysis of RNA and DNA cytosine methylation

Abstract

Aspects of the present disclosure relate to methods, compositions, and kits for the detection and analysis of DNA and RNA cytosine methylation. Certain aspects include methods, compositions, and kits for hydrosulfite sequencing of methylated nucleic acids, including methylated nucleic acids from low input samples such as cell free DNA and cell free RNA. Also disclosed are methods and compositions for the detection and quantification of 5-hydroxymethylcytosine in DNA.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 297,165, filed on January 6, 2022, which is incorporated herein by reference in its entirety.

[0003] Government Support Statement

[0004] This invention was made with government support under Grant RM1 HG008935 from the National Institutes of Health. The government has certain rights in this invention.

[0005] Sequence Listing

[0006] This application contains a sequence listing submitted in ST26 format, which is incorporated herein by reference in its entirety. The ST26 copy was created on January 6, 2023, is named ARCD_P0756WO_Sequence_Listing.xml, and is 59305 bytes in size. Background of the Invention Field of the Invention

[0008] Aspects of the invention relate at least to the fields of cell biology and epigenetics. Background Art

[0009] Bisulfite sequencing (BS-seq) is currently the gold standard for 5mC sequencing in DNA and is widely used for mC sequencing in RNA. 5 However, conventional BS-seq has several major drawbacks that limit its application in RNA m 5 C sequencing and 5mC sequencing of DNA, particularly for low input samples. There is a need for improved methods and compositions for the detection and analysis of cytosine methylation in DNA and RNA, including DNA and RNA from low input samples. Summary of the invention

[0010] The present disclosure provides various methods, compositions, systems and kits for nucleic acid processing and cytosine methylation analysis. Certain aspects of the present disclosure relate to specific bisulfite compositions that can be used for rapid bisulfite treatment of DNA and / or RNA for 5mC and m 5 C detection and analysis. Also disclosed are methods for processing DNA and RNA, including using the disclosed compositions for cytosine deamination and preparing DNA and / or RNA for sequencing and cytosine methylation analysis. Also disclosed are methods for 5hmC detection, quantification and analysis. Also disclosed are DNA and RNA processing kits, including bisulfite conversion kits for preparing DNA and / or RNA for cytosine methylation analysis.

[0011] Aspects of the present disclosure include bisulfite solutions, ammonium sulfite solutions, ammonium bisulfite solutions, bisulfite solutions without sodium bisulfite, nucleic acid processing methods, DNA processing methods, RNA processing methods, 5mC analysis methods, m 5 C analysis method, 5hmC analysis method, bisulfite sequencing method, methylation analysis method, bisulfite treatment method, nucleic acid treatment kit, DNA treatment kit and RNA treatment kit. The method disclosed herein may include at least 1, 2, 3 or more than 3 of the following steps: generating a bisulfite solution, mixing a first ammonium bisulfite solution and a second ammonium bisulfite solution, incubating DNA molecules in a bisulfite solution, incubating RNA molecules in a bisulfite solution, removing DNA molecules from a bisulfite solution, removing RNA molecules from a bisulfite solution, placing DNA molecules under alkaline conditions, placing RNA molecules under alkaline conditions, treating DNA molecules with APOBEC deaminase, detecting nucleotide methylation, quantifying nucleotide methylation, obtaining a sample from a subject, isolating nucleic acid molecules from a sample, sequencing DNA molecules and sequencing RNA molecules. In some aspects, any one or more of the aforementioned steps may be excluded. The compositions (e.g., solutions) disclosed herein may include at least 1, 2, 3, or more than 3 of the following components: ammonium bisulfite, ammonium sulfite, sodium bisulfite, sodium hydroxide, and APOBEC deaminase. In certain aspects, any one or more than one of the foregoing components may be excluded. The kits of the present invention may include at least 1, 2, 3, 4, or more than 4 of the following components: bisulfite solution, sodium bisulfite solution, ammonium bisulfite solution, bisulfite solution without sodium bisulfite, alkaline solution, buffer, DNA treatment instructions, DNA treatment instructions, DNA bisulfite treatment instructions, and RNA bisulfite treatment instructions. In certain aspects, any one or more than one of the foregoing components may be excluded.

[0012] In some aspects, disclosed herein is a method for DNA treatment, comprising: (a) incubating a solution comprising DNA molecules and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes, wherein the solution does not contain sodium bisulfite or added sodium bisulfite; and (b) placing the DNA molecules under alkaline conditions. In some aspects, disclosed herein is a method for DNA treatment, comprising: (a) generating a solution comprising DNA molecules and ammonium bisulfite, wherein the solution does not contain sodium bisulfite or added sodium bisulfite; (b) incubating the solution at a temperature of at least 95°C; and (c) removing the DNA molecules in the solution up to 12 minutes after (a). In some aspects, the present invention also discloses a method for treating a nucleic acid sample, the method comprising incubating a solution comprising DNA molecules and ammonium bisulfite at a temperature of at least 95° C. for up to 12 minutes, wherein the solution does not comprise sodium bisulfite or added sodium bisulfite, wherein each DNA molecule comprises one or more than one cytosine residue, wherein after incubating the solution, more than 99% of the DNA molecules do not comprise a cytosine residue. In some aspects, the method further comprises subjecting the plurality of DNA molecules to alkaline conditions. In some aspects, the solution does not comprise ammonium sulfite or added ammonium sulfite.

[0013] In some aspects, disclosed herein are methods for RNA treatment, comprising: (a) incubating a solution comprising RNA molecules, ammonium sulfite, and ammonium bisulfite at a temperature of at least 95° C. for up to 12 minutes, wherein the solution does not contain sodium bisulfite or added sodium bisulfite; (b) placing the RNA molecules under alkaline conditions. In some aspects, also disclosed are methods for RNA treatment, comprising: (a) generating a solution comprising RNA molecules, ammonium sulfite, and ammonium bisulfite, wherein the solution does not contain sodium bisulfite or added sodium bisulfite; (b) incubating the solution at a temperature of at least 95° C.; and (c) removing the RNA molecules in the solution up to 12 minutes after (a). In some aspects, the present invention also discloses a method for treating a nucleic acid sample, the method comprising incubating a solution comprising an RNA molecule, ammonium sulfite and ammonium bisulfite at a temperature of at least 95° C. for up to 12 minutes, wherein the solution does not comprise sodium bisulfite or added sodium bisulfite, wherein each RNA molecule comprises one or more than one cytosine residue, wherein after the solution is incubated, more than 99% of the RNA molecules do not comprise cytosine residues. In some aspects, the method further comprises placing a plurality of RNA molecules under alkaline conditions. In some aspects, the solution comprises 5% to 15% by weight of ammonium sulfite. In some aspects, the solution comprises 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% by weight of ammonium sulfite, or any range or value thereof that can be derived. In some aspects, the solution comprises about 10% by weight of ammonium sulfite.

[0014] In some aspects, the solution comprises 50% to 70% by weight of ammonium bisulfite. In some aspects, the solution comprises, comprises at least, or comprises at most 50%, 50.1%, 50.2%, 50.3%, 50.4%, 50.5%, 50.6%, 50.7%, 50.8%, 50.9%, 51%, 51.1%, 51.2%, 51.3%, 51.4%, 51.5%, 51.6%, 51.7%, 51.8%, 51.9%, 52%, 52.1%, 52.2%, 52.3%, 52.4%, 52.5%, 52.6%, 52.7%, 52.8%, %, 52.9 wt%, 53 wt%, 53.1 wt%, 53.2 wt%, 53.3 wt%, 53.4 wt%, 53.5 wt%, 53.6 wt%, 53.7 wt%, 53.8 wt%, 53.9 wt%, 54 wt%, 54.1 wt%, 54.2 wt%, 54.3 wt%, 54.4 wt%, 54.5 wt%, 54.6 wt%, 54.7 wt%, 54.8 wt%, 54.9 wt%, 55 wt%, 55.1 wt%, 55.2 wt%, 55.3 wt%, 55.4 wt%, 55.5 wt%, 55.6 wt%, 55.7 wt%, 55.8 wt%, 55.9 wt%. %, 56 wt%, 56.1 wt%, 56.2 wt%, 56.3 wt%, 56.4 wt%, 56.5 wt%, 56.6 wt%, 56.7 wt%, 56.8 wt%, 56.9 wt%, 57 wt%, 57.1 wt%, 57.2 wt%, 57.3 wt%, 57.4 wt%, 57.5 wt%, 57.6 wt%, 57.7 wt%, 57.8 wt%, 57.9 wt%, 58 wt%, 58.1 wt%, 58.2 wt%, 58.3 wt%, 58.4 wt%, 58.5 wt%, 58.6 wt%, 58.7 wt%, 58.8 wt%, 58.9 wt%, 59 wt%, 5 9.1 wt%, 59.2 wt%, 59.3 wt%, 59.4 wt%, 59.5 wt%, 59.6 wt%, 59.7 wt%, 59.8 wt%, 59.9 wt%, 60 wt%, 60.1 wt%, 60.2 wt%, 60.3 wt%, 60.4 wt%, 60.5 wt%, 60.6 wt%, 60.7 wt%, 60.8 wt%, 60.9 wt%, 61 wt%, 61.1 wt%, 61.2 wt%, 61.3 wt%, 61.4 wt%, 61.5 wt%, 61.6 wt%, 61.7 wt%, 61.8 wt%, 61.9 wt%, 62 wt%, 62.1 wt%, 62.2 wt%, 62.3 wt%, 62.4 wt%, 62.5 wt%, 62.6 wt%, 62.7 wt%, 62.8 wt%, 62.9 wt%, 63 wt%, 63.1 wt%, 63.2 wt%, 63.3 wt%, 63.4 wt%, 63.5 wt%, 63.6 wt%, 63.7 wt%, 63.8 wt%, 63.9 wt%, 64 wt%, 64.1 wt%, 64.2 wt%. %, 64.3 wt%, 64.4 wt%, 64.5 wt%, 64.6 wt%, 64.7 wt%, 64.8 wt%, 64.9 wt%, 65 wt%, 65.1 wt%, 65.2 wt%, 65.3 wt%, 65.4 wt%, 65.5 wt%, 65.6 wt%, 65.7 wt%, 65.8 wt%, 65.9 wt%, 66 wt%, 66.1 wt%, 66.2 wt%, 66.3 wt%, 66.4 wt%, 66.5 wt%, 66.6 wt%, 66.7 wt%, 66.8 wt%, 66.9 wt%, 67 wt%, 67.1 wt%, 67.2 wt%, 67.3 wt%, 67.4 wt%, 67.5 wt%, 67.6 wt%, 67.7 wt%, 67.8 wt%, 67.9 wt%, 68 wt%, 68.1 wt%, 68.2 wt%, 68 .3%, 68.4%, 68.5%, 68.6%, 68.7%, 68.8%, 68.9%, 69%, 69.1%, 69.2%, 69.3%, 69.4%, 69.5%, 69.6%, 69.7%, 69.8%, 69.9%, or 70% by weight of ammonium bisulfite, or any range or value derivable therein. In some aspects, the solution comprises 65% to 67% by weight of ammonium bisulfite. In some aspects, the solution comprises about 66.7% by weight of ammonium bisulfite. .

[0015] In some aspects, the solution does not include added sodium bisulfite. In some aspects, the solution does not include a level greater than or equal to about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, 0.40%, 0.45%, 0.50%, 0.60%, 0.70%, 0.80%, 0.90%, 0.110%, 0.120%, 0.130%, 0.140%, 0.150%, 0.160%, 0.170%, 0.180%, 0.190%, 0.210%, 0.220%, 0.230%, 0.240%, 0.250%, 0.260%, 0.270%, 0.280%, 0.290%, 0.300%, 0.310%, 0.320%, 0.330%, 0.340%, 0.350%, 0.360%, 0.370%, 0.380%, 0.390%, 0.400%, 0.410%, 0.420%, 0.430%, 0.440%, 0.450%, 0.460%, 0.470%, 0.480%, 0.490%, 50 %, 0.55%, 0.60%, 0.65%, 0.70%, 0.75%, 0.80%, 0.85%, 0.90%, 0.95%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20%, or any range derivable therein, of sodium bisulfite. In some aspects, the solution does not contain levels greater than or equal to about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, 0.40%, 0.45%, 0.50%, 0.55%, 0.60%, 0.61%, 0.62%, 0.63%, 0.64%, 0.65%, 0.66%, 0.67%, 0.68%, 0.69%, 0.70%, 0.71%, 0.72%, 0.73%, 0.74%, 0.75%, 0.76%, 0.77%, 0.78%, 0.79%, 0.80%, 0.81%, 0.82%, 0.83%, 0.84%, 0.85%, 0.86%, 0.87%, 0.88%, 0.89%, 0.90%, 0.91%, 0.92%, 0.93%, 0.94%, 0.95%, 0.96%, 0.97%, 0.98%, 0.99%, 0.91%, 0.99%, 0 5%, 0.70%, 0.75%, 0.80%, 0.85%, 0.90%, 0.95%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20%, or any range derivable therein of sodium bisulfite.

[0016] In some aspects, the solution does not include added ammonium sulfite. In some aspects, the solution does not include a level greater than or equal to about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, 0.40%, 0.45%, 0.50%, 0.51%, 0.52%, 0.53%, 0.54%, 0.55%, 0.56%, 0.57%, 0.58%, 0.59%, 0.60%, 0.61%, 0.62%, 0.63%, 0.64%, 0.65%, 0.66%, 0.67%, 0.68%, 0.69%, 0.70%, 0.71%, 0.72%, 0.73%, 0.74%, 0.75%, 0.76%, 0.77%, 0.78%, 0.79%, 0.80%, 0.81%, 0.82%, 0.83%, 0.84%, 0.85%, 0.86%, 0.87%, 0.88%, 0.89%, 0.90%, 0.91%, 0.92%, 0.93%, 0.94%, 0.95%, 0.96%, 0.97%, 0.98%, 0.99%, 0. 0.55%, 0.60%, 0.65%, 0.70%, 0.75%, 0.80%, 0.85%, 0.90%, 0.95%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% ammonium sulfite, or any range derivable therein. In some aspects, the solution does not contain levels greater than or equal to about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, 0.40%, 0.45%, 0.50%, 0.55%, 0.60%, 0.61%, 0.62%, 0.63%, 0.64%, 0.65%, 0.66%, 0.67%, 0.68%, 0.69%, 0.70%, 0.71%, 0.72%, 0.73%, 0.74%, 0.75%, 0.76%, 0.77%, 0.78%, 0.79%, 0.80%, 0.81%, 0.82%, 0.83%, 0.84%, 0.85%, 0.86%, 0.87%, 0.88%, 0.89%, 0.90%, 0.91%, 0.92%, 0.93%, 0.94%, 0.95%, 0.96%, 0.97%, 0.98%, 0.99%, 0.10 %, 65%, 0.70%, 0.75%, 0.80%, 0.85%, 0.90%, 0.95%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% ammonium sulfite, or any range derivable therein.

[0017] In some aspects, the solution does not include ammonium sulfite or added ammonium sulfite. In some aspects, the solution includes a concentration of or less than 1M, 0.9M, 0.8M, 0.7M, 0.6M, 0.5M, 0.4M, 0.3M, 0.2M, 0.1M, 0.01M, 1×10 -3 M, 1×10 - 4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 M, 1×10-13 M, 1×10 -14 M, 1×10 -15 M, 1×10 -16 M, 1×10 -17 M, 1×10 -18 M, 1×10 -19 M, 1×10 -20 M or less than 1×10 -20 In some aspects, the solution comprises less than 1 wt%, 0.1 wt%, 0.01 wt%, 0.001 wt%, or 0.0001 wt%, or less than 0.0001 wt% ammonium sulfite.

[0018] In some aspects, the solution does not include sodium bisulfite or added sodium bisulfite. In some aspects, the solution includes a concentration of or less than 1M, 0.9M, 0.8M, 0.7M, 0.6M, 0.5M, 0.4M, 0.3M, 0.2M, 0.1M, 0.01M, 1×10 -3 M, 1×10 -4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 M, 1×10 -13 M, 1×10 -14 M, 1×10 -15 M, 1×10 -16 M, 1×10 -17 M, 1×10 -18 M, 1×10 -19 M, 1×10 -20 M or less than 1×10 -20 In some aspects, the solution comprises less than 1 wt%, 0.1 wt%, 0.01 wt%, 0.001 wt%, or 0.0001 wt% or less than 0.0001 wt% sodium bisulfite.

[0019] In some aspects, the solution has a bisulfite concentration of 6.5 M to 10 M, or any range or value derivable therein. In some aspects, the solution has a bisulfite concentration of 8 M to 10 M. In some aspects, the solution has a bisulfite concentration of 9 M to 10 M. In some aspects, the solution has a bisulfite concentration of 6.5 M to 7.5 M. In some aspects, the solution is, is at least or is at most 6.5 M, 6.6 M, 6.7 M, 6.8 M, 6.9 M, 7 M, 7.1 M, 7.2 M, 7.3 M, 7.4 M, 7.5 M, 7.6 M, 7.7 M, 7.8 M, 7.9 M, 8 M, 8.1 M, 8.2 M, 8.3 M, 8.4 M, 8.5 M, 8.6 M, 8.7 M, 8.8 M, 8.9 M, 9 M, 9.1 M, 9.2 M, 9.3 M, 9.4 M, 9.5 M, 9.6 M, 9.7 M, 9.8 M, 9.9 M, 10 M, 10.1 M, 10.2 M, 10.3 M, 10.4 M or 10.5 M, or any range or value derivable therein. In some aspects, the solution is about a 7.0 M bisulfite solution. In some aspects, the solution is about a 9.5 M bisulfite solution.

[0020] In some aspects, the pH of the solution is 4.8 to 5.4. In some aspects, the pH of the solution is, is at least, or is at most 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 or above 5.9, or any range or value derivable therein. In some aspects, the pH of the solution is about 5.1.

[0021] In some aspects, the method includes incubating the solution at, at least or at a temperature of at most 95°C, 96°C, 97°C, 98°C, 99°C, 99.5°C, 99.9°C, or any range or value that can be derived therefrom. In some aspects, the method includes incubating the solution at a temperature of at least 98°C. In some aspects, the method includes incubating the solution, incubating at least or incubating at most 12 minutes, 11 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes or 4 minutes, or any range or value that can be derived therefrom. In some aspects, the method includes incubating the solution for at most 10 minutes. In some aspects, the method includes incubating the solution for at most 8 minutes.

[0022] In some aspects, a DNA processing kit is also disclosed herein, comprising: (a) a solution comprising ammonium bisulfite having a bisulfite concentration of 6.5M to 10M, wherein the solution does not contain sodium bisulfite or added sodium bisulfite; and (b) instructions for treating a DNA sample. In some aspects, the solution does not contain ammonium sulfite or added ammonium sulfite. In some aspects, the kit further comprises an alkaline solution. In some aspects, the kit further comprises one or more buffers for use. Certain aspects may exclude any one or more than one of the aforementioned components.

[0023] In some aspects, RNA processing kits are also disclosed herein, comprising: (a) a solution comprising ammonium sulfite and ammonium bisulfite at a bisulfite concentration of 6.5M to 8M, wherein the solution does not contain sodium bisulfite or added sodium bisulfite; and (b) instructions for treating RNA samples. In some aspects, the solution comprises 5% to 15% by weight of ammonium sulfite. In some aspects, the solution comprises, comprises up to or comprises at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% by weight, or any range or value derivable therein of ammonium sulfite. In some aspects, the kit further comprises an alkaline solution. In some aspects, the kit further comprises one or more buffers for species. Some aspects may exclude any one or more of the aforementioned components.

[0024] In some aspects, the solution comprises 50% to 70% by weight of ammonium bisulfite. In some aspects, the solution comprises, comprises at least, or comprises at most 50%, 50.1%, 50.2%, 50.3%, 50.4%, 50.5%, 50.6%, 50.7%, 50.8%, 50.9%, 51%, 51.1%, 51.2%, 51.3%, 51.4%, 51.5%, 51.6%, 51.7%, 51.8%, 51.9%, 52%, 52.1%, 52.2%, 52.3%, 52.4%, 52.5%, 52.6%, 52.7%, 52.8%, %, 52.9 wt%, 53 wt%, 53.1 wt%, 53.2 wt%, 53.3 wt%, 53.4 wt%, 53.5 wt%, 53.6 wt%, 53.7 wt%, 53.8 wt%, 53.9 wt%, 54 wt%, 54.1 wt%, 54.2 wt%, 54.3 wt%, 54.4 wt%, 54.5 wt%, 54.6 wt%, 54.7 wt%, 54.8 wt%, 54.9 wt%, 55 wt%, 55.1 wt%, 55.2 wt%, 55.3 wt%, 55.4 wt%, 55.5 wt%, 55.6 wt%, 55.7 wt%, 55.8 wt%, 55.9 wt%. %, 56 wt%, 56.1 wt%, 56.2 wt%, 56.3 wt%, 56.4 wt%, 56.5 wt%, 56.6 wt%, 56.7 wt%, 56.8 wt%, 56.9 wt%, 57 wt%, 57.1 wt%, 57.2 wt%, 57.3 wt%, 57.4 wt%, 57.5 wt%, 57.6 wt%, 57.7 wt%, 57.8 wt%, 57.9 wt%, 58 wt%, 58.1 wt%, 58.2 wt%, 58.3 wt%, 58.4 wt%, 58.5 wt%, 58.6 wt%, 58.7 wt%, 58.8 wt%, 58.9 wt%, 59 wt%, 5 9.1 wt%, 59.2 wt%, 59.3 wt%, 59.4 wt%, 59.5 wt%, 59.6 wt%, 59.7 wt%, 59.8 wt%, 59.9 wt%, 60 wt%, 60.1 wt%, 60.2 wt%, 60.3 wt%, 60.4 wt%, 60.5 wt%, 60.6 wt%, 60.7 wt%, 60.8 wt%, 60.9 wt%, 61 wt%, 61.1 wt%, 61.2 wt%, 61.3 wt%, 61.4 wt%, 61.5 wt%, 61.6 wt%, 61.7 wt%, 61.8 wt%, 61.9 wt%, 62 wt%, 62.1 wt%, 62.2 wt%, 62.3 wt%, 62.4 wt%, 62.5 wt%, 62.6 wt%, 62.7 wt%, 62.8 wt%, 62.9 wt%, 63 wt%, 63.1 wt%, 63.2 wt%, 63.3 wt%, 63.4 wt%, 63.5 wt%, 63.6 wt%, 63.7 wt%, 63.8 wt%, 63.9 wt%, 64 wt%, 64.1 wt%, 64.2 wt%. %, 64.3 wt%, 64.4 wt%, 64.5 wt%, 64.6 wt%, 64.7 wt%, 64.8 wt%, 64.9 wt%, 65 wt%, 65.1 wt%, 65.2 wt%, 65.3 wt%, 65.4 wt%, 65.5 wt%, 65.6 wt%, 65.7 wt%, 65.8 wt%, 65.9 wt%, 66 wt%, 66.1 wt%, 66.2 wt%, 66.3 wt%, 66.4 wt%, 66.5 wt%, 66.6 wt%, 66.7 wt%, 66.8 wt%, 66.9 wt%, 67 wt%, 67.1 wt%, 67.2 wt%, 67.3 wt%, 67.4 wt%, 67.5 wt%, 67.6 wt%, 67.7 wt%, 67.8 wt%, 67.9 wt%, 68 wt%, 68.1 wt%, 68.2 wt%, 68 .3%, 68.4%, 68.5%, 68.6%, 68.7%, 68.8%, 68.9%, 69%, 69.1%, 69.2%, 69.3%, 69.4%, 69.5%, 69.6%, 69.7%, 69.8%, 69.9%, or 70% by weight of ammonium bisulfite, or any range or value derivable therein. In some aspects, the solution comprises 65% to 67% by weight of ammonium bisulfite. In some aspects, the solution comprises about 66.7% by weight of ammonium bisulfite. .

[0025] In some aspects, the solution has a bisulfite concentration of 6.5 M to 10 M, or any range or value derivable therein. In some aspects, the solution has a bisulfite concentration of 8 M to 10 M. In some aspects, the solution has a bisulfite concentration of 9 M to 10 M. In some aspects, the solution has a bisulfite concentration of 6.5 M to 7.5 M. In some aspects, the solution has a bisulfite concentration of 6.5 M, 6.6 M, 6.7 M, 6.8 M, 6.9 M, 7 M, 7.1 M, 7.2 M, 7.3 M, 7.4 M, 7.5 M, 7.6 M, 7.7 M, 7.8 M, 7.9 M, 8 M, 8.1 M, 8.2 M, 8.3 M, 8.4 M, 8.5 M, 8.6 M, 8.7 M, 8.8 M, 8.9 M, 9 M, 9.1 M, 9.2 M, 9.3 M, 9.4 M, 9.5 M, 9.6 M, 9.7 M, 9.8 M, 9.9 M, 10 M, 10.1 M, 10.2 M, 10.3 M, 10.4 M, or 10.5 M, or any range or value derivable therein. In some aspects, the solution has a bisulfite concentration of about 7.0 M. In some aspects, the bisulfite concentration of the solution is about 9.5M.

[0026] In some aspects, the pH of the solution is 4.8 to 5.4. In some aspects, the pH of the solution is, is at least or is at most 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8 or 5.9, or any range or value derivable therein. In some aspects, the pH of the solution is about 5.1.

[0027] In some aspects, the instructions include instructions for incubating the DNA sample with the solution at or at least 95°C, 96°C, 97°C, 98°C, 99°C, 99.5°C, 99.9°C, or any range or value that can be derived therein. In some aspects, the instructions include instructions for incubating the DNA sample with the solution at a temperature of at least 98°C. In some aspects, the instructions include instructions for incubating the DNA sample with the solution, incubating up to 12 minutes, 11 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes or 4 minutes, or any range or value that can be derived therein. In some aspects, the instructions include instructions for incubating the DNA sample with the solution for up to 10 minutes. In some aspects, the instructions include instructions for incubating the DNA sample with the solution for up to 8 minutes.

[0028] In some aspects, the present invention also discloses a method for 5-hydroxymethylcytosine analysis, comprising: (a) incubating a first solution comprising a first DNA molecule and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes; (b) incubating a second solution comprising a second DNA molecule and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes; (c) placing the first DNA molecule under alkaline conditions; (d) placing the second DNA molecule under alkaline conditions; (e) treating the second DNA molecule with an APOBEC deaminase; (f) sequencing the first DNA molecule and the second DNA molecule. In some aspects, the first solution does not contain sodium bisulfite. In some aspects, the second solution does not contain sodium bisulfite; in some aspects, the first solution and the second solution are the same solution. In some aspects, the first solution and the second solution are different solutions. In some aspects, (a) and (b) are performed simultaneously. In some aspects, (c) and (d) are performed simultaneously. In some aspects, the first DNA molecule and the second DNA molecule have the same nucleotide sequence. In some aspects, the APOBEC deaminase is APOBEC3A.

[0029] Throughout this application, the term "about" is used to indicate a value that includes the inherent variation of error for the measurement or quantitative method.

[0030] When used in conjunction with the term "comprising," the indefinite number preceding an element may mean "a," but it is also consistent with the meaning of "one or more than one," "at least one," and "one or more."

[0031] The word "and / or" means "and" or "or". For example, A, B, and / or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, "and / or" acts as an inclusive or.

[0032] The words "comprising", "having", "including" or "containing" are inclusive or open and do not exclude other unrecited elements or method steps.

[0033] The compositions and methods of use thereof may "comprise," "consist essentially of," or "consist of" any ingredient or step disclosed throughout this specification. Compositions and methods "consisting essentially of" any disclosed ingredient or step limit the scope of the claims to the specific materials or steps that do not materially affect the basic and novel characteristics of the claimed invention.

[0034] One of ordinary skill in the art will understand that a solution that does not contain a particular chemical (e.g., ammonium sulfite, sodium bisulfite, etc.) does not contain an added amount of that chemical. The term "added" means that the chemical is supplied from an exogenous source, i.e., in an amount greater than what is considered a trace or minute amount.

[0035] It is particularly contemplated that any limitation discussed about one embodiment of the present invention may be applied to any other embodiment of the present invention. In addition, any composition of the present invention may be used for any method of the present invention, and any method of the present invention may be used to produce or utilize any composition of the present invention. Any embodiment discussed about one aspect of the present disclosure is also applicable to other aspects of the present disclosure, and vice versa. For example, any step in the method described herein may be applied to any other method. In addition, any method described herein may exclude any step or combination of steps. The aspects of the embodiments set forth in the examples are also embodiments that may be implemented in the context of embodiments discussed elsewhere in different embodiments or elsewhere in the present application, such as in the content of the invention, the specific embodiments, the claims, and the accompanying drawings.

[0036] Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples illustrating preferred embodiments of the present invention are intended to be illustrative only, as various changes and modifications within the spirit and scope of the present invention will be apparent to those skilled in the art through the detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The following drawings constitute part of this specification and are included in this specification to further illustrate certain aspects of the present invention. The present invention can be better understood by referring to one or more of these drawings in combination with the detailed description of specific embodiments provided herein.

[0038] Figure 1 A mechanistic diagram of the bisulfite sequencing reaction is shown.

[0039] Figure 2A Matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (Maldi-TOF MS) is shown, which monitors the reaction of AGCGA (SEQ ID NO: 1) with R-1G at 98°C, showing that cytosine is completely converted to U-BS adduct within 3 minutes. After base treatment, U-BS adduct is quantitatively converted to U. Figure 2B Maldi-TOF MS monitoring of AGm 5 The reaction of CGA (SEQ ID NO: 2) with R-1G at 98°C showed that m 5 C did not react with R-1G even after 30 minutes of incubation.

[0040] Figure 3 The RNA fragment size distribution is shown after treatment with R-1G for different lengths of time (minutes) at 95° C. or 98° C. In all cases, the RNA fragments were distributed between 150 bp and 300 bp.

[0041] Figure 4 The results of sequencing total RNA from A549 cells are shown, and the reaction temperature and reaction time (X axis) are presented in a graphical form to show the relationship between the reaction temperature and reaction time (X axis) and the known m 5 C site (top, Y axis) and non-m 5 The effect of the average mutation rate at the C site (bottom, Y axis) was determined for sites with appropriately low levels of non-m 5 C site average mutation and reasonably high levels of known m 5 Conditions for average mutation rate at site C. Conditions at 98°C for 9 minutes provide the improved results characteristic of the disclosure, and these conditions may be referred to as "preferred conditions" and / or "D.5" in certain portions of this disclosure.

[0042] Figure 5 The m of the 28S rRNA locus is shown 5 C detection level. 28S rRNA m 5 C sites and background sites can be used as m 5 C detection analytical sensitivity and background measurement benchmark. 28S rRNA has two fully modified m 5 C site (marked by a vertical line), all other C sites were unmodified. As shown under the conditions of 98°C for 9 minutes, two known m 5 The non-conversion rate of the C site was over 95%, while the non-conversion rates of all C sites were less than 5%.

[0043] FIG. 6A to FIG. 6D False positive sites in various BS sequencing methods are shown. The X-axis represents the position in 28S human rRNA. The Y-axis represents the detected C ratio. Red dots represent false positive sites and green dots represent known m 5 C site (marked by a vertical line). Fig. 6A Results from traditional BS processing (eg, "Zymo kit") are shown. Figure 6B It is shown that Yang et al. 10 The result of the method. Figure 6C It is shown that Huang et al. 15 The result of the method. Fig.6D It is shown that Zhang et al. 21 The results of the method

[0044] 7A to 7F Analysis of different treatment times and temperatures using the R-1G protocol and validation using 28S rRNA are shown. Fig. 7A Shows the non-m under different conditions 5False positive rate of site C. A.1: 70℃ for 40 minutes, B.1: 80℃ for 30 minutes, B.2: 80℃ for 60 minutes, B.3: 80℃ for 120 minutes, C.1: 90℃ for 20 minutes, C.2: 90℃ for 30 minutes, C.3: 90℃ for 45 minutes, C.4: 90℃ for 60 minutes, D.1: 98℃ for 5 minutes, D.2: 98℃ for 6 minutes, D.3: 98℃ for 7 minutes, D.4: 98℃ for 8 minutes, D.5: 98℃ for 9 minutes, D.6: 98℃ for 10 minutes, D.7: 98℃ for 15 minutes. Figure 7B The results show that the 5 Methylation rate detected at C site. Figure 7C It shows that under D5 conditions, two known m 5 Site C showed a high detection rate with an overall false positive rate of less than 5%. Fig.7D The sequence depth at different positions on the 28S rRNA is shown. Fig. 7E and Figure 7F The false positive rate (FP) and the number of detected m in different methods are shown. 5 Statistics of C-site scores (e.g., Zymo EZ RNAMethylation TM Kit ("Zymo Kit"), Yang et al., 2017, Huang et al., 2019 or Zhang et al., 2021), wherein Fig. 7E Provides non-m 5 Comparison of false positive rates (cutoff value of 10% or 5%) for the C site, while the reported method showed false positives, no false positives were detected using the method described herein, and Figure 7F Provides m detected by different methods 5 Comparison of C scores, the method provided in this paper is used for two known m 5 C sites detected more than 95% modification scores, similar to traditional-BS treatments (e.g., Zymo kit), while all other reported methods detected lower m 5 C-scores, indicating that these methods may produce false negatives.

[0045] Figure 8 It is shown that when compared with different previously published methods (such as Zymo EZ RNA Methylation TMKit (“Zymo Kit”), Yang et al., 2017, Huang et al., 2019, or Zhang et al., 2021) compared to the BS protocols and methods of the present disclosure produce less bias in RNA degradation and show more uniform coverage in highly structured regions. Taking 28s rRNA as an example, it was found that the previously studied compositions and methods were more biased in the degradation of high GC regions, in particular, it was found that m 5 The coverage decreases near the C site (green vertical dashed line), which may be due to the 5 Deviations occur in the stoichiometry of C.

[0046] 9A to 9D The m 5 Detection results of site C. Fig. 9A (From AGTorres et al. 2014, Trends in Molecular Medicine Figure 1 ) shows conventional tRNA modifications, where m at positions 48, 49, and 50 5 The C modification is assembled by NSUN2, while the m 5 C is assembled by DNMT2. FIG. 9B to FIG. 9D Shown is m 5 The sequencing analysis results of C showed that all m 5 C scores were sensitive to NSUN2 knockdown; in contrast, m 5 The C score remains unchanged.

[0047] FIG. 10A to FIG. 10B The m 5 Detection and quantification results of C sites. Fig. 10A The m detected in tRNA is shown 5 The modification rate of the C site, the majority of m detected in tRNA 5 The C site showed a high modification rate. Fig. 10B Shown in tRNA Gly CCC The three m detected in 5 C site. Two sites (49 and 50) showed very high m 5 C scores, while one site (48) showed a relatively low score, while all other C sites showed very low background.

[0048] FIG. 11A to FIG. 11B The m values ​​of many RNA species in total RNA of HeLa cells are shown. 5 C site distribution. Fig.11A The m detected in different RNA species is shown 5 C site distribution, and Fig. 11B The m in mRNA is shown 5 C site distribution.

[0049] FIG. 12A to FIG. 12B The mRNA in HeLa mRNA using the R-1G protocol under condition D.5 is shown compared with that reported in the literature. 5 C site detection. More m 5 C sites (about 1241 sites), and these sites cover most of the sites reported in the literature. Fig. 12A Shown is similar to Huang et al. 2019 15 overlap, and Fig. 12B Shown in agreement with Zhang et al. 2021 21 overlap.

[0050] Fig.13 The mRNA in HeLa cells is shown 5 Distribution of modification levels at C sites. For mRNA detected in HeLa cells 5 For C sites, the modification rates varied between sites, with approximately half of the sites showing a modification rate of more than 10%.

[0051] FIG. 14A to FIG. 14B The m detected in each gene is shown 5 The number of C sites and their functional annotations based on Gene Ontology (GO). Fig.14A It shows that most of the identified modifier genes carry only one m 5 C site. Fig. 15B It is shown that it is found that 5 C-modified genes are involved in various gene functions, including glycoprotein metabolism, cytoskeleton organization, cell localization, etc.

[0052] FIG. 15A to FIG. 15B The m between different biological samples is shown 5 C modification levels were consistent. Fig.15A Figure 3 shows that although there are some differentially modified sites, the m 5 The overall modification level of the C site was consistent. Fig. 15B The m in HeLa cells is shown 5 The C-site motif (top) is more G-rich (e.g., CGGGG (SEQ ID NO: 10), which is a hallmark of NSUN2 association, while HEK293T (bottom) 5 The C site is enriched in the CUCCA (SEQ ID NO: 11) motif, which is a hallmark of NSUN6.

[0053] Fig.16The mRNA detected in the mRNA extracts of HeLa cell lines knocked down for NSUN2 (X axis) or NSUN6 (Y axis) is shown. 5 More than 90% of the modification scores in extracts from NSUN2 knockdown cells were decreased, indicating that NSUN2 may play a role in the m 5 C plays a major role in modification.

[0054] Fig.17 The mRNA expression in transcripts of modified genes from HeLa and HEK293T cells is shown. 5 The distribution of C site positions. 5 C modification is enriched at the 5′-end of the transcript (e.g., gene start and / or transcription (tx) start), indicating that m 5 C modification may be associated with transcript translation.

[0055] FIG. 18A to FIG. 18B The m at the 5′-end of the transcript is shown. 5 C modification can regulate translation efficiency. Fig.18A The results show that genes showing methylation signals at the 5′-end are also more enriched in ribosome density signals in the 5′-UTR of transcripts compared with unmethylated genes (p value = 1.05×10 -6 ), while genes showing methylation signals at the 3′ end did not show significant enrichment signals of ribosome density signals (p=0.37). Fig.18B It is shown that within the CDS region, neither the 5′-end nor the 3′-end methylated genes showed ribosome density enrichment signals.

[0056] FIG. 19A to FIG. 19B An analysis comparing the R-1G regimen and the A7 regimen using the DNA oligonucleotide AGCGA (SEQ ID NO: 3) is shown. Fig.19A It is shown that treatment of a model DNA oligomer with R-1G completely converts C to U-BS in 5 minutes at 98° C. Subsequent base treatment converts the U-BS adduct to U. Fig.19B It is shown that treatment of a model DNA oligo with A7 completely converted C to U-BS in just 3 minutes at 98°C.

[0057] Fig. 20 Shown is Maldi-TOF MS monitoring the reaction of 5mC with BS for different lengths of time at 98° C. After 20 minutes of incubation, only minimal reaction was detected.

[0058] Fig.21Sanger sequencing of an 82 monomer unit synthetic DNA oligonucleotide containing C and 5mC (SEQ ID NO: 8) is shown. Sanger sequencing shows that at least 8 minutes of incubation are required to complete the conversion of C to U, while 5mC is still shown as C even after 12 minutes of incubation.

[0059] FIG. 22A to FIG. 22B It is shown how the BS treatment disclosed herein (eg, A7-BS) quantitatively deaminates 4mC compared to traditional BS treatment (eg, Zymo-BS treatment). Fig.22A Described are Maldi TOF MS results showing that the 4mC residue in TA4mCTT (SEQ ID NO: 9) is not deaminated by conventional-BS treatment, but the DNA BS treatment disclosed herein quantitatively deaminates 4mC. Fig. 22B Sanger sequencing data are described, showing that two known 4mC sites in a 100 bp synthetic oligonucleotide (SEQ ID NO: 12) are read uniquely as T when treated with the DNA BS disclosed herein, whereas both 4mC sites are partially read as C when treated with conventional-BS.

[0060] FIG. 23A to FIG. 23B A comparison of DNA damage caused by conventional BS treatment (e.g., "Zymo kit") and published BS protocol A7 is shown. Using fish gDNA ( Fig.23A ) and found that in all cases using A7, degradation of fish gDNA was less than that caused by conventional -BS treatment between 4 and 12 minutes. The lower bands represent smaller DNA fragments. Compared with A7, Zymo kit treatment produced more low bands and fewer high bands, indicating that it caused more DNA damage. Using synthetic 164bp DNA ( Fig. 23B ), and found that the Zymo kit again caused more DNA degradation than A7 between 4 and 12 minutes.

[0061] FIG. 24A to FIG. 24E The DNA bisulfite conversion rate at different times using the protocols disclosed herein (e.g., A7) is shown compared to conventional-BS treatment (e.g., Zymo kit conditions). The results show that not only is the background of the disclosed protocols much lower than when using Zymo kit conditions, but the range of the background is also much lower. Using protocol A7 and incubating for 10 minutes provides the improved results characteristic described in the present disclosure. Fig.24A Shows from Fig. 24B The average ratio of the calculated background noise shows the raw background noise at different C sites along λ DNA (SEQ ID NO: 15). Fig.24CComparison of the unconversion rates of λ DNA treated with Zymo DNA methylation gold kit or the published A7 protocol at different incubation times is shown. The yellow (top) numbers represent the median unconversion rates, while the red (bottom) numbers represent the average unconversion rates. Fig.24D Shown are the bisulfite conversion efficiencies of lambda DNA treated with the Zymo DNA methylation gold kit or the published A7 protocol at different incubation times. Fig.24E A comparison of the background of lambda DNA treated with the Zymo DNA methylation gold kit or the published A7 protocol at different incubation times is shown. The results show that the use of A7 results in a much lower background and reduced background range compared to the Zymo kit treatment.

[0062] FIG. 25A to FIG. 25D The effect of the formulation and protocol disclosed herein ("New-BS") on 5mC analysis of low input DNA samples is shown. 10ng and 3.3ng of mESC starting gDNA were used to test the effect of the New-BS protocol (e.g., protocol A7 at 98°C for 10 minutes). Background noise and detection signal of 5mC after traditional-BS treatment (e.g., Zymo DNA methylation gold kit) or treatment with the disclosed protocol using an internal reference (spike-in) 164 monomer unit dsDNA oligomer (SEQ ID NO: 13; and antisense SEQ ID NO: 14). Fig.25A Shown are background and 5mC signals detected using conventional-BS treatment using 10 ng and 3 ng of mES starting gDNA, including spiked oligonucleotides. Fig.25B Depicted Fig.25A Graphical analysis of the data presented in , shows that the new BS treatment resulted in significantly lower background levels (% unconverted C) when compared to the traditional BS treatment. Fig.26 C shows the background and detected 5mC signal using 10 ng and 3 ng of mES starting gDNA (including spiked oligos) using the BS treatment protocol of the present disclosure (eg, protocol A7, 98°C for 10 min). Fig.25D Depicted Fig.25C Graphical analysis of the data presented in , showing that the new-BS treatment resulted in undesirable 5mC conversion similar to the traditional-BS treatment. As shown, the traditional-BS treatment resulted in high background noise in low-input DNA samples, and the noise increased as the input decreased. This noise would hamper the application of BS-seq in ultra-low input samples.

[0063] Fig.26 It is shown that in mESC gDNA (e.g., as in FIG. 25A to FIG. 25D , a comparison of methylation levels between conventional BS treatment (Y-axis) and the BS regimen of the present disclosure ("Neo-BS", X-axis) in Figure 1. The methylation levels reported in the data from the conventional BS treatment show a higher ratio than the data reported from the novel BS treatment of the present disclosure. This result may be due to the relatively high level of background noise (e.g., insufficient conversion) associated with the conventional-BS treatment.

[0064] Fig. 27 It is shown that the traditional-BS processed data reports more non-CpG sites than the BS scheme of the present disclosure (e.g., FIG. 25A to FIG. 25D This observation may be due to the relative increase in background noise in the traditional BS process compared to the BS scheme of the present disclosure. Background noise is a random signal, more likely to be non-CpG sites, and may cause problems in studying non-CpG methylation, leading to erroneous conclusions in biological studies.

[0065] FIG. 28A to FIG. 28B Shown are the coverage and conversion efficiency of the BS treatment disclosed herein for mESC genomic regions with different GC contents. Fig.28A The coverage of genomic regions with different GC contents in the BS process of the present disclosure is shown ( FIG. 25A to FIG. 25D The processing is similar between the “new-BS” described in and the traditional BS. Fig.28B It was shown that the unconverted C ratio increased as the GC% of the genomic region increased, but the unconverted ratios in all GC content regions showed lower background in the BS treatment disclosed herein when compared to the standard BS treatment.

[0066] FIG. 29A to FIG. 29B It is shown that the BS protocol disclosed herein shows more evenly distributed genomic coverage in mESC gDNA when compared to traditional BS processing (e.g., FIG. 25A to FIG. 25D ). Fig.29A The relative coverage (Z score) of different genomic windows at 100kb is shown. In general, the distribution of the BS scheme disclosed herein is narrower than that of traditional-BS processing data, as shown in the statistical data presented in the box plot, using the interquartile range (IQR) to represent the statistical variance of the data. Compared with the BS scheme described herein, the IQR values ​​of the traditional-BS processing showing 10ng and 3.3ng samples were reduced by 7.5% and 9.9%, respectively. Fig.29B Raw genome coverage data for all mESC chromosomes are shown.

[0067] Fig.30Shown is a comparison of the percentage of unconverted C (background) in lambda DNA spiked into gDNA from 1, 10, or 100 mESCs, where the DNA had been treated with either traditional BS or the BS disclosed herein ("Neo-BS").

[0068] Fig.31 Shown is a comparison of the percentage of unconverted C (background) in mitochondrial DNA from gDNA extracts of 1, 10, or 100 mESCs, where the DNA had been treated with either traditional BS or the BS disclosed herein ("Neo-BS").

[0069] Fig.32A Shown is Maldi-TOF MS demonstrating conversion of 5hmC to CMS within 1 minute using A7 treatment with oligonucleotide AG5hmCGA (SEQ ID NO: 5) at 98°C.

[0070] Fig.32B A diagram showing the process of 5hmC to CMS conversion.

[0071] Fig.33A Shown is Maldi-TOF MS demonstrating conversion of 5fC to U-BS within 30 min at 98°C using A7 treatment of oligonucleotide AG5fCGA (SEQ ID NO: 6).

[0072] Fig.33B A process diagram showing the conversion of 5fC to U is shown.

[0073] Fig.34A Maldi-TOF MS is shown, indicating that 5caC is converted to U-BS within 3 minutes at 98 °C.

[0074] Fig.34B A diagram showing the process of 5caC to U conversion.

[0075] Fig.35 Results from Maldi-TOF MS are shown, demonstrating that APOBEC3A efficiently deaminates 5mC to T, whereas CMS resists deamination and remains intact after APOBEC3A treatment.

[0076] Fig.36 Sanger sequencing results are shown, demonstrating that 5mC is quantitatively converted to T and 5hmC is mostly converted to 5hmU and thus read as T, although a small portion of 5hmC is not deaminated. In contrast, CMS resists deamination after APOBEC3A treatment and thus is still read as C.

[0077] Fig.37A schematic diagram of the workflow for sequencing 5mC and 5hmC in DNA using the disclosed method is shown. Genomic DNA contains C and its derivatives such as 5mC, 5hmC, 5fC, and 5caC. After treatment with the disclosed BS reagents and conditions, C, 5fC, and 5caC are converted to U, 5hmC is converted to CMS, and 5mC remains intact. Half of the samples (left) are sequenced, where only 5mC and 5hmC sites are read as C. The other half of the samples (right) are treated with APOBEC3A to convert 5mC to T while keeping CMS intact. After sequencing, only the initial 5hmC site will be read as C, while all other C derivatives will be read as T. The two libraries are subtracted to obtain the initial 5mC site. DETAILED DESCRIPTION

[0078] Aspects of the present disclosure relate to compositions, methods, and kits for detecting and analyzing methylated DNA and methylated RNA. Certain aspects relate to compositions for bisulfite treatment of methylated DNA and methylated RNA, including bisulfite solutions that do not contain sodium bisulfite. In some aspects, methods for bisulfite treatment of methylated DNA and methylated RNA are also disclosed, including methods comprising incubating at high temperatures (e.g., >95°C) for a short time (e.g., <15 minutes) using the disclosed bisulfite solution. Also described herein are kits comprising the disclosed compositions, and instructions for analyzing methylated DNA and / or methylated RNA. The sequencing method includes rapid bisulfite treatment, low background noise, and high sensitivity, and is capable of sequencing m in RNA starting from low input amounts of biological RNA or DNA samples. 5 C and 5mC in DNA for high-precision sequencing.

[0079] I. DNA processing methods

[0080] Aspects of the present disclosure relate to compositions and methods for DNA treatment. Specific aspects relate to compositions comprising ammonium bisulfite and methods of using such compositions in bisulfite treatment of DNA. Therefore, in some aspects, methods for DNA treatment are disclosed herein, including incubating a solution comprising a DNA molecule and ammonium bisulfite under conditions sufficient to deaminize the cytosine residues of the DNA molecule, wherein the solution does not contain sodium bisulfite or added sodium bisulfite. These methods may also include placing the DNA molecule under alkaline (i.e., alkaline) conditions. As disclosed herein, under suitable conditions, incubating one or more than one DNA molecule in a bisulfite solution of the present invention results in extremely fast deamination of cytosine, and low DNA degradation, while retaining 5-methylcytosine (5mC), resulting in identification of methylated nucleotides with a very low false positive rate. In some aspects, the method provided herein provides BS treatment suitable for accurately distinguishing 5mC and N4-methylcytosine (4mC). In some aspects, the method provided herein promotes the deamination of 4mC at a higher rate relative to traditional-BS treatment. In some respects, the method provided herein promotes 4mC to be converted into uracil at a higher rate relative to traditional-BS treatment. In some respects, the method provided herein quantitatively deaminates 4mC. In some respects, the method provided herein promotes the deamination of 4mC with an efficiency greater than or equal to about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100%, or any range that can be derived therefrom. In some respects, the method provided herein substantially avoids BS treatment false positives due to the presence of 4mC in the genome.

[0081] In some aspects, the DNA treatment methods of the present disclosure include incubating one or more DNA molecules in a bisulfite solution, wherein the bisulfite solution comprises ammonium bisulfite and does not comprise sodium bisulfite or added sodium bisulfite. In some aspects, the bisulfite solution comprises a concentration of or at most 1 M, 0.1 M, 0.01 M, 1×10 -3 M, 1×10 -4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 M, 1×10 - 13 M, 1×10 -14 M, 1×10 -15 M, 1×10-16 M, 1×10 -17 M, 1×10 -18 M, 1×10 -19 M, 1×10 -20 M or less than 1×10 -20 In some aspects, the solution contains no sodium. In some aspects, the solution contains sodium at a concentration of or at most 10 M, 1 M, 0.1 M, 0.01 M, 1×10 -3 M, 1×10 -4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M or less than 1×10 -10 In some aspects the solution does not contain ammonium sulfite or added ammonium sulfite.

[0082] In certain aspects, the solutions of the invention (e.g., bisulfite solutions) comprise between 50% and 70% by weight, including any range or value derivable therein. In some aspects, the solution comprises at least, at most, or about 50%, 50.1%, 50.2%, 50.3%, 50.4%, 50.5%, 50.6%, 50.7%, 50.8%, 50.9%, 51%, 51.1%, 51.2%, 51.3%, 51.4%, 51.5%, 51.6%, 51.7%, 51.8%, 51.9%, 52%, 52.1%, 52.2%, 52.3%, 52.4%, 52.5%, 52.6%, 52.7%, 52.8%, 52.9%, 53.0%, 53.1%, 53.2%, 53.3%, 53.4%, 53.5%, 53.6%, 53.7%, 53.8%, 53.9%, 54.0%, 54.1%, 54.2%, 54.3%, 54.4%, 54.5%, 54.6%, 54.7%, 54.8%, 54.9%, 55.1%, 55.2%, 55.3%, 55.4%, 55.5%, 55.6%, 55.7%, 55.8%, 55.9%, 56. 52.8 wt%, 52.9 wt%, 53 wt%, 53.1 wt%, 53.2 wt%, 53.3 wt%, 53.4 wt%, 53.5 wt%, 53.6 wt%, 53.7 wt%, 53.8 wt%, 53.9 wt%, 54 wt%, 54.1 wt%, 54.2 wt%, 54.3 wt%, 54.4 wt%, 54.5 wt%, 54.6 wt%, 54.7 wt%, 54.8 wt%, 54.9 wt%, 55 wt%, 55.1 wt%, 55.2 wt%, 55.3 wt%, 55.4 wt%, 55.5 wt%, 55.6 wt%, 55.7 wt%, 5 %, 55.9 wt%, 56 wt%, 56.1 wt%, 56.2 wt%, 56.3 wt%, 56.4 wt%, 56.5 wt%, 56.6 wt%, 56.7 wt%, 56.8 wt%, 56.9 wt%, 57 wt%, 57.1 wt%, 57.2 wt%, 57.3 wt%, 57.4 wt%, 57.5 wt%, 57.6 wt%, 57.7 wt%, 57.8 wt%, 57.9 wt%, 58 wt%, 58.1 wt%, 58.2 wt%, 58.3 wt%, 58.4 wt%, 58.5 wt%, 58.6 wt%, 58.7 wt%, 58 .8 wt%, 58.9 wt%, 59 wt%, 59.1 wt%, 59.2 wt%, 59.3 wt%, 59.4 wt%, 59.5 wt%, 59.6 wt%, 59.7 wt%, 59.8 wt%, 59.9 wt%, 60 wt%, 60.1 wt%, 60.2 wt%, 60.3 wt%, 60.4 wt%, 60.5 wt%, 60.6 wt%, 60.7 wt%, 60.8 wt%, 60.9 wt%, 61 wt%, 61.1 wt%, 61.2 wt%, 61.3 wt%, 61.4 wt%, 61.5 wt%, 61.6 wt%, 61.7 wt%, 61.8 wt%, 61.9 wt%, 62 wt%, 62.1 wt%, 62.2 wt%, 62.3 wt%, 62.4 wt%, 62.5 wt%, 62.6 wt%, 62.7 wt%, 62.8 wt%, 62.9 wt%, 63 wt%, 63.1 wt%, 63.2 wt%, 63.3 wt%, 63.4 wt%, 63.5 wt%, 63.6 wt%, 63.7 wt%, 63.8 wt%, 63.9 wt%. %, 64 wt%, 64.1 wt%, 64.2 wt%, 64.3 wt%, 64.4 wt%, 64.5 wt%, 64.6 wt%, 64.7 wt%, 64.8 wt%, 64.9 wt%, 65 wt%, 65.1 wt%, 65.2 wt%, 65.3 wt%, 65.4 wt%, 65.5 wt%, 65.6 wt%, 65.7 wt%, 65.8 wt%, 65.9 wt%, 66 wt%, 6.1 wt%, 66.2 wt%, 66.3 wt%, 66.4 wt%, 66.5 wt%, 66.6 wt%, 66.7 wt%, 66.8 wt%, 66.9 wt%, 67 wt%, 67.1 wt%, 67.2 wt%, 67.3 wt%, 67.4 wt%, 67.5 wt%, 67.6 wt%, 67.7 wt%, 67.8 wt%, 67.9 wt%, 68 wt%, 68.1 wt%, 68. %, 69.8 wt%, 69.9 wt% or 70 wt% ammonium bisulfite, or any range or value derivable therein. In some aspects, the solution comprises at least, at most, or about 66 wt%, 66.01 wt%, 66.02 wt%, 66.03 wt%, 66.04 wt%, 66.05 wt%, 66.06 wt%, 66.07 wt%, 66.08 wt%, 66.09 wt%, 66.1 wt%, 66.11 wt%, 66.12 wt%, 66.13 wt%, 66.14 wt%, 66.15 wt%, 66.16 wt%. %, 66.17 wt%, 66.18 wt%, 66.19 wt%, 66.2 wt%, 66.21 wt%, 66.22 wt%, 66.23 wt%, 66.24 wt%, 66.25 wt%, 66.26 wt%, 66.27 wt%, 66.28 wt%, 66.29 wt%, 66.3 wt%, 66.31 wt%, 66.32 wt%, 66.33 wt%, 66.34 wt%, 66.35 wt%, 66.36 wt%, 66.37 wt%, 66.38 wt%, 66.39 wt%, 66.4 wt%, 66.41 wt%, 66.42 wt%, 66.43 wt%, 66.44 wt%, 66.45 wt%, 66.46 wt%, 66.47 wt%, 66.48 wt%, 66.49 wt%, 66.5 wt%, 66.51 wt%, 66 .52 wt%, 66.53 wt%, 66.54 wt%, 66.55 wt%, 66.56 wt%, 66.57 wt%, 66.58 wt%, 66.59 wt%, 66.6 wt%, 66.61 wt%, 66.62 wt%, 66.63 wt%, 66.64 wt%, 66.65 wt%, 66.66 wt%, 66.67 wt%, 66.68 wt%, 6 6.69 wt%, 66.7 wt%, 66.71 wt%, 66.72 wt%, 66.73 wt%, 66.74 wt%, 66.75 wt%, 66.76 wt%, 66.77 wt%, 66.78 wt%, 66.79 wt%, 66.8 wt%, 66.81 wt%, 66.82 wt%, 66.83 wt%, 66.84 wt%, 66.85 wt%, 66.86 wt%, 66.87 wt%, 66.88 wt%, 66.89 wt%, 66.90 wt%, 66.91 wt%, 66.92 wt%, 66.93 wt%, 66.94 wt%, 66.95 wt%, 66.96 wt%, 66.97 wt%, 66.98 wt%, 66.99 wt%, 66.91 wt%, 66.99 wt%, 66.91 wt%, 66.93 wt%, 66.97 wt%, 66.98 wt%, In some aspects, the solution comprises about 66.67% by weight of ammonium bisulfite. In some aspects, the bisulfite solution does not comprise ammonium sulfite or added ammonium sulfite. In some aspects, the bisulfite solution comprises ammonium sulfite. .

[0083] In some aspects, the bisulfite solution has a bisulfite concentration of 6.5 M to 10 M, including any range or value derivable therein. In some aspects, the bisulfite solution has a bisulfite concentration of at least, at most, or about 6.5 M, 6.6 M, 6.7 M, 6.8 M, 6.9 M, 7 M, 7.1 M, 7.2 M, 7.3 M, 7.4 M, 7.5 M, 7.6 M, 7.7 M, 7.8 M, 7.9 M, 8 M, 8.1 M, 8.2 M, 8.3 M, 8.4 M, 8.5 M, 8.6 M, 8.7 M, 8.8 M, 8.9 M, 9 M, 9.1 M, 9.2 M, 9.3 M, 9.4 M, 9.5 M, 9.6 M, 9.7 M, 9.8 M, 9.9 M, or 10 M, or any range or value derivable therein. In some aspects, the bisulfite solution has a bisulfite concentration of about 9.5 M. In some aspects, the bisulfite solution has a bisulfite concentration of 9.5M.

[0084] For example, the bisulfite solution of the present invention can be produced by mixing two ammonium bisulfite solutions having different weight % ammonium bisulfite. For example, the bisulfite solution of the present invention can be produced by mixing a 70% ammonium bisulfite solution and a 50% ammonium bisulfite solution. In some aspects, the 70% ammonium bisulfite solution and the 50% ammonium bisulfite solution are mixed in a ratio of, for example, 10:0.1, 10:0.2, 10:0.3, 10:0.4, 10:0.5, 10:0.6, 10:0.7, 10:0.8, 10:0.9, 10:1, 10:1.1, 10:1.2, 10:1.3, 10:1.4, 10:1.5, 10:1.6, 10:1.7, 10:1.8, 10:1.9 or 10:2, or any range or value derivable therein. In some aspects, the 70% ammonium bisulfite solution and the 50% ammonium bisulfite solution are mixed in a ratio of 10:1.

[0085] In some aspects, the DNA treatment method comprises incubating one or more DNA molecules in a bisulfite solution of the invention (e.g., a solution comprising ammonium bisulfite, such as 50% to 70% ammonium bisulfite, which does not comprise sodium bisulfite) at a temperature of at least 80°C for up to 20 minutes. In some aspects, the method comprises heating the mixture at a temperature of at least, at most, or about 80°C, 80.1°C, 80.2°C, 80.3°C, 80.4°C, 80.5°C, 80.6°C, 80.7°C, 80.8°C, 80.9°C, 81°C, 81.1°C, 81.2°C, 81.3°C, 81.4°C, 81.5°C, 81.6°C, 81.7°C, 81.8°C, 81.9°C, 82°C, 82.1°C, 82.2°C, 82.3°C, 82.4°C, 82.5°C, 82.6°C, 82.7°C, 82.8°C, 82.9°C, 83°C, 83.1°C, 83.2°C, 83.3°C, 83.4°C, 83.5°C , 83.6℃, ​​83.7℃, 83.8℃, 83.9℃, 84℃, 84.1℃, 84.2℃, 84.3℃, 84.4℃, 84.5℃, 84.6℃, 84.7℃, 84.8℃, 84.9℃, 85℃, 85.1℃, 85.2℃, 85.3℃, 85.4℃, 85.5℃, 85.6℃, 85.7℃, 85.8℃, 85.9℃, 86℃, 86.1℃, 86.2℃, 86.3℃, 86.4℃, 86.5℃, 86.6℃, 86.7℃, 86.8℃, 86.9℃, 87℃, 87.1℃, 87.2℃, 87.3℃, 87.4 ℃, 87.5℃, 87.6℃, 87.7℃, 87.8℃, 87.9℃, 88℃, 88.1℃, 88.2℃, 88.3℃, 88.4℃, 88.5℃, 88.6℃, 88.7℃, 88.8℃, 88.9℃, 89℃, 89.1℃, 89.2℃, 89.3℃, 89.4℃, 89.5℃, 89.6℃, 89.7℃, 89.8℃, 89.9℃, 90℃, 90.1℃, 90.2℃, 90.3℃, 90.4℃, 90.5℃, 90.6℃, 90.7℃, 90.8℃, 90.9℃, 91℃, 91.1℃, 91.2℃, 91. 3℃, 91.4℃, 91.5℃, 91.6℃, 91.7℃, 91.8℃, 91.9℃, 92℃, 92.1℃, 92.2℃, 92.3℃, 92.4℃, 92.5℃, 92.6℃, 92.7℃, 92.8℃, 92.9℃, 93℃, 93.1℃, 93.2℃, 93.3℃, ​​93.4℃, 93.5℃, 93.6℃, ​​93.7℃, 93.8℃, 93.9℃, 94℃, 94.1℃, 94.2℃, 94.3℃, 94.4℃, 94.5℃, 94.6℃, 94.7℃, 94.8℃, 94.9℃, 95℃, 95.1℃, 95.2℃、95.3℃、95.4℃、95.5℃、95.6℃、95.7℃、95.8℃、95.9℃、96℃、96.1℃、96.2℃、96.3℃、96.4℃、96.5℃、96.6℃、96.7℃、96.8℃、96.9℃、97℃、97.1℃、97.2℃、97.3℃ , 97.4℃, 97.5℃, 97.6℃, 97.7℃, 97.8℃, 97.9℃, 98℃, 98.1℃, 98.2℃, 98.3℃, 98.4℃, 98.5℃, 98.6℃, 98.7℃, 98.8℃, 98.9℃, 99℃, 99.1℃, 99.2℃, 99.3℃, 99.4℃, 99 Incubate the one or more DNA molecules in a bisulfite solution at a temperature of 99.5° C., 99.6° C., 99.7° C., 99.8° C., 99.9° C. (or any range or value derivable therein) for up to or about 15 minutes, 14.9 minutes, 14.8 minutes, 14.7 minutes, 14.6 minutes, 14.5 minutes, 14.4 minutes, 14.3 minutes, 14.2 minutes, 14.1 minutes, 14 minutes, 13.9 minutes, 13.8 minutes, 13.7 minutes, 13.6 minutes, 13.5 minutes, 13.4 minutes, 13.3 minutes, 13.2 minutes, 13.1 minutes, 13 minutes, 12.9 minutes, 12.8 minutes, 12.7 minutes, 12.6 minutes, 12.5 minutes minutes, 12.4 minutes, 12.3 minutes, 12.2 minutes, 12.1 minutes, 12 minutes, 11.9 minutes, 11.8 minutes, 11.7 minutes, 11.6 minutes, 11.5 minutes, 11.4 minutes, 11.3 minutes, 11.2 minutes, 11.1 minutes, 11 minutes, 10.9 minutes, 10.8 minutes, 10.7 minutes, 10.6 minutes, 10.5 minutes, 10.4 minutes, 10.3 minutes, 10.2 minutes, 10.1 minutes, 10 minutes, 9.9 minutes, 9.8 minutes, 9.7 minutes, 9.6 minutes, 9.5 minutes, 9.4 minutes, 9.3 minutes, 9.2 minutes, 9.1 minutes, 9 minutes, 8.9 minutes, 8.8 minutes, 8.7 minutes, 8. 6 minutes, 8.5 minutes, 8.4 minutes, 8.3 minutes, 8.2 minutes, 8.1 minutes, 8 minutes, 7.9 minutes, 7.8 minutes, 7.7 minutes, 7.6 minutes, 7.5 minutes, 7.4 minutes, 7.3 minutes, 7.2 minutes, 7.1 minutes, 7 minutes, 6.9 minutes, 6.8 minutes, 6.7 minutes, 6.6 minutes, 6.5 minutes, 6.4 minutes, 6.3 minutes, 6.2 minutes, 6.1 minutes, 6 minutes, 5.9 minutes, 5.8 minutes, 5.7 minutes, 5.6 minutes, 5.5 minutes, 5.4 minutes, 5.3 minutes, 5.2 minutes, 5.1 minutes, 5 minutes, 4.9 minutes, 4.8 minutes, 4.7 minutes, 4.6 minutes, 4.5 minutes, 4.4 minutes, 4.3 minutes, 4.2 minutes, 4.1 minutes, 4 minutes, 3.9 minutes, 3.8 minutes, 3.7 minutes, 3.6 minutes, 3.5 minutes, 3.4 minutes, 3.3 minutes, 3.2 minutes, 3.1 minutes, 3 minutes, 2.9 minutes, 2.8 minutes, 2.7 minutes, 2.6 minutes, 2.5 minutes, 2.4 minutes, 2.3 minutes, 2.2 minutes, 2.1 minutes, 2 minutes, 1.9 minutes, 1.8 minutes, 1.7 minutes, 1.6 minutes, 1.5 minutes, 1.4 minutes, 1.3 minutes, 1.2 minutes, 1.1 minutes or 1 minute (or any range or value derivable therein). Any combination of the foregoing incubation times and temperatures can be used in the DNA treatment methods of the present disclosure. .

[0086] In some aspects, the DNA treatment method comprises incubating one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 95° C. for up to 12 minutes, incubating one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 96° C. for up to 12 minutes, incubating one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 12 minutes, incubating one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 98° C. for up to 12 minutes, incubating one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 99° C. for up to 12 minutes, ...5° C. for up to 12 minutes, incubating one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 96° C. for up to 12 minutes, incubating one or more DNA molecules in a bisulfite solution of the invention at a temperature of Incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 96° C. for up to 11 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 11 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 98° C. for up to 11 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 99° C. for up to 11 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 95° C. for up to 11 minutes. Incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 96° C. for up to 10 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 97° C. for up to 10 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 98° C. for up to 10 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 99° C. for up to 10 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 95° C. for up to 9 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 96° C. for up to 10 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 98° C. for up to 10 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 95° C. for up to 9 minutes, incubate one or more DNA molecules in a bisulfite solution of the present invention at a temperature of at least 96° C. for up to 10 minutes. Incubate one or more DNA molecules in a bisulfite solution of the invention for up to 9 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 97°C for up to 9 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 98°C for up to 9 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 99°C for up to 9 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 95°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 96°C for up to 8 minutes,Incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 97°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 98°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 99°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 95°C for up to 7 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 96°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 97°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 98°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 99°C for up to 8 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 95°C for up to 7 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 96°C for up to 8 minutes, Incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 7 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 98° C. for up to 7 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 99° C. for up to 7 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 95° C. for up to 6 minutes, Incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 96°C for up to 6 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 97°C for up to 6 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 98°C for up to 6 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 99°C for up to 6 minutes, incubate one or more DNA molecules in a bisulfite solution of the invention at a temperature of at least 95°C for up to 6 minutes, Incubate one or more DNA molecules in a bisulfite solution of the invention for up to 5 minutes at a temperature of at least 96°C for up to 5 minutes at a temperature of at least 97°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for at least 5 minutes at a temperature of at least 98°C for at least ...7°C for at most 5 minutes at a temperature of at least 97°C for at most 5 minutes at a temperature of at least 97°C for

[0087] As disclosed herein, incubation of DNA molecules with a bisulfite solution of the present disclosure (e.g., a solution comprising ammonium bisulfite, such as 50% to 70% ammonium bisulfite, which does not comprise sodium bisulfite, or added sodium bisulfite) under appropriate conditions (e.g., at a temperature of at least 95° C. for up to 12 minutes) is sufficient to deaminate most cytosine residues in the DNA molecules. In some aspects, after incubation of the DNA molecules with the bisulfite solution of the present invention under appropriate conditions, more than 90% of the DNA molecules do not comprise cytosine residues. In some aspects, greater than or equal to 90%, 90.1%, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, 91%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95%, 95.1% , 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97 In some aspects, more than 99% of the DNA molecules do not contain cytosine residues.

[0088] The DNA processing methods disclosed herein can be used, for example, to prepare DNA molecules for sequencing in order to detect, quantify and / or analyze DNA cytosine methylation. In some aspects, the DNA processing methods disclosed herein provide DNA molecules for sequencing analysis that result in reduced false positive levels, increased true positive levels, reduced false negative levels and / or increased true negative levels relative to traditional BS processing.

[0089] II. RNA processing methods

[0090] Aspects of the present disclosure relate to compositions and methods for RNA treatment. Specific aspects relate to compositions comprising ammonium bisulfite and methods of using such compositions in bisulfite treatment of RNA. Therefore, in some aspects, disclosed herein is a method for RNA treatment, comprising incubating a solution comprising RNA molecules, ammonium bisulfite and ammonium sulfite under conditions sufficient to deaminize cytosine residues of RNA molecules, wherein the solution does not contain sodium bisulfite or added sodium bisulfite. These methods may also include placing the RNA molecules under alkaline (i.e., alkaline) conditions. As disclosed herein, under suitable conditions, incubating one or more than one RNA molecule in a bisulfite solution of the present invention results in extremely fast deamination of cytosine, and low degradation of RNA, resulting in identification of methylated nucleotides with a very low false positive rate. In some aspects, relative to traditional BS treatment, the method disclosed herein results in a reduction in background noise (e.g., unconverted cytosine) levels.

[0091] In some aspects, the RNA treatment methods of the invention comprise incubating one or more RNA molecules in a bisulfite solution, wherein the bisulfite solution comprises ammonium bisulfite and ammonium sulfite, and wherein the bisulfite solution does not comprise sodium bisulfite or added sodium bisulfite. In some aspects, the bisulfite solution comprises a concentration of or at least 1 M, 0.1 M, 0.01 M, 1×10 -3 M, 1×10 -4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 - 10 M, 1×10 -11 M, 1×10 -12 M, 1×10 -13 M, 1×10 -14 M, 1×10 -15 M, 1×10 -16 M, 1×10 -17 M, 1×10 -18 M, 1×10 -19 M, 1×10 -20 M or less than 1×10 -20 In some aspects, the bisulfite solution does not contain sodium.

[0092] In certain aspects, the solutions of the invention (e.g., bisulfite solutions) comprise between 50% and 70% by weight, including any range or value derivable therein. In some aspects, the solution comprises at least, at most, or about 50%, 50.1%, 50.2%, 50.3%, 50.4%, 50.5%, 50.6%, 50.7%, 50.8%, 50.9%, 51%, 51.1%, 51.2%, 51.3%, 51.4%, 51.5%, 51.6%, 51.7%, 51.8%, 51.9%, 52%, 52.1%, 52.2%, 52.3%, 52.4%, 52.5%, 52.6%, 52.7%, 52.8%, 52.9%, 53.0%, 53.1%, 53.2%, 53.3%, 53.4%, 53.5%, 53.6%, 53.7%, 53.8%, 53.9%, 54.0%, 54.1%, 54.2%, 54.3%, 54.4%, 54.5%, 54.6%, 54.7%, 54.8%, 54.9%, 55.1%, 55.2%, 55.3%, 55.4%, 55.5%, 55.6%, 55.7%, 55.8%, 55.9%, 56. 52.8 wt%, 52.9 wt%, 53 wt%, 53.1 wt%, 53.2 wt%, 53.3 wt%, 53.4 wt%, 53.5 wt%, 53.6 wt%, 53.7 wt%, 53.8 wt%, 53.9 wt%, 54 wt%, 54.1 wt%, 54.2 wt%, 54.3 wt%, 54.4 wt%, 54.5 wt%, 54.6 wt%, 54.7 wt%, 54.8 wt%, 54.9 wt%, 55 wt%, 55.1 wt%, 55.2 wt%, 55.3 wt%, 55.4 wt%, 55.5 wt%, 55.6 wt%, 55.7 wt%, 5 %, 55.9 wt%, 56 wt%, 56.1 wt%, 56.2 wt%, 56.3 wt%, 56.4 wt%, 56.5 wt%, 56.6 wt%, 56.7 wt%, 56.8 wt%, 56.9 wt%, 57 wt%, 57.1 wt%, 57.2 wt%, 57.3 wt%, 57.4 wt%, 57.5 wt%, 57.6 wt%, 57.7 wt%, 57.8 wt%, 57.9 wt%, 58 wt%, 58.1 wt%, 58.2 wt%, 58.3 wt%, 58.4 wt%, 58.5 wt%, 58.6 wt%, 58.7 wt%, 58 .8 wt%, 58.9 wt%, 59 wt%, 59.1 wt%, 59.2 wt%, 59.3 wt%, 59.4 wt%, 59.5 wt%, 59.6 wt%, 59.7 wt%, 59.8 wt%, 59.9 wt%, 60 wt%, 60.1 wt%, 60.2 wt%, 60.3 wt%, 60.4 wt%, 60.5 wt%, 60.6 wt%, 60.7 wt%, 60.8 wt%, 60.9 wt%, 61 wt%, 61.1 wt%, 61.2 wt%, 61.3 wt%, 61.4 wt%, 61.5 wt%, 61.6 wt%, 61.7 wt%, 61.8 wt%, 61.9 wt%, 62 wt%, 62.1 wt%, 62.2 wt%, 62.3 wt%, 62.4 wt%, 62.5 wt%, 62.6 wt%, 62.7 wt%, 62.8 wt%, 62.9 wt%, 63 wt%, 63.1 wt%, 63.2 wt%, 63.3 wt%, 63.4 wt%, 63.5 wt%, 63.6 wt%, 63.7 wt%, 63.8 wt%, 63.9 wt%. %, 64 wt%, 64.1 wt%, 64.2 wt%, 64.3 wt%, 64.4 wt%, 64.5 wt%, 64.6 wt%, 64.7 wt%, 64.8 wt%, 64.9 wt%, 65 wt%, 65.1 wt%, 65.2 wt%, 65.3 wt%, 65.4 wt%, 65.5 wt%, 65.6 wt%, 65.7 wt%, 65.8 wt%, 65.9 wt%, 66 wt%, 6.1 wt%, 66.2 wt%, 66.3 wt%, 66.4 wt%, 66.5 wt%, 66.6 wt%, 66.7 wt%, 66.8 wt%, 66.9 wt%, 67 wt%, 67.1 wt%, 67.2 wt%, 67.3 wt%, 67.4 wt%, 67.5 wt%, 67.6 wt%, 67.7 wt%, 67.8 wt%, 67.9 wt%, 68 wt%, 68.1 wt%, 68. %, 69.8 wt%, 69.9 wt% or 70 wt% ammonium bisulfite, or any range or value derivable therein. In some aspects, the solution comprises at least, at most, or about 66 wt%, 66.01 wt%, 66.02 wt%, 66.03 wt%, 66.04 wt%, 66.05 wt%, 66.06 wt%, 66.07 wt%, 66.08 wt%, 66.09 wt%, 66.1 wt%, 66.11 wt%, 66.12 wt%, 66.13 wt%, 66.14 wt%, 66.15 wt%, 66.16 wt%. %, 66.17 wt%, 66.18 wt%, 66.19 wt%, 66.2 wt%, 66.21 wt%, 66.22 wt%, 66.23 wt%, 66.24 wt%, 66.25 wt%, 66.26 wt%, 66.27 wt%, 66.28 wt%, 66.29 wt%, 66.3 wt%, 66.31 wt%, 66.32 wt%, 66.33 wt%, 66.34 wt%, 66.35 wt%, 66.36 wt%, 66.37 wt%, 66.38 wt%, 66.39 wt%, 66.4 wt%, 66.41 wt%, 66.42 wt%, 66.43 wt%, 66.44 wt%, 66.45 wt%, 66.46 wt%, 66.47 wt%, 66.48 wt%, 66.49 wt%, 66.5 wt%, 66.51 wt%, 66 .52 wt%, 66.53 wt%, 66.54 wt%, 66.55 wt%, 66.56 wt%, 66.57 wt%, 66.58 wt%, 66.59 wt%, 66.6 wt%, 66.61 wt%, 66.62 wt%, 66.63 wt%, 66.64 wt%, 66.65 wt%, 66.66 wt%, 66.67 wt%, 66.68 wt%, 6 6.69 wt%, 66.7 wt%, 66.71 wt%, 66.72 wt%, 66.73 wt%, 66.74 wt%, 66.75 wt%, 66.76 wt%, 66.77 wt%, 66.78 wt%, 66.79 wt%, 66.8 wt%, 66.81 wt%, 66.82 wt%, 66.83 wt%, 66.84 wt%, 66.85 wt%, 66.86 wt%, 66.87 wt%, 66.88 wt%, 66.89 wt%, 66.90 wt%, 66.91 wt%, 66.92 wt%, 66.93 wt%, 66.94 wt%, 66.95 wt%, 66.96 wt%, 66.97 wt%, 66.98 wt%, 66.99 wt%, 66.91 wt%, 66.99 wt%, 66.91 wt%, 66.93 wt%, 66.97 wt%, 66.98 wt%, 6.86%, 66.87%, 66.88%, 66.89%, 66.9%, 66.91%, 66.92%, 66.93%, 66.94%, 66.95%, 66.96%, 66.97%, 66.98%, 66.99% or 67% by weight of ammonium bisulfite, or any range or value derivable therein.

[0093] In some aspects, the bisulfite solution has a bisulfite concentration of 6.5 M to 10 M, including any range or value derivable therein. In some aspects, the bisulfite solution has a bisulfite concentration of at least, at most, or about 6.5 M, 6.6 M, 6.7 M, 6.8 M, 6.9 M, 7.0 M, 7.1 M, 7.2 M, 7.3 M, 7.4 M, 7.5 M, 7.6 M, 7.7 M, 7.8 M, 7.9 M, 8.0 M, 8.1 M, 8.2 M, 8.3 M, 8.4 M, 8.5 M, 8.6 M, 8.7 M, 8.8 M, 8.9 M, 9.0 M, 9.1 M, 9.2 M, 9.3 M, 9.4 M, 9.5 M, 9.6 M, 9.7 M, 9.8 M, 9.9 M, or 10 M, or any range or value derivable therein. In some aspects, the bisulfite solution has a bisulfite concentration of about 7.0 M. In some aspects, the bisulfite solution has a bisulfite concentration of 7.0 M.

[0094] In some aspects, the bisulfite solution of the invention for RNA treatment comprises 5 wt % to 15 wt %, or any range or value derivable therein. In some aspects, the solution comprises at least, at most, or about 5 wt %, 5.1 wt %, 5.2 wt %, 5.3 wt %, 5.4 wt %, 5.5 wt %, 5.6 wt %, 5.7 wt %, 5.8 wt %, 5.9 wt %, 6 wt %, 6.1 wt %, 6.2 wt %, 6.3 wt %, 6.4 wt %, 6.5 wt %, 6.6 wt %, 6.7 wt %, 6.8 wt %, 6.9 wt %, 7 wt %, 7.1 wt %, 7.2 wt %, 7.3 wt %, 7.4 wt %, 7.5 wt %, 7.6 wt %, 7.7 wt %, 7.8 wt %, 7.9 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 wt %, 8 7.6 wt%, 7.7 wt%, 7.8 wt%, 7.9 wt%, 8 wt%, 8.1 wt%, 8.2 wt%, 8.3 wt%, 8.4 wt%, 8.5 wt%, 8.6 wt%, 8.7 wt%, 8.8 wt%, 8.9 wt%, 9 wt%, 9.1 wt%, 9.2 wt%, 9.3 wt%, 9.4 wt%, 9.5 wt%, 9.6 wt%, 9.7 wt%, 9.8 wt%, 9.9 wt%, 10 wt%, 10.1 wt%, 10.2 wt%, 10.3 wt% %, 10.4 wt%, 10.5 wt%, 10.6 wt%, 10.7 wt%, 10.8 wt%, 10.9 wt%, 11 wt%, 11.1 wt%, 11.2 wt%, 11.3 wt%, 11.4 wt%, 11.5 wt%, 11.6 wt%, 11.7 wt%, 11.8 wt%, 11.9 wt%, 12 wt%, 12.1 wt%, 12.2 wt%, 12.3 wt%, 12.4 wt%, 12.5 wt%, 12.6 wt%, 12.7 wt%, 12.8 In some aspects, the bisulfite solution comprises from 8 wt % to 12 wt % ammonium sulfite. In some aspects, the bisulfite solution comprises about 10 wt % ammonium sulfite. In some aspects, the bisulfite solution is produced by mixing an ammonium bisulfite solution (eg, 50% to 70% ammonium bisulfite) with ammonium sulfite (eg, solid ammonium sulfite monohydrate).

[0095] In some aspects, the RNA treatment method comprises incubating one or more RNA molecules in a bisulfite solution of the invention (e.g., a solution comprising ammonium bisulfite and ammonium sulfite without sodium bisulfite or added sodium bisulfite) at a temperature of at least 80°C for up to 20 minutes. In some aspects, the method comprises heating the mixture at a temperature of at least, at most, or about 80°C, 80.1°C, 80.2°C, 80.3°C, 80.4°C, 80.5°C, 80.6°C, 80.7°C, 80.8°C, 80.9°C, 81°C, 81.1°C, 81.2°C, 81.3°C, 81.4°C, 81.5°C, 81.6°C, 81.7°C, 81.8°C, 81.9°C, 82°C, 82.1°C, 82.2°C, 82.3°C, 82.4°C, 82.5°C, 82.6°C, 82.7°C, 82.8°C, 82.9°C, 83°C, 83.1°C, 83.2°C, 83.3°C, 83.4°C, 83.5°C , 83.6℃, ​​83.7℃, 83.8℃, 83.9℃, 84℃, 84.1℃, 84.2℃, 84.3℃, 84.4℃, 84.5℃, 84.6℃, 84.7℃, 84.8℃, 84.9℃, 85℃, 85.1℃, 85.2℃, 85.3℃, 85.4℃, 85.5℃, 85.6℃, 85.7℃, 85.8℃, 85.9℃, 86℃, 86.1℃, 86.2℃, 86.3℃, 86.4℃, 86.5℃, 86.6℃, 86.7℃, 86.8℃, 86.9℃, 87℃, 87.1℃, 87.2℃, 87.3℃, 87.4 ℃, 87.5℃, 87.6℃, 87.7℃, 87.8℃, 87.9℃, 88℃, 88.1℃, 88.2℃, 88.3℃, 88.4℃, 88.5℃, 88.6℃, 88.7℃, 88.8℃, 88.9℃, 89℃, 89.1℃, 89.2℃, 89.3℃, 89.4℃, 89.5℃, 89.6℃, 89.7℃, 89.8℃, 89.9℃, 90℃, 90.1℃, 90.2℃, 90.3℃, 90.4℃, 90.5℃, 90.6℃, 90.7℃, 90.8℃, 90.9℃, 91℃, 91.1℃, 91.2℃, 91. 3℃, 91.4℃, 91.5℃, 91.6℃, 91.7℃, 91.8℃, 91.9℃, 92℃, 92.1℃, 92.2℃, 92.3℃, 92.4℃, 92.5℃, 92.6℃, 92.7℃, 92.8℃, 92.9℃, 93℃, 93.1℃, 93.2℃, 93.3℃, ​​93.4℃, 93.5℃, 93.6℃, ​​93.7℃, 93.8℃, 93.9℃, 94℃, 94.1℃, 94.2℃, 94.3℃, 94.4℃, 94.5℃, 94.6℃, 94.7℃, 94.8℃, 94.9℃, 95℃, 95.1℃, 95.2℃、95.3℃、95.4℃、95.5℃、95.6℃、95.7℃、95.8℃、95.9℃、96℃、96.1℃、96.2℃、96.3℃、96.4℃、96.5℃、96.6℃、96.7℃、96.8℃、96.9℃、97℃、97.1℃、97.2℃、97.3℃ , 97.4℃, 97.5℃, 97.6℃, 97.7℃, 97.8℃, 97.9℃, 98℃, 98.1℃, 98.2℃, 98.3℃, 98.4℃, 98.5℃, 98.6℃, 98.7℃, 98.8℃, 98.9℃, 99℃, 99.1℃, 99.2℃, 99.3℃, 99.4℃, 99 Incubate the one or more RNA molecules in a bisulfite solution at a temperature of 99.5° C., 99.6° C., 99.7° C., 99.8° C. or 99.9° C. (or any range or value derivable therein) for up to or about 15 minutes, 14.9 minutes, 14.8 minutes, 14.7 minutes, 14.6 minutes, 14.5 minutes, 14.4 minutes, 14.3 minutes, 14.2 minutes, 14.1 minutes, 14 minutes, 13.9 minutes, 13.8 minutes, 13.7 minutes, 13.6 minutes, 13.5 minutes, 13.4 minutes, 13.3 minutes, 13.2 minutes, 13.1 minutes, 13 minutes, 12.9 minutes, 12.8 minutes, 12.7 minutes, 12.6 minutes, 12.5 minutes minutes, 12.4 minutes, 12.3 minutes, 12.2 minutes, 12.1 minutes, 12 minutes, 11.9 minutes, 11.8 minutes, 11.7 minutes, 11.6 minutes, 11.5 minutes, 11.4 minutes, 11.3 minutes, 11.2 minutes, 11.1 minutes, 11 minutes, 10.9 minutes, 10.8 minutes, 10.7 minutes, 10.6 minutes, 10.5 minutes, 10.4 minutes, 10.3 minutes, 10.2 minutes, 10.1 minutes, 10 minutes, 9.9 minutes, 9.8 minutes, 9.7 minutes, 9.6 minutes, 9.5 minutes, 9.4 minutes, 9.3 minutes, 9.2 minutes, 9.1 minutes, 9 minutes, 8.9 minutes, 8.8 minutes, 8.7 minutes, 8. 6 minutes, 8.5 minutes, 8.4 minutes, 8.3 minutes, 8.2 minutes, 8.1 minutes, 8 minutes, 7.9 minutes, 7.8 minutes, 7.7 minutes, 7.6 minutes, 7.5 minutes, 7.4 minutes, 7.3 minutes, 7.2 minutes, 7.1 minutes, 7 minutes, 6.9 minutes, 6.8 minutes, 6.7 minutes, 6.6 minutes, 6.5 minutes, 6.4 minutes, 6.3 minutes, 6.2 minutes, 6.1 minutes, 6 minutes, 5.9 minutes, 5.8 minutes, 5.7 minutes, 5.6 minutes, 5.5 minutes, 5.4 minutes, 5.3 minutes, 5.2 minutes, 5.1 minutes, 5 minutes, 4.9 minutes, 4.8 minutes, 4.7 minutes, 4.6 minutes, 4.5 minutes, 4.4 minutes, 4.3 minutes, 4.2 minutes, 4.1 minutes, 4 minutes, 3.9 minutes, 3.8 minutes, 3.7 minutes, 3.6 minutes, 3.5 minutes, 3.4 minutes, 3.3 minutes, 3.2 minutes, 3.1 minutes, 3 minutes, 2.9 minutes, 2.8 minutes, 2.7 minutes, 2.6 minutes, 2.5 minutes, 2.4 minutes, 2.3 minutes, 2.2 minutes, 2.1 minutes, 2 minutes, 1.9 minutes, 1.8 minutes, 1.7 minutes, 1.6 minutes, 1.5 minutes, 1.4 minutes, 1.3 minutes, 1.2 minutes, 1.1 minutes or 1 minute (or any range or value derivable therein). Any combination of the foregoing incubation times and temperatures can be used in the RNA treatment methods of the present disclosure. .

[0096] In some aspects, the RNA treatment method comprises incubating one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 95° C. for up to 12 minutes, incubating one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 96° C. for up to 12 minutes, incubating one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 12 minutes, incubating one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 98° C. for up to 12 minutes, incubating one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 99° C. for up to 12 minutes, ...5° C. for up to 12 minutes, incubating one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 96° C. for up to 12 minutes, incubating one or more RNA molecules in a bisulfite solution of the invention at a temperature of Incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 96° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 97° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 98° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 99° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 95° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 96° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 97° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 98° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 99° C., incubate one or more RNA molecules in a bisulfite solution of the invention for up to 11 minutes at a temperature of at least 95° C. Incubate one or more RNA molecules in a bisulfite solution of the present invention for up to 10 minutes at a temperature of at least 96° C., incubate one or more RNA molecules in a bisulfite solution of the present invention for up to 10 minutes at a temperature of at least 97° C., incubate one or more RNA molecules in a bisulfite solution of the present invention for up to 10 minutes at a temperature of at least 98° C., incubate one or more RNA molecules in a bisulfite solution of the present invention for up to 10 minutes at a temperature of at least 99° C., incubate one or more RNA molecules in a bisulfite solution of the present invention for up to 10 minutes at a temperature of at least 95° C., incubate one or more RNA molecules in a bisulfite solution of the present invention for up to 9 minutes at a temperature of at least 96° C. incubate one or more RNA molecules in a bisulfite solution of the invention for up to 9 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 9 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 98° C. for up to 9 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 99° C. for up to 9 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 95° C. for up to 8 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 96° C. for up to 8 minutes,Incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 8 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 98° C. for up to 8 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 99° C. for up to 8 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 95° C. for up to 7 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 96° C. for up to 7 minutes, in ...6° C. for up to 7 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 7 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 7 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 7 minutes, incubate one or more RNA Incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97° C. for up to 7 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 98° C. for up to 7 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 99° C. for up to 7 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 95° C. for up to 6 minutes, Incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 96°C for up to 6 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 97°C for up to 6 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 98°C for up to 6 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 99°C for up to 6 minutes, incubate one or more RNA molecules in a bisulfite solution of the invention at a temperature of at least 95°C for up to 6 minutes, Incubate one or more RNA molecules in a bisulfite solution of the invention for up to 5 minutes at a temperature of at least 96°C for up to 5 minutes at a temperature of at least 97°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for up to 5 minutes at a temperature of at least 98°C for up to 5 minutes at a temperature of at least 99°C for at least 5 minutes at a temperature of at least 99°C for at least 5 minutes at a temperature of at least 97°C for up to 5 minutes at a temperature of at least 97°C for at least ...

[0097] As disclosed herein, incubation of RNA molecules with a bisulfite solution of the present disclosure (e.g., a solution comprising ammonium bisulfite and ammonium sulfite, which does not comprise sodium bisulfite, or added sodium bisulfite) under appropriate conditions (e.g., at a temperature of at least 95° C. for up to 12 minutes) is sufficient to deaminate most cytosine residues in the RNA molecules. In some aspects, after incubation of RNA molecules with a bisulfite solution of the present disclosure under appropriate conditions, more than 90% of the RNA molecules do not comprise cytosine residues. In some aspects, more than 90%, 90.1%, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, 91%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92%, 92.1%, 92.2%, 92.3%, 92.4%, 92.6%, 92.7%, 92.8%, 92.9 ...9%, 92.9%, 92.1%, 92.2%, 92.3%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 92.9%, 92.1%, 92.2%, 92.3%, 92.5%, 92.9%, 92.9%, 92.1%, 92.2%, 92.3%, 92.6%, 92.8%, 92.9%, 92.9%, 92.1%, 92.2%, 92.3%, 92.9%, 92.9%, 92. .5%, 92.6%, 92.7%, 92.8%, 92.9%, 93%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95%, 95.1%, 9 5.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97. In some aspects, more than 99% of the RNA molecules do not contain cytosine residues.

[0098] The RNA processing methods of the invention can be used, for example, to prepare RNA molecules for sequencing, to detect, quantify and / or analyze RNA cytosine methylation.

[0099] III. 5hmC analysis method

[0100] Aspects of the present disclosure relate to compositions and methods for detecting, quantifying, and analyzing 5-hydroxymethylcytosine (5hmC) in DNA. As described herein, the disclosed DNA processing methods can be used for the rapid deamination of cytosine and for the rapid spontaneous conversion of 5hmC to cytosine methylene sulfonate (CMS). APOBEC3A is reported to be active for C and 5mC. 28 It has high deamination reactivity. Therefore, in some aspects, disclosed herein is a method for 5hmC analysis, including incubating DNA molecules in a bisulfite solution of the present disclosure (e.g., a solution containing ammonium bisulfite, such as 50% to 70% ammonium bisulfite, without sodium bisulfite or added sodium bisulfite) under sufficient conditions (e.g., at a temperature of at least 95°C for up to 12 minutes), and then placing the DNA molecules under alkaline conditions, thereby converting C to U and 5hmC to CMS. Thereafter, in some cases, a portion of the DNA molecules is treated with an APOBEC deaminase (e.g., APOBEC3A under appropriate conditions, such as those disclosed in Schutsky, E., DeNizio et al., Nat Biotechnol 36, 1083-1090 (2018), which are incorporated herein by reference in their entirety), thereby converting 5mC to U. Thereafter, all DNA molecules are sequenced and the sequences are aligned to identify 5hmC residues on the original DNA molecules. Fig.37 A schematic diagram of an embodiment of the 5hmC analysis method of the present disclosure is provided in FIG.

[0101] IV. General Analytical Methods

[0102] A. Detection and Analysis of Methylated Nucleic Acids

[0103] Aspects of the methods include assaying nucleic acids to determine expression levels and / or methylation levels of nucleic acids (eg, DNA, RNA). Certain exemplary methods for detecting and analyzing nucleic acid methylation are described herein.

[0104] In some aspects, the method provided herein is convenient to use low and / or ultra-low DNA input amount to generate a sequencing library processed through BS. In some aspects, the method provided herein is convenient to use low and / or ultra-low RNA input amount to generate a sequencing library processed through BS. In some aspects, the method provided herein reduces the background level in the analysis comprising the low and / or ultra-low DNA input amount processed relative to traditional BS. In some aspects, the method provided herein reduces the background level in the analysis comprising the low and / or ultra-low RNA input amount processed relative to traditional BS. In some aspects, the methods provided herein reduce the false positive rate by about or equal to about 0.1 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, 0.6 times, 0.7 times, 0.8 times, 0.9 times, 1 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 21 times, 22 times, 23 times, 24 times, 25 times, 26 times, 27 times, 28 times, 29 times, 30 times, 31 times, 32 times, 33 times, 34 times, 35 times, 36 times, 37 times, 38 times, 39 times, 40 times, 41 times, 42 times, 43 times, 44 times, 45 times, 46 times, 47 times, 48 ​​times, 49 times, 50 times, 51 times, 52 times, 53 times, 54 times, 55 times, 56 times, 57 times, 58 times, 59 times, 60 times, 61 times, 62 times, 63 times, 64 times, 65 times, 66 times, 67 times, 68 times, 69 times, 70 times, 71 times, 72 times, 73 times, 74 times, 75 times, 76 times, 77 times, 78 times, 79 times, 80 times, 81 times, 82 times, 83 times, 84 times, , 44 times, 45 times, 46 times, 47 times, 48 ​​times, 49 times, 50 times, 51 times, 52 times, 53 times, 54 times, 55 times, 56 times, 57 times, 58 times, 59 times, 60 times, 61 times, 62 times, 63 times, 64 times, 65 times, 66 times, 67 times, 68 times, 69 times, 70 times, 71 times, 72 times, 73 times, 74 times, 75 times, 76 times, 77 times, 78 times, 79 times, 80 times, 81 times, 82 times, 83 times, 84 times, 85 times, 86 times, 87 times, 88 times, 89 times, 90 times, 91 times, 92 times, 93 times, 94 times, 95 times, 96 times, 97 times, 98 times, 99 times, or 100 times, or any range derivable therein.In some aspects, the methods provided herein increase the true positive detection rate by greater than or equal to about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110 %, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% or any range derivable therein.

[0105] In some aspects, the methods provided herein reduce the ratio of unconverted C in high GC% regions relative to traditional BS treatments. In some aspects, the methods provided herein reduce the ratio of unconverted C in high GC% regions by greater than or equal to about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41% when compared to conventional BS processing. , 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72% , 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% or any range derivable therein.

[0106] 1.HPLC-UV

[0107] The HPLC-UV (high performance liquid chromatography-ultraviolet) technique developed by Kuo and colleagues in 1980 (described in Kuo KC et al., Nucleic Acids Res. 1980; 8: 4763-4776, which is incorporated herein by reference) can be used to quantify the amount of deoxycytidine (dC) and methylated cytosine (5mC) present in a hydrolyzed DNA sample. The method involves hydrolyzing the DNA into its constituent nucleobases, separating the 5mC and dC bases by chromatography, and then measuring the fraction. The 5mC / dC ratio can then be calculated for each sample, and a comparison can be made between experimental and control samples.

[0108] 2.LC-MS / MS

[0109] Liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS) is a highly sensitive HPLC-UV detection method that requires smaller amounts of hydrolyzed DNA sample. In mammalian DNA, approximately 2% to 5% of all cytosine residues are methylated, and LC-MS / MS has been validated to detect methylation levels of 0.05% to 10%, and it can confidently detect differences between samples as small as about 0.25% of total cytosine residues, corresponding to about a 5% difference in genome-wide DNA methylation. The procedure typically requires 50ng to 100ng of DNA sample, although smaller amounts (as low as 5ng) of DNA have been successfully analyzed.

[0110] 3. ELISA-based method

[0111] There are several commercially available kits, all based on enzyme-linked immunosorbent assay (ELISA), that can rapidly assess DNA methylation status. These assays include the Whole Genome DNA Methylation ELISA, available from Cell Biolabs; the Imprint Methylated DNA Quantitation Kit (Sandwich ELISA), available from Sigma-Aldrich; the EpiSeeker Methylated DNA Quantitation Kit, available from abcam; Whole Genome DNA Methylation Assay—LINE-1, available from Actie Motif; the 5-mC DNA ELISA Kit, available from Zymo Research; the MethylFlash Methylated DNA 5-mC Quantitation Kit and the MethylFlash Methylated DNA 5-mC Quantitation Kit, available from Epigentek.

[0112] Briefly, DNA samples are captured onto ELISA plates, and methylated cytosines are detected by sequential incubation steps with: (1) primary antibody raised against 5Mc; (2) labeled secondary antibody; and (3) colorimetric / fluorescent detection reagents.

[0113] Genome-wide DNA Methylation Analysis - LINE-1 specifically determines the methylation levels of LINE-1 (long interspersed nuclear element-1) retrotransposons, which make up approximately 17% of the human genome. These are recognized as surrogates for genome-wide DNA methylation. Briefly, fragmented DNA is hybridized with a biotinylated LINE-1 probe, which is then immobilized on a streptavidin-coated plate. Following wash and blocking steps, methylated cytosines are quantified using an anti-5mC antibody, an HRP-conjugated secondary antibody, and a chemiluminescent detection reagent. Samples are quantified against a standard curve generated from standards with known LINE-1 methylation levels.

[0114] 4. LINE-1 pyrosequencing

[0115] LINE-1 methylation levels can also be assessed by another method that involves bisulfite conversion of DNA, followed by PCR amplification of LINE-1 conserved sequences. The methylation status of the amplified fragments is then quantified by pyrosequencing, which is able to resolve differences as small as about 5% between DNA samples. Although this technique assesses LINE-1 elements and therefore has relatively few CpG sites, this has been shown to be a good reflection of changes in DNA methylation across the genome. This method is particularly suitable for high-throughput analysis of cancer samples, where hypomethylation is often associated with a poor prognosis. This method works particularly well with human DNA, but versions are also available for rat and mouse genomes.

[0116] 5.AFLP and RFLP

[0117] The detection of differentially methylated fragments can be achieved by conventional PCR-based amplified fragment length polymorphism (AFLP), restriction fragment length polymorphism (RFLP), or a combination of the two.

[0118] 6.LUMA

[0119] The LUMA (Luminescent Methylation Detection) technique utilizes a combination of two DNA restriction digest reactions performed in parallel and a subsequent pyrosequencing reaction to fill in the overhanging ends of the digested DNA strands. One digestion reaction is performed with the CpG methylation-sensitive enzyme HpaII; while the parallel reaction uses the methylation-insensitive enzyme MspI, which will cut at all CCGG sites. The enzyme EcoRI is included in both reactions as an internal control. Both MspI and HpaII generate 5′-CG single-stranded overhangs after DNA cleavage, while EcoRI generates 5′-AATT single-stranded overhangs, which are then filled in with a subsequent pyrosequencing-based extension analysis. Basically, the measured light signal is calculated as the ratio of HpaII / MspI is proportional to the amount of unmethylated DNA present in the sample. Since the sequence of nucleotides added in the pyrosequencing reaction is known, the specificity of the method is very high and the variability is very low, which is very important for detecting small changes in methylation throughout the genome. LUMA requires only a relatively small amount of DNA (250ng to 500ng), has little variability, and has the advantage of an internal control that can account for the variability of the DNA input amount.

[0120] 7. Bisulfite Sequencing

[0121] DNA bisulfite treatment mediates the deamination of cytosine into uracil, and as determined by PCR amplification and subsequent Sanger sequencing analysis, these converted residues will be read as thymine. However, 5-methylcytosine (5mC) residues are resistant to this conversion and are therefore still read as cytosine. Therefore, the Sanger sequencing sequencing fragments of untreated DNA samples are compared with the same samples treated with bisulfite, and methylated cytosine can be detected. With the advent of second generation sequencing (NGS) technology, this method can be extended to DNA methylation analysis of the entire genome. In order to ensure the complete conversion of non-methylated cytosine, a control for bisulfite reaction can be added.

[0122] Whole-genome bisulfite sequencing (WGBS) is similar to whole-genome sequencing, except for the additional bisulfite conversion step. Sequencing the 5mC-enriched portion of the genome is not only a less expensive approach, but also increases the sequencing coverage, thereby increasing the accuracy of revealing differentially methylated regions. Sequencing can be done using any existing NGS platform; Illumina TM and Life Technologies TM Kits for such analysis are provided.

[0123] Bisulfite sequencing methods include Reduced Representation Bisulfite Sequencing (RRBS), in which only a portion of the genome is sequenced. In RRBS, enrichment of CpG-rich regions is achieved by separating short fragments that recognize CCGG sites after MspI digestion (and it cuts both methylated and non-methylated sites). It ensures the separation of about 85% of CpG islands in the human genome. Then, the same bisulfite conversion and library preparation as WGBS are performed. The RRBS procedure typically requires about 100ng to 1μg of DNA.

[0124] 8. Method without bisulfite conversion

[0125] In some aspects, direct detection of modified bases that have not been converted by bisulfite can be used to detect methylation. Pacific Biosciences has developed a method for directly detecting methylated bases by monitoring the kinetics of polymerases during single-molecule sequencing, and provides commercial products for such sequencing (further described in Flusberg B.A. et al., Nat. Methods. 2010; 7: 461-465, which are incorporated herein by reference). Other methods include nanopore-based single-molecule real-time sequencing technology (SMRT), which can directly detect modified bases (described in Laszlo AH et al., Proc. Natl. Acad. Sci. USA. 2013 and Schreiber J. et al., Proc. Natl. Acad. Sci. USA. 2013, which are incorporated herein by reference).

[0126] 9. Array or Bead Hybridization

[0127] Methylated DNA fragments of the genome, usually obtained by immunoprecipitation, can be used for hybridization to a microarray. Currently available examples of such arrays include: Human CpG Island Microarray Kit GeneChip Human Promoter 1.0R Array and GeneChip Human Tiling 2.0R Array Set

[0128] Finding differentially methylated regions using bisulfite converted DNA can be done using different techniques. Some of these are easier to perform and analyze than others because only a portion of the genome is used. The most significant functional effects of DNA methylation occur in gene promoter regions, enhancer regulatory elements, and 3' untranslated regions (3'UTRs). Assays focused on these specific regions can be used, such as the Illumina TM Infinium HumanMethylation450 microbead chip array. This array can be used to detect the methylation status of genes, including miRNA promoters, 5'UTR, 3'UTR, coding regions (about 17 CpGs per gene) and island shores (about 2kb upstream of the CpG island).

[0129] Briefly, bisulfite-treated genomic DNA is mixed with analytical oligonucleotides, one of which is complementary to uracil (converted from the original unmethylated cytosine) and the other is complementary to the cytosine at the methylated (and therefore protected from conversion) site. After hybridization, the primers are extended and attached to locus-specific oligonucleotides to generate a template for universal PCR. Finally, labeled PCR primers are used to generate detectable products immobilized on barcoded microbeads, and the signal is measured. The ratio between the two microbeads for each locus (single CpG) is an indicator of its methylation level.

[0130] Kits are available for purchase that perform validation studies using methylation-specific primer extension. TM VeraCode methylation analysis uses The assay analyzes 96 or 384 user-specified CpG loci. Unlike BeadChip assays, VeraCode assays require The reader scans.

[0131] 10. Methyl-sensitive cleavage counting: endonuclease digestion followed by sequencing

[0132] As an alternative to sequencing large amounts of methylated (or unmethylated) DNA, one can generate fragments from these regions and map them back to the genome after sequencing. In addition, the coverage of NGS may be sufficient to quantify methylation levels at specific loci. The serial analysis of gene expression (SAGE) technique has been adapted for this purpose and is known as methylation-specific digital karyotyping, as well as a similar technique known as methylation-sensitive cleavage counting (MSCC).

[0133] In summary, in all these methods, a methylation-sensitive nuclease, such as HpaII, is used for the initial digestion of genomic DNA at unmethylated sites, followed by an adapter ligation that ligates sites containing another digestive enzyme that is cut outside its recognition site, such as EcoP15I or MmeI. By these means, small fragments located near the original HpaII site are generated. Then, NGS and genome mapping are performed. The reads of each HpaII site are associated with its methylation level.

[0134] Recently, many restriction enzymes (methylation-dependent endonucleases) using methylated DNA as substrates have been found. These include, for example, BisI, BlsI, GlaI, GluI, KroI, MteI, PcsI, PkrI. The unique ability of these enzymes to cut only methylated sites has been used to achieve the method for selective amplification of methylated DNA. Three methylation-dependent endonucleases (FspEI, MspJI and LpnPI) available from New England Biolabs are IIS-type enzymes that cut outside the recognition site, so it is possible to produce 32bp fragments around the recognition site containing the complete methylation of CpG. These short fragments can be sequences and compared with the reference genome. The reading of each specific 32bp fragment can be used as an indicator of its methylation level. Similarly, short fragments can be produced from methylated CpG islands using the methyl-specific endonuclease McrBC of Escherichia coli, and McrBC cuts DNA between the half sites of two (G / A) mCs 50bp to 3000bp apart from each other.

[0135] B. Sequencing

[0136] 1. DNA Sequencing

[0137] In some aspects, DNA can be analyzed by sequencing. DNA for sequencing can be prepared by any method known in the art, such as library preparation, hybrid capture, sample quality control, library preparation based on connection using product, or a combination thereof. DNA can be prepared for any sequencing technology. . In some aspects, a unique genetic read of each sample can be generated by genotyping one or more highly polymorphic SNPs. In some aspects, sequencing can be performed, such as base pairs and / or double-end sequencing, to cover about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or a target oligonucleotide with a percentage higher than 99%, or a coverage greater than 20×, 25×, 30×, 35×, 40×, 45×, 50× or greater than 50× (or any range derivable therein). In certain aspects, mutations, SNPs, INDELs, copy number alterations (somatic and / or germline), or other genetic differences can be determined from sequencing using at least one bioinformatics tool, including but not limited to VarScan2, any R package (including CopywriteR), and / or Annovar.

[0138] 2. RNA Sequencing

[0139] In some aspects, RNA can be analyzed by sequencing. RNA for sequencing can be prepared by any method known in the art, such as but not limited to poly-A selection, cDNA synthesis, chain or non-chain library preparation or its combination. RNA can be prepared for any type of RNA sequencing technology, including chain-specific RNA sequencing. In some aspects, sequencing can be performed to produce about 10M, 15M, 20M, 25M, 30M, 35M, 40M or more than 40M sequencing fragments, including paired sequencing fragments. In some aspects, sequencing can be performed to produce about 50bp, 55bp, 60bp, 65bp, 70bp, 75bp, 80bp, 85bp, 90bp, 95bp, 100bp, 105bp, 110bp or a read length greater than 110bp (or any range that can be derived therein). In some aspects, raw sequencing data can be converted to estimated sequenced fragment counts (RSEM), fragments per kilobase of transcript per million mapped reads (FPKM), and / or reads per kilobase of transcript per million mapped reads (RPKM).

[0140] 3. Examples of Sequencing Methods

[0141] DNA (including bisulfite-converted DNA) and / or RNA (including bisulfite-converted RNA) can be used to amplify one or more regions of interest and then sequenced. Therefore, aspects of the present disclosure can include sequencing nucleic acids to detect and / or quantify methylation of nucleic acid biomarkers. In some aspects, the methods of the present disclosure include sequencing methods. Sequencing can be removed from certain methods of the present disclosure. Examples of sequencing methods include, but are not limited to, those described below.

[0142] a. Massively parallel tag sequencing (MPSS).

[0143] In the 1990s, Lynx Therapeutics developed the first next-generation sequencing technology, massively parallel tag sequencing (or MPSS). MPSS is a bead-based method that uses a complex method of adapter ligation followed by adapter decoding to read sequences in increments of 4 nucleotides. This approach makes it susceptible to sequence-specific bias or loss of specific sequences.

[0144] b.Polony sequencing.

[0145] The Polony sequencing method was developed by George M. Church's laboratory at Harvard University and is one of the first second-generation sequencing systems, and was used for whole-genome sequencing in 2005. This method combines in vitro paired-tag libraries with emulsion PCR, automated microscopy, and ligation-based sequencing chemistry to sequence the Escherichia coli genome with an accuracy of >99.9999% and a cost of about 1 / 9 of Sanger sequencing.

[0146] c.454 pyrosequencing TM .

[0147] 454Life Sciences TM developed a parallel version of pyrosequencing, and the company was acquired by Roche Diagnostics TM Acquisition. The method amplifies DNA in water droplets in an oil solution (emulsion PCR), each of which contains a single DNA template attached to a single primer-coated microbead, which then forms clonal colonies. The sequencer contains many picoliter-volume wells, each containing a single microbead and sequencing enzyme. Pyrosequencing uses luciferase to produce light to detect individual nucleotides incorporated into nascent DNA, and the combined data is used to generate a sequence read. With Sanger sequencing on one end and Solexa and SOLiD on the other TM In comparison, the technology offers moderate read lengths and single-base prices.

[0148] d. Illumina TM (Solexa) sequencing.

[0149] Solexa developed sequencing methods based on reversible dye terminator technology and engineered polymerases. The termination chemistry was developed in-house by Solexa, and the concept of the Solexa system was invented by Balasubramanian and Klennerman at the Department of Chemistry at Cambridge University. In 2004, Solexa acquired Manteia Predictive Medicine to gain access to a massively parallel sequencing technology based on "DNA clusters," which involves clonal amplification of surface DNA. The cluster technology was acquired in conjunction with Lynx Therapeutics of California. Solexa Ltd. later merged with Lynx to form Solexa Inc.

[0150] In this method, DNA molecules and primers are first attached to a glass slide and amplified with a polymerase, resulting in the formation of localized clonal DNA colonies, later called "DNA clusters". To determine the sequence, four types of reversible terminator bases (RT-bases) are added and unincorporated nucleotides are washed away. A camera captures an image of the fluorescently labeled nucleotides, and then the dye is chemically removed from the DNA along with the terminal 3' blocker to allow the next cycle to begin. Unlike pyrosequencing, the DNA chain is extended one nucleotide at a time, and image acquisition can be performed at a delayed moment, allowing very large arrays of DNA colonies to be captured from a single camera-taken sequential image.

[0151] The separation of enzymatic reaction and image capture allows for optimal throughput and theoretically unlimited sequencing capacity. In the case of optimal configuration, the ultimate achievable instrument throughput is therefore determined only by the analog-to-digital conversion rate of the cameras, multiplied by the number of cameras and divided by the number of pixels per DNA colony required to optimally visualize them (approximately 10 pixels / colony). In 2012, with cameras running at A / D conversion rates exceeding 10 MHz, and available optics, fluidics, and enzymology, throughput can be multiples of 1 million nucleotides per second, roughly equivalent to covering the equivalent of one human genome at 1x per hour per instrument, and resequencing one human genome per day per instrument (equipped with a camera) (at approximately 30x).

[0152] e.SOLiD TM Sequencing.

[0153] SOLiD TM The technology performs sequencing by ligation. Here, a collection of all possible oligonucleotides of fixed length are labeled according to the sequencing position. The oligonucleotides are annealed and ligated; preferential ligation by DNA ligase for matching sequences results in more signal information for the nucleotide at that position. Before sequencing, the DNA is amplified by emulsion PCR. Each of the resulting microbeads contains a single copy of the same DNA molecule and is deposited on a glass slide. The result is a number and length of sequences comparable to those of Illumina TM Sequencing equivalent.

[0154] f.Ion Torrent TM Semiconductor sequencing.

[0155] Ion Torrent TMSystems Inc. has developed a system based on the use of standard sequencing chemistry, but with a novel, semiconductor-based detection system. Unlike the optical methods used in other sequencing systems, this sequencing method is based on the detection of hydrogen ions released during DNA polymerization. Microwells containing the template DNA strand to be sequenced are filled with a single type of nucleotide. If the incoming nucleotide is complementary to the leading template nucleotide, it is incorporated into the growing complementary strand. This results in the release of hydrogen ions, which triggers the ultrasensitive ion sensor, indicating that a reaction has occurred. If homopolymer repeats are present in the template sequence, multiple nucleotides will be incorporated into a single cycle. This results in a corresponding amount of released hydrogen and a proportionally higher electronic signal.

[0156] g.DNA Nanoballs TM Sequencing.

[0157] DNA Nanoballs TM Sequencing is a high-throughput sequencing technology used to determine the entire genome sequence of an organism. The company uses this technology to sequence samples submitted by independent researchers. The method uses rolling circle replication to amplify small fragments of genomic DNA into DNA nanoballs. The nucleotide sequence is then determined by ligated non-chain sequencing. Compared to other second-generation sequencing platforms, this DNA sequencing method allows a large number of DNA nanoballs to be sequenced per run, and the reagent cost is low. However, only short sequences of DNA can be determined from each DNA nanoball, which makes it difficult to map short sequences to a reference genome. This technology has been used in multiple genome sequencing projects.

[0158] h.Heliscope single molecule sequencing.

[0159] Heliscope sequencing is a single-molecule sequencing method developed by Helicos Biosciences. It uses DNA fragments with attached poly-A tail adapters that are attached to the surface of a flow cell. The next steps consist of extension-based sequencing with cycles of washing the flow cell with fluorescently labeled nucleotides (one nucleotide type at a time, like the Sanger method). Reads are performed by the Heliscope sequencer. Reads are short, up to 55 bases at a time, but recent improvements allow for more accurate reading of fragments of one type of nucleotide. The sequencing method and equipment were used to sequence the genome of the M13 bacteriophage.

[0160] i. Single molecule real-time (SMRT) sequencing.

[0161] SMRT sequencing is based on sequencing by synthesis. DNA is synthesized in zero-mode waveguides (ZMWs), which are small well-shaped containers with a capture tool at the bottom of the well. Sequencing is performed using an unmodified polymerase (attached to the bottom of the ZMW) and fluorescently labeled nucleotides that flow freely in solution. The wells are constructed in such a way that only the fluorescence that appears at the bottom of the well is detected. When the nucleotide is incorporated into the DNA strand, the fluorescent marker separates from the nucleotide, leaving behind the unmodified DNA strand. According to Pacific Biosciences, the developer of the SMRT technology, this method can detect nucleotide modifications (such as cytosine methylation). This is achieved by observing the polymerase kinetics. This method allows reading of 20,000 or more nucleotides with an average read length of 5 kilobases.

[0162] C. Other analytical methods

[0163] In some aspects, the method involves amplifying and / or sequencing one or more than one target genomic region using at least one pair of primers specific to the target genomic region. In some aspects, the primer is a heptamer. In some aspects, an enzyme such as a priming enzyme or a priming enzyme / polymerase combination enzyme is added to the amplification step to synthesize the primer.

[0164] In some respects, arrays can be used to detect nucleic acids of the present invention.Arrays include solid supports, wherein nucleic acid probes are attached to supports.Arrays typically include multiple different nucleic acid probes, which are bound to substrate surfaces at different known positions. These arrays, also referred to as "microarrays" or commonly known as "chips", have been generally described in the art, for example, U.S. Patent No. 5,143,854, No. 5,445,934, No. 5,744,305, No. 5,677,195, No. 6,040,193, No. 6,040,193 and Fodor et al. (1991), which are incorporated herein by reference in their entirety for all purposes. The technology of synthesizing these arrays using mechanical synthesis methods is described in, for example, U.S. Patent No. 5,384,261, which is incorporated herein by reference in its entirety for all purposes. Although planar array surfaces are used in some respects, arrays can be manufactured on surfaces of almost any shape or even on multiple surfaces. The array can be nucleic acids on beads, gels, polymer surfaces, fibers such as optical fibers, glass, or any other suitable substrate, see U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193, and 5,800,992, which are incorporated herein in their entireties for all purposes.

[0165] In addition to the use of arrays and microarrays, it is contemplated that many different analytical methods may be used to analyze nucleic acids. These assays include, but are not limited to, nucleic acid amplification, polymerase chain reaction, quantitative PCR, RT-PCR, in situ hybridization, digital PCR, ddPCR (droplet digital PCR), BEAMing (beads, emulsion, amplification and magnetic) (Inostics), ARMS (amplification of difficult mutations system), RNA-sequencing, TAM-Seg (tagged amplicon deep sequencing), PAP (pyrophosphate cleavage activated polymerization), second-generation RNA sequencing, Northern hybridization, hybridization protection assay (HPA) (GenProbe), branched DNA (bDNA) assay (Chiron), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies) and / or Bridge Litigation assay (Genaco).

[0166] Amplification primers or hybridization probes can be prepared to be complementary to genomic regions, biomarkers, probes or oligonucleotides as described herein. The term "primer" as used herein is intended to include any nucleic acid that can initiate the synthesis of nascent nucleic acids and / or pair with the single-stranded oligomers of the present disclosure or parts thereof in a template-dependent process. Typically, primers are oligonucleotides with a length of ten to twenty and / or thirty nucleic acids, but sequences longer than thirty nucleic acids can also be used. Primers can be provided in double-stranded and / or single-stranded form, although single-stranded form is preferred.

[0167] Use length is 13 and 100 Nucleotide, particularly length is 17 and 100 Nucleotide, or length is up to 1000 to 2000 bases or longer primers in some respects, allows to form both stable and selective double-stranded molecules.The molecule having complementary sequence on the continuous fragment of 20 bases in length can be used for increasing stability and / or the selectivity of the hybrid molecule obtained.People can design the nucleic acid molecules for hybridization, it has one or more than one 20 to 30 Nucleotide, or if desired even longer complementary sequence.This fragment can be easily prepared, for example, by chemical method directly synthesizing this fragment, or by introducing the sequence of selection into the recombinant vector for recombinant production.

[0168] In some aspects, each probe / primer comprises at least 15 nucleotides. For example, each probe may comprise at least or at most 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 400 or more than 400 nucleotides (or any range derivable therein). They may have these lengths and have a sequence identical or complementary to a gene described herein. In particular, each probe / primer has a relatively high sequence complexity and does not have any ambiguous residues (undefined "n" residues). The probe / primer can hybridize to the target gene, including its RNA transcript, under stringent or highly stringent conditions. It is contemplated that the probe or primer may have inosine or other design implementations that accommodate the recognition of more than one human sequence for a particular biomarker.

[0169] For applications requiring high selectivity, one generally needs to employ relatively very stringent conditions for hybridization. For example, relatively low salt and / or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at a temperature of about 50° C. to about 70° C. Such high stringency conditions tolerate little mismatching between the probe or primer and the template or target strand, and will be particularly suitable for isolating specific genes or detecting specific mRNA transcripts. It is generally believed that conditions can be made more stringent by adding increasing amounts of formamide.

[0170] In some aspects, quantitative RT-PCR (e.g., TaqMan TM , ABI, but not limited thereto) is used to detect and compare the level or abundance of nucleic acid in a sample. The concentration of the target DNA in the linear portion of the PCR process is proportional to the initial concentration of the target before the PCR begins. By determining the concentration of the PCR product of the target DNA in the PCR reaction that has completed the same number of cycles and is in its linear range, the relative concentration of the specific target sequence in the original DNA mixture can be determined. In the linear range portion of the PCR reaction, this direct ratio between the concentration of the PCR product and the relative abundance in the starting material is true. The final concentration of the target DNA in the platform portion of the curve is determined by the availability of reagents in the reaction mixture and is independent of the initial concentration of the target DNA. Therefore, when the PCR reaction is in the linear portion of its curve, the PCR product of the amplification can be sampled and quantified. In addition, the relative concentration of the amplifiable DNA can be normalized to some independent standards / controls, which can be based on the DNA species present internally or the DNA species introduced externally. The abundance of a specific DNA species can also be determined relative to the average abundance of all DNA species in the sample.

[0171] In some aspects, PCR amplification utilizes one or more than one internal PCR standard. The internal standard can be a housekeeping gene abundant in the cell, or it can be GAPDH, GUSB and beta-2 microglobulin. These standards can be used to normalize expression levels so that the expression levels of different gene products can be directly compared. Those skilled in the art know how to use internal standards to normalize expression levels.

[0172] An inherent problem in some samples is that they are variable in quantity and / or quality. This problem can be overcome if RT-PCR is performed as a relative quantitative RT-PCR with an internal standard, wherein the internal standard is an amplifiable DNA fragment that is similar to or larger than the target DNA fragment, and wherein the abundance of the DNA representing the internal standard is about 5-fold to 100-fold greater than the abundance of the DNA representing the target nucleic acid region.

[0173] In some aspects, relative quantitative RT-PCR uses an external standard scheme. Under this scheme, the PCR product is sampled in the linear portion of its amplification curve. For each target DNA fragment, the optimal PCR cycle number for sampling can be determined empirically. In addition, the nucleic acid separated from various samples can be normalized for the amplifiable DNA of the same concentration.

[0174] The nucleic acid array can contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250 or more than 250 different polynucleotide probes that can hybridize with different and / or identical biomarkers. Multiple probes of the same gene can be used on a single nucleic acid array. Probes for other disease genes can also be included in the nucleic acid array. The probe density on the array can be in any range. In some aspects, the density can be or can be at least 50 probes / cm 2 , 100 probes / cm 2 , 200 probes / cm 2 , 300 probes / cm 2 , 400 probes / cm 2 , 500 probes / cm 2 or more than 500 probes / cm 2 (or any range derivable therein).

[0175] Specifically contemplated are chip-based nucleic acid technologies, such as those described by Hacia et al. (1996) and Shoemaker et al. (1996). In short, these technologies include quantitative methods for analyzing large numbers of genes rapidly and accurately. By labeling genes with oligonucleotides or using fixed probe arrays, chip technology can be used to separate target molecules into high-density arrays and screen these molecules on the basis of hybridization (see also Pease et al., 1994; and Fodor et al., 1991). It is contemplated that this technology can be used in conjunction with diagnostic, prognostic, and therapeutic methods that assess the expression level of one or more than one cancer biomarker.

[0176] Certain aspects may involve the use of arrays or data generated from arrays. The data may be readily available. In addition, arrays may be prepared to generate data that can be used in correlation studies.

[0177] V. How to use

[0178] A. Identification of DNA methylation variants

[0179] The field of DNA methylation analysis has recently expanded with the identification of multiple cytosine variants. Traditional DNA methylation involves the transfer of a methyl group to the carbon 5 position of cytosine to produce 5-methylcytosine (5mC). However, studies have shown that the Tet family of cytosine oxygenases is involved in the oxidation of 5-methylcytosine to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC).

[0180] 5-Formylcytosine (5fC) is one of the DNA variants generated when the Tet enzyme acts on 5-hydroxymethylcytosine. Further oxidation of 5-formylcytosine by the Tet enzyme will lead to its conversion to 5-carboxylcytosine. It is believed that the oxidation of 5-methylcytosine through various DNA methylation variants represents a mechanism for DNA demethylation and that the demethylation pathway has functions during development and germ cell programming. 5-Formylcytosine is present in mouse embryonic stem (ES) cells and major mouse organs. This DNA modification is also present in the paternal pronucleus after fertilization, accompanied by the disappearance of 5-methylcytosine, indicating its involvement in the DNA demethylation process.

[0181] 5-Carboxycytosine (5caC) has been identified as a DNA methylation variant that is generated when the Tet enzyme oxidizes 5-hydroxymethylcytosine followed by 5-formylcytosine. It is believed that oxidation of 5-methylcytosine by various DNA methylation variants represents a mechanism for DNA demethylation and that the demethylation pathway has functions during development and germ cell programming. It has been proposed that thymine DNA glycosylase (TDG) excises 5caC from genomic DNA, returning the cytosine residue to its unmodified state. 5-Carboxycytosine has been identified in mouse embryonic (ES) stem cells. This DNA modification appears in the paternal pronucleus after fertilization, accompanied by the disappearance of 5-methylcytosine, further supporting that this variant is part of the DNA demethylation pathway.

[0182] 5-Methylcytosine (5mC) is a DNA modification resulting from the transfer of a methyl group from S-adenosylmethionine (also known as AdoMet or SAM) to the carbon 5 position of a cytosine residue. This transfer is catalyzed by DNA methyltransferases. 5-Methylcytosine is the most common and most extensively studied form of DNA methylation. It typically occurs within CpG dinucleotide motifs, although non-CpG methylation has been found in embryonic stem cells.

[0183] 5-Hydroxymethylcytosine (5hmC) is a DNA methylation modification that results from the enzymatic oxidation of 5-methylcytosine (5mC) by the iron-dependent Tet family of deoxygenases3. 5-Hydroxymethylcytosine can be found at elevated levels in certain mammalian tissues, such as mouse Purkinje cells and granule neurons. Alternatively, 5hmC can be generated by the addition of formaldehyde to DNA cytosine by DNMT proteins.

[0184] Other methods for distinguishing epigenetic modifications have been provided. It is expected that the current method can be applied and combined with other methods disclosed in the art. Examples of methods disclosed in the prior art include U.S. Patent No. 8,741,567, U.S. Patent No. 9,611,510, PCT Application Publication No. WO201416577, U.S. Patent No. 11,130,991 and U.S. Patent Application Publication No. 2021 / 0310062, each of which is incorporated herein by reference in its entirety. In some aspects, the current method may include or not include the steps described in the patents and patent application disclosures cited above.

[0185] B. Clinical and Diagnostic Applications

[0186] Methods disclosed herein can be used to assess DNA and / or RNA for clinical and / or diagnostic purposes. Some aspects relate to methods for assessing DNA. Some aspects relate to methods for assessing RNA. Some aspects relate to methods for assessing samples comprising DNA molecules and / or RNA molecules. Assessment can be detection or determination of specific cytosine modifications, or detection or determination of specific modified differences.

[0187] The sample can be from biopsy, such as fine needle aspiration, needle biopsy, vacuum-assisted biopsy, incisional biopsy, excisional biopsy, punch biopsy, scraping biopsy or skin biopsy. In some aspects, the sample is obtained from the biopsy of cancerous tissue by any biopsy method mentioned above. In some aspects, the sample can be obtained from any tissue provided herein, including but not limited to gallbladder, skin, heart, lung, breast, pancreas, liver, muscle, kidney, smooth muscle, bladder, colon, intestine, brain, prostate, esophagus or thyroid tissue. Or, the sample can be obtained from any other source, including but not limited to blood, sweat, hair follicle, oral tissue, tears, menstruation, feces or saliva. In some aspects, the sample is obtained from cystic fluid or the fluid derived from tumor or vegetation. In some aspects, cyst, tumor or vegetation is colorectal. In some aspects of the current method, any medical professional, such as doctor, nurse or medical technician, can obtain the biological sample for testing. In addition, the biological sample can be obtained without the help of medical professional.

[0188] The sample may include, but is not limited to, tissues, cells, or biological materials from or derived from the subject's cells. In some aspects, the sample comprises cell-free DNA. In some aspects, the sample comprises a fertilized egg, a fertilized egg, a blastocyst, or a blastomere. The biological sample may be a heterogeneous or homogeneous cell or tissue population. Biological samples may be obtained using any method known in the art, which may provide samples suitable for the analytical methods described herein. The sample may be obtained by non-invasive methods, including but not limited to: scraping the skin or cervix, wiping the cheek, collecting saliva, collecting urine, collecting feces, collecting menstruation, tears, or semen.

[0189] In some aspects, the method of the present disclosure can be used to discover new biomarkers for a disease or condition. In some aspects, the method of the present disclosure can be performed on a sample from a patient to provide a prognosis for a patient-specific disease or condition. In some aspects, the method of the present disclosure can be performed on a sample from a patient to predict the patient's response to a specific treatment. In some aspects, the disease includes cancer. For example, the cancer can be pancreatic cancer, colon cancer, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, cerebellar or brain basal cell carcinoma in children, bile duct cancer, extrahepatic bladder cancer, bone cancer, osteosarcoma / malignant fibrous histiocytoma, brain stem glioma, brain tumor, cerebellar astrocytoma brain tumor, cerebral astrocytoma / malignant glioma brain tumor, ependymoma brain tumor, medulloblastoma brain tumor, supratentorial primitive neuroectodermal tumor brain tumor, visual pathway and hypothalamic glioma, breast cancer, lymphoma, bronchial adenoma / carcinoid, tracheal cancer, Burkitt's lymphoma, carcinoid, childhood carcinoid, non Primary gastrointestinal cancer, central nervous system lymphoma, primary cerebellar astrocytoma, childhood brain astrocytoma / malignant glioma, childhood cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disease, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, childhood extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid, gastrointestinal stromal tumor (GIST), germ cell tumor: extracranial, extragonadal or ovarian, gestational trophoblastic tumor, brain stem glioma , Glioma, Childhood Brain Astrocytoma, Childhood Visual Pathway and Hypothalamic Glioma, Gastric Carcinoid, Hairy Cell Leukemia, Head and Neck Cancer, Heart Cancer, Hepatocellular (Liver) Cancer, Hodgkin Lymphoma, Hypopharyngeal Cancer, Hypothalamic and Visual Pathway Glioma, Childhood Intraocular Melanoma, Islet Cell Carcinoma (Endocrine Pancreas), Kaposi's Sarcoma, Kidney Cancer (Renal Cell Carcinoma), Laryngeal Cancer, Leukemia, Acute Lymphoblastic (Also Known as Acute Lymphocytic Leukemia) Leukemia, Acute Myeloid (Also Known as Acute Myeloid Leukemia) Leukemia, Chronic Lymphocytic (Also Known as Chronic Lymphocytic Leukemia) Leukemia, Chronic Myeloid (Also Known as Chronic Myeloid Leukemia) Leukemia, Hairy Cell Lip and Mouth Cavity cancer, liposarcoma, liver cancer (primary), non-small cell lung cancer, small cell lung cancer, lymphoma, AIDS-related lymphoma, Burkitt's lymphoma, cutaneous T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's (old classification of all lymphomas except Hodgkin's disease) lymphoma, primary central nervous system lymphoma, Waldenstrom's macroglobulinemia, malignant fibrous histiocytoma of bone / osteosarcoma, childhood medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell carcinoma, malignant mesothelioma in adults, childhood mesothelioma, metastatic squamous neck cancer, oral cancer, multiple endocrine neoplasia syndrome, multiple myeloma / plasmacytoma, mycosis fungoides,Myelodysplastic syndrome, myelodysplastic / myeloproliferative disease, chronic myeloid leukemia, acute myeloid leukemia in adults, acute myeloid leukemia in children, multiple myeloma, chronic myeloproliferative disease, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma / malignant, fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer (surface epithelial stromal tumor), ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, islet cell sinus and nasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumor, pineoblastoma and supratentorial primitive neuroectodermal tumor, childhood pituitary adenoma, plasma cell tumor / multiple myeloma, pleuropulmonary blastoma, primary central nervous system Systemic lymphoma, prostate cancer, colorectal cancer, renal cell carcinoma (kidney cancer), transitional cell carcinoma of the renal pelvis and ureter, retinoblastoma, rhabdomyosarcoma, childhood salivary gland carcinosarcoma, Ewing family tumors, Kaposi sarcoma, soft tissue sarcoma, uterine Sezary syndrome sarcoma, skin cancer (non-melanoma), skin cancer (melanoma), skin cancer, Merkel cell small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell carcinoma of the neck with occult primary, metastatic gastric cancer, supratentorial primitive neuroectodermal tumor, childhood T-cell lymphoma, testicular cancer, laryngeal cancer, thymoma, childhood thymoma, thymic carcinoma, thyroid cancer, urethral cancer, uterine cancer, endometrial uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, childhood vulvar cancer and Wilms tumor (kidney cancer).

[0190] In some aspects, cancer includes ovarian cancer, prostate cancer, colon cancer or lung cancer. In some aspects, method is used to determine the new biomarker of ovarian cancer, prostate cancer, colon cancer or lung cancer by using the method of the present disclosure to assess cell free nucleic acid (for example, cell free DNA). In some embodiments, the method of the present disclosure can be used for the fetal DNA separated from pregnant women. In some aspects, the method of the present disclosure can be used for the prenatal diagnosis using the fetal DNA separated from pregnant women. In some aspects, the method of the present disclosure can be used for assessing fertilized eggs or blastocysts, to determine whether there is embryo quality or specific disease markers.

[0191] In some aspects, the methods disclosed herein are performed on low input concentrations of DNA and / or RNA. In some aspects, the low input DNA and / or RNA concentration is about or less than about 0.01 ng, 0.05 ng, 0.10 ng, 0.15 ng, 0.20 ng, 0.25 ng, 0.30 ng, 0.35 ng, 0.40 ng, 0.45 ng, 0.50 ng, 0.55 ng, 0.60 ng, 0.65 ng, 0.70 ng, 0.75 ng, 0.80 ng, 0.85 ng, 0.90 ng, 0.95 ng, 1.0 ng, 1.5 ng, 2.0 ng, 3.5 ng, 4.0 ng, 5.0 ng, 6.0 ng, 7.0 ng, 8.0 ng, 9.0 ng, 10.0 ng, 11.0 ng, 12.0 ng, 13.0 ng, 14.0 ng, 15.0 ng, 16.0 ng, 17.0 ng, 18.0 ng, 19.0 ng, 20.0 ng, 21.0 ng, 22.0 ng, 23.0 ng, 24.0 ng, 25.0 ng, 26.0 ng, 27.0 ng, 28.0 ng, 29.0 ng, 30.0 ng, 10 ng, 15 ng, 16 ng, 17 ng, 18 ng, 19 ng, 20 ng, 21 ng, 22 ng, 23 ng, 24 ng, 25 ng, 26 ng, 27 ng, 28 ng, 29 ng, 30 ng, 31 ng, 32 ng, 33 ng, 34 ng, 35 ng, 36 ng, 37 ng, 38 ng, 39 ng, 40 ng, 41 ng, 42 ng, 43 ng, 44 ng, 45 ng, 46 ng, 47 ng, 48 ng, 49 ng, 50 ng, 51 ng, 52 ng, 53 ng, 54 ng, 55 ng, 56 ng, 57 ng, 58 ng, 59 ng, 60 ng, 61 ng, 62 ng, 63 ng, 64 ng, 65 ng, 66 ng, 67 ng, 68 ng, 69 ng, 70 ng, 71 ng, 72 ng, 73 ng, 74 ng, 75 ng In some aspects, the low input concentration of DNA and / or RNA is obtained from about or less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, or 500 cells.

[0192] VI. Sample preparation

[0193] In some aspects, the method includes obtaining a sample (also referred to as a "biological sample") from a subject. The acquisition method provided herein may include a biopsy method, such as fine needle aspiration, needle biopsy, vacuum-assisted biopsy, incisional biopsy, excisional biopsy, punch biopsy, scraping biopsy, liquid biopsy or skin biopsy. In some aspects, the sample is obtained from a tissue by any biopsy method mentioned above. In some aspects, the sample can be obtained from any tissue provided herein, and these tissues include but are not limited to noncancerous or cancerous tissues, and noncancerous or cancerous tissues from serum, gallbladder, mucosa, skin, heart, lung, breast, pancreas, blood, liver, muscle, kidney, smooth muscle, bladder, colon, intestine, brain, prostate, esophagus or thyroid tissue. Alternatively, the sample can be obtained from any other source, and other sources include but are not limited to blood, sweat, hair follicles, oral tissue, tears, menstruation, feces or saliva. In some aspects of the current method, any medical professional, such as a doctor, nurse or medical technician, can obtain the biological sample for testing. In addition, the biological sample can be obtained without the help of a medical professional.

[0194] The sample may include, but is not limited to, tissues, cells, or biological materials from or derived from cells of the subject. In certain aspects, the biological sample includes extracellular vesicles, such as exosomes. The biological sample may be a heterogeneous or homogeneous population of cells or tissues. The biological sample may be a cell-free sample. The biological sample may be obtained using any method known in the art, which may provide a sample suitable for the analytical methods described herein. The sample may be obtained by non-invasive methods, including but not limited to: scraping the skin or cervix, swabbing the cheek, collecting saliva, collecting urine, collecting feces, collecting menstruation, tears, or semen.

[0195] Sample can be obtained by methods known in the art. In some aspects, sample is obtained by biopsy. In some aspects, sample is obtained by swab, endoscopy, scraping, phlebotomy or any other method known in the art. In some cases, the components of the kit of the inventive method can be used to obtain, store or transport samples. In some cases, multiple samples for diagnosis can be obtained by the method described herein. In other cases, multiple samples can be obtained by the method, such as one or more samples from a tissue and one or more samples from another specimen (such as serum) for diagnosis. In some cases, multiple samples can be obtained at the same or different times, such as one or more samples from a type of tissue and one or more samples from another specimen (such as serum). Samples can be obtained at different times, stored and / or analyzed in different ways. For example, samples can be obtained and analyzed by conventional staining methods or any other cytological analysis methods.

[0196] In some aspects, the biological sample can be obtained by a doctor, nurse or other medical professional, such as a medical technician, endocrinologist, cytologist, phlebotomist, radiologist or pulmonologist. The medical professional can instruct the sample to be tested or assayed appropriately. In some aspects, the molecular atlas company may consult which assay or test is most appropriate. In other aspects of the current method, the patient or object can obtain a biological sample for testing without the help of a medical professional, such as obtaining a whole blood sample, a urine sample, a fecal sample, a buccal sample or a saliva sample.

[0197] In other cases, the sample is obtained by invasive surgery, including but not limited to: biopsy, needle aspiration, endoscopy or phlebotomy. The method of needle aspiration can also include fine needle aspiration, needle biopsy, vacuum-assisted biopsy or large needle core biopsy. In some embodiments, multiple samples can be obtained by the methods herein to ensure sufficient amounts of biological material.

[0198] The general method of obtaining biological samples is also known in the art. Publications such as Ramzy, Ibrahim Clinical Cytopathology and Aspiration Biopsy 2001 describe the general method of biopsy and cytological methods, which are incorporated herein by reference in their entirety. In some embodiments, the sample is a fine needle aspirate of an esophageal or suspected esophageal tumor or neoplasm. In some cases, the fine needle aspiration sampling process can be guided by using ultrasound, X-ray or other imaging equipment.

[0199] In some aspects of the present methods, the molecular mapping business may obtain the biological sample directly from the subject, by a medical professional, by a third party, or by a kit provided by the molecular mapping business or a third party. In some cases, the biological sample may be obtained by the molecular mapping business after the subject, medical professional, or third party obtains the biological sample and sends it to the molecular mapping business. In some cases, the molecular mapping business may provide suitable containers and excipients for storing and transporting the biological sample to the molecular mapping business.

[0200] In some embodiments of the methods described herein, medical professionals do not need to participate in initial diagnosis or sample collection. Individuals can also obtain samples by using over-the-counter (OTC) test kits. OTC test kits may include tools for obtaining samples as described herein, tools for storing samples for testing, and instructions for the correct use of the test kit. In some cases, molecular atlas services are included in the price of purchasing the test kit. In other cases, molecular atlas services are charged separately. Samples suitable for the molecular atlas industry can be any material containing tissues, cells, nucleic acids, genes, gene fragments, expression products, gene expression products, or gene expression product fragments of individual to be tested. A method for determining sample suitability and / or adequacy is provided.

[0201] In some embodiments, the subject may be referred to a specialist, such as an oncologist, surgeon, or endocrinologist. The specialist may also obtain the biological sample for testing, or may introduce the individual to a testing center or laboratory to submit the biological sample. In some cases, a medical professional may transfer the subject to a testing center or laboratory to submit the biological sample. In other cases, the subject may provide a sample. In some cases, a molecular atlas company may obtain the sample.

[0202] VII. Kit

[0203] Also disclosed herein is a kit that can be used to implement the methods of the present disclosure. The contents of the kit may include one or more reagents described throughout the disclosure and / or one or more reagents known in the art for performing one or more steps described throughout the disclosure. For example, the kit may include one or more of the following: bisulfite, ammonium bisulfite, ammonium sulfite, ammonium sulfite monohydrate, sodium bisulfite, a bisulfite solution containing ammonium bisulfite, a bisulfite solution containing ammonium bisulfite and ammonium sulfite, 70% ammonium bisulfite solution, 50% ammonium bisulfite solution, 50% to 70% ammonium bisulfite solution, APOBEC deaminase, APOBEC3A, nuclease-free water, one or more primers, polyethylene glycol, magnetic beads, DNA polymerase, taq polymerase, DNA ligase, RNA ligase, reverse transcriptase, dNTP, DNA polymerase buffer, RNA polymerase, DTT, redox reagent, Mg 2+ , K + , adapters, DNA adapters, DNA comprising an RNA promoter, proteases, alkaline solutions, sodium hydroxide solutions, and NTPs. In certain aspects of the present disclosure, any one or more than one of the aforementioned components can be removed from the kit. In some aspects, the kit of the present invention does not comprise sodium bisulfite or added sodium bisulfite. In some aspects, the kit of the present invention does not comprise ammonium sulfite or added ammonium sulfite.

[0204] In some aspects, the kits of the invention include a solution containing ammonium bisulfite. In some aspects, the solution comprises between 50% and 70% by weight, including any range or value derivable therein. In some aspects, the kits of the invention include a solution comprising at least, at most, or about 50%, 50.1%, 50.2%, 50.3%, 50.4%, 50.5%, 50.6%, 50.7%, 50.8%, 50.9%, 51%, 51.1%, 51.2%, 51.3%, 51.4%, 51.5%, 51.6%, 51.7%, 51.8%, 51.9%, 52%, 52.1%, 52.2%, 52.3%, 52.4%, 52.5%, 52.6%, 52.7%, 52.8%, 52.9%, 53.0%, 53.1%, 53.2%, 53.3%, 53.4%, 53.5%, 53.6%, 53.7%, 53.8%, 53.9%, 54.1%, 54.2%, 54.3%, 54.4%, 54.5%, 54.6%, 54.7%, 54.8%, 54.9%, 55. 2.6 wt%, 52.7 wt%, 52.8 wt%, 52.9 wt%, 53 wt%, 53.1 wt%, 53.2 wt%, 53.3 wt%, 53.4 wt%, 53.5 wt%, 53.6 wt%, 53.7 wt%, 53.8 wt%, 53.9 wt%, 54 wt%, 54.1 wt%, 54.2 wt%, 54.3 wt%, 54.4 wt%, 54.5 wt%, 54.6 wt%, 54.7 wt%, 54.8 wt%, 54.9 wt%, 55 wt%, 55.1 wt%, 55.2 wt%, 55.3 wt%, 55.4 wt%, 55.5 wt% %, 55.6 wt%, 55.7 wt%, 55.8 wt%, 55.9 wt%, 56 wt%, 56.1 wt%, 56.2 wt%, 56.3 wt%, 56.4 wt%, 56.5 wt%, 56.6 wt%, 56.7 wt%, 56.8 wt%, 56.9 wt%, 57 wt%, 57.1 wt%, 57.2 wt%, 57.3 wt%, 57.4 wt%, 57.5 wt%, 57.6 wt%, 57.7 wt%, 57.8 wt%, 57.9 wt%, 58 wt%, 58.1 wt%, 58.2 wt%, 58.3 wt%, 58.4 wt%, 58.5 wt% %, 58.6 wt%, 58.7 wt%, 58.8 wt%, 58.9 wt%, 59 wt%, 59.1 wt%, 59.2 wt%, 59.3 wt%, 59.4 wt%, 59.5 wt%, 59.6 wt%, 59.7 wt%, 59.8 wt%, 59.9 wt%, 60 wt%, 60.1 wt%, 60.2 wt%, 60.3 wt%, 60.4 wt%, 60.5 wt%, 60.6 wt%, 60.7 wt%, 60.8 wt%, 60.9 wt%, 61 wt%, 61.1 wt%, 61.2 wt%, 61.3 wt%, 61.4 wt%, 61.5 wt%, 61.6 wt%, 61.7 wt%, 61.8 wt%, 61.9 wt%, 62 wt%, 62.1 wt%, 62.2 wt%, 62.3 wt%, 62.4 wt%, 62.5 wt%, 62.6 wt%, 62.7 wt%, 62.8 wt%, 62.9 wt%, 63 wt%, 63.1 wt%, 63.2 wt%, 63.3 wt%, 63.4 wt%, 63.5 wt%, 63.6 wt%, 63. 7 wt%, 63.8 wt%, 63.9 wt%, 64 wt%, 64.1 wt%, 64.2 wt%, 64.3 wt%, 64.4 wt%, 64.5 wt%, 64.6 wt%, 64.7 wt%, 64.8 wt%, 64.9 wt%, 65 wt%, 65.1 wt%, 65.2 wt%, 65.3 wt%, 65.4 wt%, 65.5 wt%, 65.6 wt%, 65.7 wt%, 65.8 wt%, 65. 9 wt%, 66 wt%, 66.1 wt%, 66.2 wt%, 66.3 wt%, 66.4 wt%, 66.5 wt%, 66.6 wt%, 66.7 wt%, 66.8 wt%, 66.9 wt%, 67 wt%, 67.1 wt%, 67.2 wt%, 67.3 wt%, 67.4 wt%, 67.5 wt%, 67.6 wt%, 67.7 wt%, 67.8 wt%, 67.9 wt%, 68 wt%, 68.1 wt%. %, 68.2 wt %, 68.3 wt %, 68.4 wt %, 68.5 wt %, 68.6 wt %, 68.7 wt %, 68.8 wt %, 68.9 wt %, 69 wt %, 69.1 wt %, 69.2 wt %, 69.3 wt %, 69.4 wt %, 69.5 wt %, 69.6 wt %, 69.7 wt %, 69.8 wt %, 69.9 wt % or 70 wt % ammonium bisulfite, or any range or value derivable therein. In some aspects, the solution comprises at least, at most, or about 66 wt%, 66.01 wt%, 66.02 wt%, 66.03 wt%, 66.04 wt%, 66.05 wt%, 66.06 wt%, 66.07 wt%, 66.08 wt%, 66.09 wt%, 66.1 wt%, 66.11 wt%, 66.12 wt%, 66.13 wt%, 66.14 wt%, 66.15 wt%. %, 66.16 wt %, 66.17 wt %, 66.18 wt %, 66.19 wt %, 66.2 wt %, 66.21 wt %, 66.22 wt %, 66.23 wt %, 66.24 wt %, 66.25 wt %, 66.26 wt %, 66.27 wt %, 66.28 wt %, 66.29 wt %, 66.3 wt %, 66.31 wt %, 66.32 wt %, 66.33 wt%, 66.34 wt%, 66.35 wt%, 66.36 wt%, 66.37 wt%, 66.38 wt%, 66.39 wt%, 66.4 wt%, 66.41 wt%, 66.42 wt%, 66.43 wt%, 66.44 wt%, 66.45 wt%, 66.46 wt%, 66.47 wt%, 66.48 wt%, 66.49 wt%, 66.5 %, 66.51 wt %, 66.52 wt %, 66.53 wt %, 66.54 wt %, 66.55 wt %, 66.56 wt %, 66.57 wt %, 66.58 wt %, 66.59 wt %, 66.6 wt %, 66.61 wt %, 66.62 wt %, 66.63 wt %, 66.64 wt %, 66.65 wt %, 66.66 wt %, 66.67 wt %, 6 6.68 wt%, 66.69 wt%, 66.7 wt%, 66.71 wt%, 66.72 wt%, 66.73 wt%, 66.74 wt%, 66.75 wt%, 66.76 wt%, 66.77 wt%, 66.78 wt%, 66.79 wt%, 66.8 wt%, 66.81 wt%, 66.82 wt%, 66.83 wt%, 66.84 wt%, 66.85 %, 66.86 wt%, 66.87 wt%, 66.88 wt%, 66.89 wt%, 66.9 wt%, 66.91 wt%, 66.92 wt%, 66.93 wt%, 66.94 wt%, 66.95 wt%, 66.96 wt%, 66.97 wt%, 66.98 wt%, 66.99 wt%, or 67 wt%, or any range or value derivable therein. In some aspects, the solution comprises about 66.67 wt% ammonium bisulfite.

[0205] In some aspects, the solution comprises ammonium sulfite. In some aspects, the solution comprises at least, at most, or about 5%, 5.1%, 5.2%, 5.3%, 5.4%, 5.5%, 5.6%, 5.7%, 5.8%, 5.9%, 6%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%, 6.7%, 6.8%, 6.9%, 7%, 7.1%, 7.2%, 7.3%, 7.4%, 7.5%, 7.6%, 7.7%, 7.8%, 7.9%, 8%, 8.1%, 8.2%, 8.3%, 8.4%, 8.5%, 8.6%, 8.7%, 8.8%, 8.9%, 8.1%, 8.2%, 8.3%, 8.4%, 8.5%, 8.6%, 8.7%, 8.8%, 8.9%, 8. 7.6 wt%, 7.7 wt%, 7.8 wt%, 7.9 wt%, 8 wt%, 8.1 wt%, 8.2 wt%, 8.3 wt%, 8.4 wt%, 8.5 wt%, 8.6 wt%, 8.7 wt%, 8.8 wt%, 8.9 wt%, 9 wt%, 9.1 wt%, 9.2 wt%, 9.3 wt%, 9.4 wt%, 9.5 wt%, 9.6 wt%, 9.7 wt%, 9.8 wt%, 9.9 wt%, 10 wt%, 10.1 wt%, 10.2 wt%, 10.3 wt% %, 10.4 wt%, 10.5 wt%, 10.6 wt%, 10.7 wt%, 10.8 wt%, 10.9 wt%, 11 wt%, 11.1 wt%, 11.2 wt%, 11.3 wt%, 11.4 wt%, 11.5 wt%, 11.6 wt%, 11.7 wt%, 11.8 wt%, 11.9 wt%, 12 wt%, 12.1 wt%, 12.2 wt%, 12.3 wt%, 12.4 wt%, 12.5 wt%, 12.6 wt%, 12.7 wt%, 12.8 %, 13.4 wt %, 13.5 wt %, 13.6 wt %, 13.7 wt %, 13.8 wt %, 13.9 wt %, 14 wt %, 14.1 wt %, 14.2 wt %, 14.3 wt %, 14.4 wt %, 14.5 wt %, 14.6 wt %, 14.7 wt %, 14.8 wt %, 14.9 wt %, or 15 wt %, or any range or value derivable therein. In some aspects, the solution comprises ammonium sulfite at a concentration of or less than 0.1 M, 0.01 M, 1×10 -3 M, 1×10 -4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M or less than 1×10 -10In some aspects, the solution comprises less than 1%, 0.1%, 0.01%, 0.001%, or 0.0001%, or less than 0.0001% by weight of ammonium bisulfite. In some aspects, the solution comprises less than 1%, 0.1%, 0.01%, 0.001%, or 0.0001%, or less than 0.0001% by weight of ammonium sulfite. In some aspects, the solution does not comprise ammonium sulfite or added ammonium sulfite.

[0206] In some aspects, the solution does not include ammonium sulfite or added ammonium sulfite. In some aspects, the solution includes a concentration of or less than 1M, 0.9M, 0.8M, 0.7M, 0.6M, 0.5M, 0.4M, 0.3M, 0.2M, 0.1M, 0.01M, 1×10 -3 M, 1×10 - 4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 M, 1×10 -13 M, 1×10 -14 M, 1×10 -15 M, 1×10 -16 M, 1×10 -17 M, 1×10 -18 M, 1×10 -19 M, 1×10 -20 M or less than 1×10 -20 M of ammonium sulfite.

[0207] In some aspects, the solution has a bisulfite concentration of 6.5 M to 10 M, including any range or value derivable therein. In some aspects, the solution has a bisulfite concentration of at least, at most, or about 6.5 M, 6.6 M, 6.7 M, 6.8 M, 6.9 M, 7 M, 7.1 M, 7.2 M, 7.3 M, 7.4 M, 7.5 M, 7.6 M, 7.7 M, 7.8 M, 7.9 M, 8 M, 8.1 M, 8.2 M, 8.3 M, 8.4 M, 8.5 M, 8.6 M, 8.7 M, 8.8 M, 8.9 M, 9 M, 9.1 M, 9.2 M, 9.3 M, 9.4 M, 9.5 M, 9.6 M, 9.7 M, 9.8 M, 9.9 M, or 10 M, or any range or value derivable therein. In some aspects, the solution has a bisulfite concentration of about 7.0 M. In some aspects, the solution has a bisulfite concentration of 7.0 M. In some aspects, the solution has a bisulfite concentration of about 9.5 M. In some aspects, the solution has a bisulfite concentration of about 9.5 M. In some aspects, the solution has a pH of 4.8 to 5.4, including any range or value derivable therein. In some aspects, the solution has a pH of at least, at most, or about 4.8, 4.9, 5, 5.1, 5.2, 5.3, or 5.4. In some aspects, the solution has a pH of about 5.1.

[0208] In some aspects, the solution does not contain sodium bisulfite or added sodium bisulfite. In some aspects, the solution contains a concentration of at least 1M, 0.1M, 0.01M, 1×10 -3 M, 1×10 -4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 M, 1×10 -13 M, 1×10 -14 M, 1×10 -15 M, 1×10 -16 M, 1×10 -17 M, 1×10 -18 M, 1×10 -19 M, 1×10 -20 M or less than 1×10 -20 In some aspects, the solution does not contain sodium.

[0209] In some aspects, the solution does not include sodium bisulfite or added sodium bisulfite. In some aspects, the solution includes a concentration of or less than 1M, 0.9M, 0.8M, 0.7M, 0.6M, 0.5M, 0.4M, 0.3M, 0.2M, 0.1M, 0.01M, 1×10 -3 M, 1×10 -4 M, 1×10 -5 M, 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 M, 1×10 -13 M, 1×10 -14 M, 1×10 -15 M, 1×10 -16 M, 1×10 -17 M, 1×10 -18 M, 1×10 -19 M, 1×10 -20 M or less than 1×10 -20 In some aspects, the solution comprises less than 1 wt%, 0.1 wt%, 0.01 wt%, 0.001 wt%, or 0.0001 wt% or less than 0.0001 wt% sodium bisulfite.

[0210] In certain aspects, the kit of the present disclosure includes instructions for processing nucleic acid samples, such as DNA samples or RNA samples. The instructions may include instructions for using one or more components of the kit in the methods disclosed herein. For example, the instructions may include one or more instructions for incubating a nucleic acid sample with a bisulfite solution, instructions for mixing a bisulfite solution with a nucleic acid sample, instructions for treating nucleic acids with bisulfite, instructions for separating nucleic acids from samples, instructions for nucleic acid amplification, and instructions for preparing samples for sequencing. Instructions for incubating a nucleic acid sample with a bisulfite solution may include incubating the sample and solution or incubating up to 15 minutes, 14 minutes, 13 minutes, 12 minutes, 11 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, or 1 minute or less than 1 minute, or instructions for the time of any range or value that can be derived therefrom. The instructions for incubating the nucleic acid sample with the bisulfite solution may include incubating at or at least 80°C, 80.1°C, 80.2°C, 80.3°C, 80.4°C, 80.5°C, 80.6°C, 80.7°C, 80.8°C, 80.9°C, 81°C, 81.1°C, 81.2°C, 81.3°C, 81.4°C, 81.5°C, 81.6°C, 81.7°C, 81.8°C, 81.9°C, 82°C, 82.1°C, 82.2°C, 82.3°C, 82.4°C. 2.4℃、82.5℃、82.6℃、82.7℃、82.8℃、82.9℃、83℃、83.1℃、83.2℃、83.3℃、83.4℃、83.5℃、83.6℃、83.7℃、83.8℃、83.9℃、84℃、84.1℃、84.2℃、84.3℃、84.4℃、84.5℃、84.6℃、84.7℃、84.8℃、84.9℃、85℃、85.1℃、85.2℃、85 .3℃, 85.4℃, 85.5℃, 85.6℃, 85.7℃, 85.8℃, 85.9℃, 86℃, 86.1℃, 86.2℃, 86.3℃, 86.4℃, 86.5℃, 86.6℃, 86.7℃, 86.8℃, 86.9℃, 87℃, 87.1℃, 87.2℃, 87.3℃, 87.4℃, 87.5℃, 87.6℃, 87.7℃, 87.8℃, 87.9℃, 88℃, 88.1℃, 88 .2℃, 88.3℃, 88.4℃, 88.5℃, 88.6℃, 88.7℃, 88.8℃, 88.9℃, 89℃, 89.1℃, 89.2℃, 89.3℃, 89.4℃, 89.5℃, 89.6℃, 89.7℃, 89.8℃, 89.9℃, 90℃, 90.1℃, 90.2℃, 90.3℃, 90.4℃, 90.5℃, 90.6℃, 90.7℃, 90.8℃, 90.9℃, 91℃, 91.1℃、91.2℃、91.3℃、91.4℃、91.5℃、91.6℃、91.7℃、91.8℃、91.9℃、92℃、92.1℃、92.2℃、92.3℃、92.4℃、92.5℃、92.6℃、92.7℃、92.8℃、92.9℃、93℃、93.1℃、93.2℃、93.3℃、93.4℃、9 3.5℃、93.6℃、93.7℃、93.8℃、93.9℃、94℃、94.1℃、94.2℃、94.3℃、94.4℃、94.5℃、94.6℃、94.7℃、94.8℃、94.9℃、95℃、95.1℃、95.2℃、95.3℃、95.4℃、95.5℃、95.6℃、95.7℃、95.8℃ , 95.9℃, 96℃, 96.1℃, 96.2℃, 96.3℃, 96.4℃, 96.5℃, 96.6℃, 96.7℃, 96.8℃, 96.9℃, 97℃, 97.1℃, 97.2℃, 97.3℃, 97.4℃, 97.5℃, 97.6℃, 97.7℃, 97.8℃, 97.9℃, 98℃, 98.1℃, 98.2℃ In some aspects, the instructions include instructions for incubating the sample and solution at about 98°C, 98.3°C, 98.4°C, 98.5°C, 98.6°C, 98.7°C, 98.8°C, 98.9°C, 99°C, 99.1°C, 99.2°C, 99.3°C, 99.4°C, 99.5°C, 99.6°C, 99.7°C, 99.8°C, 99.9°C, or above 99.9°C, or any range or value derivable therein. In some aspects, the instructions include instructions for incubating the sample at about 98°C. In some aspects, the instructions include instructions for incubating the sample at 98°C. .

[0211] The one or more reagents are preferably provided in a solid form or in a liquid buffer suitable for storage in stock and later added to the reaction medium when the method using the reagent is carried out. Suitable packaging is provided. The kit may provide additional components useful in the process. These additional components may include buffers, capture reagents, colorimetric reagents, labels, reaction surfaces, detection means, control samples, instructions and interpretive information.

[0212] Any component of the kits described herein can be used in the methods of the present disclosure. In addition, components described in the context of the disclosed methods can be provided in the kits of the present disclosure.

[0213] VIII. Aspects

[0214] The following non-limiting aspects are included to illustrate certain features disclosed herein.

[0215] Aspect 1: A method for DNA treatment, comprising: (a) incubating a solution comprising DNA molecules and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes, wherein the solution does not contain added sodium bisulfite; and (b) placing the DNA molecules under alkaline conditions.

[0216] Aspect 2: The method according to aspect 1, wherein the solution does not contain added ammonium sulfite.

[0217] Aspect 3: The method according to aspect 1 or 2, wherein the solution does not contain ammonium sulfite at a level higher than about 1 / 10 of the level of ammonium bisulfite.

[0218] Aspect 4: The method according to any one of aspects 1 to 3, wherein the solution does not contain a level of sodium bisulfite greater than about 1 / 10 of the level of ammonium bisulfite.

[0219] Aspect 5: The method according to any one of aspects 1 to 4, wherein the bisulfite concentration of the solution is 6.5M to 10M.

[0220] Aspect 6: The method according to any one of aspects 1 to 5, wherein the bisulfite concentration of the solution is 8M to 10M.

[0221] Aspect 7: The method according to any one of aspects 1 to 6, wherein the bisulfite concentration of the solution is 9M to 10M.

[0222] Aspect 8: The method according to any one of aspects 1 to 7, wherein the bisulfite concentration of the solution is about 9.5M.

[0223] Aspect 9: The method according to any one of aspects 1 to 8, wherein the solution comprises 50 wt % to 70 wt % of ammonium bisulfite.

[0224] Aspect 10: The method according to any one of aspects 1 to 9, wherein the solution comprises 60 wt % to 70 wt % of ammonium bisulfite.

[0225] Aspect 11: The method according to any one of aspects 1 to 10, wherein the solution comprises 65 wt% to 68 wt% ammonium bisulfite.

[0226] Aspect 12: The method according to any one of aspects 1 to 11, wherein the solution comprises about 66.7 wt % ammonium bisulfite.

[0227] Aspect 13: The method according to any one of aspects 1 to 12, wherein the pH of the solution is 4.8 to 5.4.

[0228] Aspect 14: The method according to any one of aspects 1 to 13, wherein the pH of the solution is about 5.1.

[0229] Aspect 15: The method according to any one of aspects 1 to 14, wherein (a) comprises incubating the solution at a temperature of about 98°C.

[0230] Aspect 16: The method according to any one of aspects 1 to 15, wherein (a) comprises incubating the solution for up to 10 minutes.

[0231] Aspect 17: The method according to any one of aspects 1 to 16, wherein (a) comprises incubating the solution for up to 8 minutes.

[0232] Aspect 18: The method according to any one of aspects 1 to 17, wherein the DNA molecule comprises 4mC and more than 50% of the 4mC is deaminated after incubation.

[0233] Aspect 19: The method according to any one of aspects 1 to 18, wherein more than 75% of 4mC is deaminated after incubation.

[0234] Aspect 20: The method according to any one of aspects 1 to 19, wherein substantially all 4mC is deaminated after incubation.

[0235] Aspect 21: A method for DNA treatment, the method comprising: (a) generating a solution comprising DNA molecules and ammonium bisulfite, wherein the solution does not contain added sodium bisulfite; (b) incubating the solution at a temperature of at least 95°C; and (c) removing the DNA molecules in the solution at most 12 minutes after (a).

[0236] Aspect 22: The method of aspect 21, wherein the solution does not contain added ammonium sulfite.

[0237] Aspect 23: The method of aspect 21 or 22, wherein the solution does not contain ammonium sulfite at a level greater than about 1 / 10 of the level of ammonium bisulfite.

[0238] Aspect 24: The method according to any one of aspects 21 to 23, wherein the solution does not contain a level of sodium bisulfite greater than about 1 / 10 of the level of ammonium bisulfite.

[0239] Aspect 25: The method according to any one of aspects 21 to 24, wherein the bisulfite concentration of the solution is 6.5M to 10M.

[0240] Aspect 26: The method according to any one of aspects 21 to 25, wherein the bisulfite concentration of the solution is 8M to 10M.

[0241] Aspect 27: The method according to any one of aspects 21 to 26, wherein the bisulfite concentration of the solution is 9M to 10M.

[0242] Aspect 28: The method according to any one of aspects 21 to 27, wherein the bisulfite concentration of the solution is about 9.5M.

[0243] Aspect 29: The method according to any one of aspects 21 to 28, wherein the solution comprises 50 wt% to 70 wt% ammonium bisulfite.

[0244] Aspect 30: The method according to any one of aspects 21 to 29, wherein the solution comprises 60 wt% to 70 wt% ammonium bisulfite.

[0245] Aspect 31: The method according to any one of aspects 21 to 30, wherein the solution comprises 65 wt% to 68 wt% ammonium bisulfite.

[0246] Aspect 32: The method according to any one of aspects 21 to 31, wherein the solution comprises about 66.7 wt % ammonium bisulfite.

[0247] Aspect 33: The method according to any one of aspects 21 to 32, wherein the pH of the solution is 4.8 to 5.4.

[0248] Aspect 34: The method according to any one of aspects 21 to 33, wherein the pH of the solution is about 5.1.

[0249] Aspect 35: The method according to any one of aspects 21 to 34, wherein (b) comprises incubating the solution at a temperature of about 98°C.

[0250] Aspect 36: The method according to any one of aspects 21 to 35, wherein (c) comprises removing the DNA molecules in the solution at most 10 minutes after (a).

[0251] Aspect 37: The method according to any one of aspects 21 to 36, wherein (c) comprises removing the DNA molecules in the solution at most 8 minutes after (a).

[0252] Aspect 38: The method according to any one of aspects 21 to 37, wherein (a) comprises mixing a 70% ammonium bisulfite solution and a 50% bisulfite solution.

[0253] Aspect 39: The method according to any one of aspects 21 to 38, wherein the DNA molecule comprises 4mC and more than 50% of the 4mC is deaminated after incubation.

[0254] Aspect 40: The method according to any one of aspects 21 to 39, wherein more than 75% of 4mC is deaminated after incubation.

[0255] Aspect 41: The method according to any one of aspects 21 to 40, wherein substantially all 4mC is deaminated after incubation.

[0256] Aspect 42: A method for processing a nucleic acid sample, the method comprising incubating a solution comprising DNA molecules and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes, wherein the solution does not contain added sodium bisulfite, wherein each DNA molecule contains one or more than one cytosine residue, and wherein after incubating the solution, greater than 99% of the DNA molecules do not contain cytosine residues.

[0257] Aspect 43: The method of aspect 42, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 of the level of ammonium bisulfite.

[0258] Aspect 44: The method according to aspect 42 or 43, further comprising placing the plurality of DNA molecules under alkaline conditions.

[0259] Aspect 45: The method according to any one of aspects 42 to 44, wherein the solution comprises 50 wt% to 70 wt% ammonium bisulfite.

[0260] Aspect 46: The method according to any one of aspects 42 to 45, wherein the solution comprises 60 wt% to 70 wt% ammonium bisulfite.

[0261] Aspect 47: The method according to any one of aspects 42 to 46, wherein the solution comprises 65 wt% to 68 wt% ammonium bisulfite.

[0262] Aspect 48: The method according to any one of aspects 42 to 47, wherein the solution comprises about 66.7% by weight of ammonium bisulfite.

[0263] Aspect 49: The method according to any one of aspects 42 to 48, wherein the solution does not contain added ammonium sulfite.

[0264] Aspect 50: The method of any one of aspects 42 to 49, wherein the solution does not contain ammonium sulfite at a level greater than about 1 / 10 of the level of ammonium bisulfite.

[0265] Aspect 51: The method according to any one of aspects 42 to 50, wherein the bisulfite concentration of the solution is 6.5M to 10M.

[0266] Aspect 52: The method according to any one of aspects 42 to 51, wherein the bisulfite concentration of the solution is 8M to 10M.

[0267] Aspect 53: The method according to any one of aspects 42 to 52, wherein the bisulfite concentration of the solution is 9M to 10M.

[0268] Aspect 54: The method according to any one of aspects 42 to 53, wherein the bisulfite concentration of the solution is about 9.5M.

[0269] Aspect 55: The method according to any one of aspects 42 to 54, wherein the pH of the solution is 4.8 to 5.4.

[0270] Aspect 56: The method according to any one of aspects 42 to 55, wherein the DNA molecule comprises 4mC and more than 50% of the 4mC is deaminated after incubation.

[0271] Aspect 57: The method according to any one of aspects 42 to 56, wherein more than 75% of 4mC is deaminated after incubation.

[0272] Aspect 58: The method according to any one of aspects 42 to 57, wherein substantially all 4mC is deaminated after incubation.

[0273] Aspect 59: A DNA processing kit comprising: (a) a solution comprising ammonium bisulfite, the bisulfite concentration of the solution being 6.5 M to 10 M, wherein the solution does not comprise sodium bisulfite; and (b) instructions for processing a DNA sample.

[0274] Aspect 60: The kit according to aspect 59, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 of the level of ammonium bisulfite.

[0275] Aspect 61: The kit of claim 59 or 60, wherein the bisulfite concentration of the solution is 8M to 10M.

[0276] Aspect 62: The kit according to any one of aspects 59 to 61, wherein the bisulfite concentration of the solution is 9M to 10M.

[0277] Aspect 63: The kit according to any one of aspects 59 to 62, wherein the bisulfite concentration of the solution is about 9.5M.

[0278] Aspect 64: The kit according to any one of aspects 59 to 63, wherein the solution comprises 50% to 70% by weight of ammonium bisulfite.

[0279] Aspect 65: The kit according to any one of aspects 59 to 64, wherein the solution comprises 60% to 70% by weight of ammonium bisulfite.

[0280] Aspect 66: The kit according to any one of aspects 59 to 65, wherein the solution comprises 65% to 68% by weight of ammonium bisulfite.

[0281] Aspect 67: The kit according to any one of aspects 59 to 66, wherein the solution comprises about 66.7% by weight of ammonium bisulfite.

[0282] Aspect 68: The kit according to any one of aspects 59 to 67, wherein the pH of the solution is 4.8 to 5.4.

[0283] Aspect 69: The kit according to any one of aspects 59 to 68, wherein the pH of the solution is about 5.1.

[0284] Aspect 70: The kit according to any one of aspects 59 to 69, wherein the instructions include instructions for incubating the DNA sample with the solution at a temperature of at least 95°C for up to 12 minutes.

[0285] Aspect 71: The kit according to any one of aspects 59 to 70, wherein the instructions include instructions for incubating the DNA sample with the solution at a temperature of about 98°C.

[0286] Aspect 72: The kit according to any one of aspects 59 to 71, wherein the instructions include instructions for incubating the DNA sample with the solution for up to 10 minutes.

[0287] Aspect 73: The kit according to any one of aspects 59 to 72, wherein the instructions include instructions for incubating the DNA sample with the solution for up to 8 minutes.

[0288] Aspect 74: The kit according to any one of aspects 59 to 73, wherein the solution does not comprise ammonium sulfite.

[0289] Aspect 75: The kit according to any one of aspects 59 to 74, wherein the solution does not contain a level of ammonium sulfite greater than about 1 / 10 the level of ammonium bisulfite.

[0290] Aspect 76: The kit according to any one of aspects 59 to 75, further comprising an alkaline solution.

[0291] Aspect 77: The kit according to any one of aspects 59 to 76, further comprising one or more than one buffer.

[0292] Aspect 78: A method for RNA treatment, the method comprising: (a) incubating a solution comprising an RNA molecule, ammonium sulfite and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes, wherein the solution does not contain added sodium bisulfite; and (a) placing the RNA molecule under alkaline conditions.

[0293] Aspect 79: The method of aspect 78, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 of the level of ammonium sulfite.

[0294] Aspect 80: The method of aspect 78 or 79, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 of the level of ammonium bisulfite.

[0295] Aspect 81: The method according to any one of aspects 78 to 80, wherein the bisulfite concentration of the solution is 6.5M to 10M.

[0296] Aspect 82: The method according to any one of aspects 78 to 81, wherein the bisulfite concentration of the solution is 6.5M to 7.5M.

[0297] Aspect 83: The method according to any one of aspects 78 to 82, wherein the bisulfite concentration of the solution is about 7.0M.

[0298] Aspect 84: The method according to any one of aspects 78 to 83, wherein the pH of the solution is 4.8 to 5.4.

[0299] Aspect 85: The method according to any one of aspects 78 to 84, wherein the solution comprises 5 wt% to 15 wt% ammonium sulfite.

[0300] Aspect 86: The method of any one of aspects 78 to 85, wherein the solution comprises 8 wt% to 12 wt% ammonium sulfite.

[0301] Aspect 87: The method according to any one of aspects 78 to 86, wherein the solution comprises about 10% by weight of ammonium sulfite.

[0302] Aspect 88: The method according to any one of aspects 78 to 87, wherein (a) comprises incubating the solution at a temperature of about 98°C.

[0303] Aspect 89: The method according to any one of aspects 78 to 88, wherein (a) comprises incubating the solution for up to 10 minutes.

[0304] Aspect 90: The method according to any one of aspects 78 to 88, wherein (a) comprises incubating the solution for up to 8 minutes.

[0305] Aspect 91: A method for RNA treatment, the method comprising: (a) generating a solution comprising RNA molecules, ammonium sulfite and ammonium bisulfite, wherein the solution does not contain added sodium bisulfite; (b) incubating the solution at a temperature of at least 95°C; and (c) removing the RNA molecules in the solution at most 12 minutes after (a).

[0306] Aspect 92: The method of aspect 91, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 of the level of ammonium sulfite.

[0307] Aspect 93: The method of aspect 91 or 92, wherein the solution does not contain a level of sodium bisulfite greater than about 1 / 10 the level of ammonium bisulfite.

[0308] Aspect 94: The method according to any one of aspects 91 to 93, wherein the bisulfite concentration of the solution is 6.5M to 10M.

[0309] Aspect 95: The method according to any one of aspects 91 to 94, wherein the bisulfite concentration of the solution is 6.5M to 7.5M.

[0310] Aspect 96: The method according to any one of aspects 91 to 95, wherein the bisulfite concentration of the solution is about 7.0M.

[0311] Aspect 97: The method according to any one of aspects 91 to 96, wherein the pH of the solution is 4.8 to 5.4.

[0312] Aspect 98: The method according to any one of aspects 91 to 97, wherein the pH of the solution is about 5.1.

[0313] Aspect 99: The method according to any one of aspects 91 to 98, wherein the solution comprises 5 wt% to 15 wt% ammonium sulfite.

[0314] Aspect 100: The method of any one of aspects 91 to 99, wherein the solution comprises 8 wt% to 12 wt% ammonium sulfite.

[0315] Aspect 101: The method of any one of aspects 91 to 100, wherein the solution comprises about 10 wt% ammonium sulfite.

[0316] Aspect 102: The method according to any one of aspects 91 to 101, wherein (b) comprises incubating the solution at a temperature of about 98°C.

[0317] Aspect 103: The method according to any one of aspects 91 to 102, wherein (c) comprises removing RNA molecules in the solution at most 10 minutes after (a).

[0318] Aspect 104: The method according to any one of aspects 91 to 103, wherein (c) comprises removing RNA molecules in the solution at most 8 minutes after (a).

[0319] Aspect 105: A method for processing a nucleic acid sample, the method comprising incubating a solution comprising RNA molecules, ammonium sulfite and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes, wherein the solution does not contain added sodium bisulfite, wherein each RNA molecule contains one or more than one cytosine residue, and wherein after incubating the solution, greater than 99% of the RNA molecules do not contain cytosine residues.

[0320] Aspect 106: The method of aspect 105, wherein the solution does not contain a level of sodium bisulfite greater than about 1 / 10 the level of ammonium sulfite.

[0321] Aspect 107: The method of aspect 105 or 106, wherein the solution does not contain a level of sodium bisulfite greater than about 1 / 10 the level of ammonium bisulfite.

[0322] Aspect 108: The method according to any one of aspects 105 to 107, wherein the pH of the solution is 4.8 to 5.4.

[0323] Aspect 109: The method according to any one of aspects 105 to 108, wherein the pH of the solution is about 5.1.

[0324] Aspect 110: The method of any one of aspects 105 to 109, wherein the solution comprises 5 wt % to 15 wt % ammonium sulfite.

[0325] Aspect 111: The method of any one of aspects 105 to 110, wherein the solution comprises 8 wt% to 12 wt% ammonium sulfite.

[0326] Aspect 112: The method according to any one of aspects 105 to 111, wherein the solution comprises about 10% by weight ammonium sulfite.

[0327] Aspect 113: The method according to any one of aspects 105 to 112, wherein (a) comprises incubating the solution at a temperature of about 98°C.

[0328] Aspect 114: The method according to any one of aspects 105 to 113, wherein (a) comprises incubating the solution for up to 10 minutes.

[0329] Aspect 115: The method according to any one of aspects 105 to 114, wherein (a) comprises incubating the solution for up to 8 minutes.

[0330] Aspect 116: The method according to any one of aspects 105 to 115, wherein the bisulfite concentration of the solution is 6.5M to 10M.

[0331] Aspect 117: The method according to any one of aspects 105 to 116, wherein the bisulfite concentration of the solution is 6.5M to 7.5M.

[0332] Aspect 118: The method according to any one of aspects 105 to 117, wherein the bisulfite concentration of the solution is about 7.0M.

[0333] Aspect 119: The method according to any one of aspects 105 to 118, further comprising subjecting the plurality of RNA molecules to alkaline conditions.

[0334] Aspect 120: An RNA processing kit comprising: (a) a solution comprising ammonium sulfite and ammonium bisulfite, the solution having a bisulfite concentration of 6.5 M to 8 M, wherein the solution does not contain added sodium bisulfite; and (b) instructions for processing an RNA sample.

[0335] Aspect 121: The kit according to aspect 120, wherein the solution does not contain a level of sodium bisulfite greater than about 1 / 10 the level of ammonium sulfite.

[0336] Aspect 122: The kit according to aspect 120 or 121, wherein the solution does not contain a level of sodium bisulfite greater than about 1 / 10 the level of ammonium bisulfite.

[0337] Aspect 123: The kit according to any one of aspects 120 to 122, wherein the bisulfite concentration of the solution is about 7.0M.

[0338] Aspect 124: The kit according to any one of aspects 120 to 123, wherein the pH of the solution is 4.8 to 5.4.

[0339] Aspect 125: The kit according to any one of aspects 120 to 124, wherein the pH of the solution is about 5.1.

[0340] Aspect 126: The kit according to any one of aspects 120 to 125, wherein the solution comprises 5 wt % to 15 wt % ammonium sulfite.

[0341] Aspect 127: The kit according to any one of aspects 120 to 126, wherein the solution comprises 8 wt % to 12 wt % ammonium sulfite.

[0342] Aspect 128: The kit according to any one of aspects 120 to 127, wherein the solution comprises about 10% by weight of ammonium sulfite.

[0343] Aspect 129: The kit according to any one of aspects 120 to 128, wherein the instructions include instructions for incubating the RNA sample with the solution at a temperature of at least 95°C for up to 12 minutes.

[0344] Aspect 130: The kit according to any one of aspects 120 to 129, wherein the instructions include instructions for incubating the RNA sample with the solution at a temperature of about 98°C.

[0345] Aspect 131: The kit according to any one of aspects 120 to 130, wherein the instructions include instructions for incubating the RNA sample with the solution for up to 10 minutes.

[0346] Aspect 132: A method for 5-hydroxymethylcytosine analysis, the method comprising: (a) incubating a first solution comprising a first DNA molecule and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes; (b) incubating a second solution comprising a second DNA molecule and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes; (c) placing the first DNA molecule under alkaline conditions; (d) placing the second DNA molecule under alkaline conditions; (e) treating the second DNA molecule with an apo-BEC deaminase; and (f) sequencing the first DNA molecule and the second DNA molecule.

[0347] Aspect 133: The method according to aspect 132, wherein the first solution does not contain added sodium bisulfite.

[0348] Aspect 134: The method of aspect 132 or 133, wherein the first solution does not contain a level of sodium bisulfite greater than about 1 / 10 the level of ammonium bisulfite.

[0349] Aspect 135: The method of aspects 132 to 134, wherein the second solution does not contain added sodium bisulfite.

[0350] Aspect 136: The method according to any one of aspects 132 to 135, wherein the second solution does not contain a level of sodium bisulfite greater than about 1 / 10 the level of ammonium bisulfite.

[0351] Aspect 137: The method according to any one of aspects 132 to 136, wherein the first solution and the second solution are the same solution.

[0352] Aspect 138: The method according to any one of aspects 132 to 136, wherein the first solution and the second solution are different solutions.

[0353] Aspect 139: The method according to any one of aspects 132 to 138, wherein (a) and (b) are performed simultaneously.

[0354] Aspect 140: The method according to any one of aspects 132 to 139, wherein (c) and (d) are performed simultaneously.

[0355] Aspect 141: The method according to any one of aspects 132 to 140, wherein the first DNA molecule and the second DNA molecule have the same nucleotide sequence.

[0356] Aspect 142: The method according to any one of aspects 132 to 141, wherein the APOBEC deaminase is APOBEC3A.

[0357] Example

[0358] The following examples are included to illustrate certain embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques that the inventors have found to work well in the practice of the present invention and therefore can be considered to constitute certain modes of its practice. However, based on this disclosure, it will be appreciated by those skilled in the art that many changes may be made in the disclosed specific embodiments without departing from the spirit and scope of the present invention and still obtaining similar or similar results.

[0359] Example 1- RNA for m 5 Bisulfite sequencing for C detection and analysis

[0360] RNA 5 C modification and its regulators have been shown to affect a variety of cellular functions and are important in bladder cancer. 1 、Hepatocellular carcinoma (HCC) 2 , Glioblastoma multiforme (GBM) 3 and leukemia 4 This suggests that RNAm 5 C modification. Various methods, such as m 5 C-RIP-seq 5 , 5-Azacytidine-mediated RNA immunoprecipitation (Aza-IP) 6 and miCLIP 7 It has been reported for transcriptome-wide m 5 C mapping, but they all include an antibody enrichment step. BS sequencing remains the highest standard for 5mC sequencing and has been increasingly used to study RNAm 5 C 1,8-10. There are several commercial RNABS conversion kits, including EZ RNAMethylation from Zymo Research TM Kit and Methylamp from Epigentek TM RNA BS Conversion Kit. In addition to providing m 5In addition to the transcriptome-wide view of C deposition, RNA BS sequencing is cheap and easy to perform. On the other hand, although BS-seq is not very effective in the detection of abundant RNAs such as tRNA and rRNA 11,12 Detection 5 C is effective, but great variability has been observed between studies of low-abundance RNAs such as mRNA, with some studies examining 8,000 different RNA species. 5 Study on C site 13 Other studies have found only a small number of methylated mRNAs 14 Recent studies have reported the identification of only a few hundred mRNAs in the human and mouse transcriptomes using improved bisulfite sequencing methods and more rigorous computational approaches. 5 C site 1,15 These controversial findings raise the need for developing more powerful methods to identify mRNA 15 The real m 5 The requirement for the C site.

[0361] In a comprehensive effort to develop quantitative methods for sequencing various RNA modifications, the inventors focused on: (i) reducing RNA degradation by improving efficiency so that reactions can be completed in very short times; and (ii) using high reaction temperatures to denature RNA to achieve complete C-to-U conversion. Figure 1 ), the reaction of cytosine with BS is rapid and reversible, while the deamination reaction that converts the C-BS adduct to the U-BS adduct is rate-limiting 16 Bisulfite is involved in both steps 16,17 , therefore, the BS conversion rate can be significantly accelerated when increasing BS concentration is used. 17 This strategy is used in RNA m 5 C sequencing has not been reported yet.

[0362] C-BS and U-BS adducts are the main species that generate abasic sites, leading to further RNA cleavage and degradation19. It is hypothesized that the rapid conversion of C- to -U will reduce the time that C-BS and U-BS are present in the reaction, thereby reducing RNA damage. In addition, it is further inferred that higher temperatures will not only accelerate the deamination reaction, but more importantly, help denature the secondary structure in the RNA, allowing complete bisulfite conversion in a much shorter time. Although high BS concentrations and high reaction temperatures may cause more RNA damage, it is hypothesized that shorter reaction times can reduce RNA damage and ultimately reduce RNA degradation. Equally important, high BS concentrations and high temperatures do not lead to m 5 Undesirable deamination of C.

[0363] Due to the limited solubility of sodium bisulfite salt in water, current bisulfite treatments are performed at 3M to 5M bisulfite concentrations. In DNA 5mC BS-sequencing, Shiraishi et al. proposed that ammonium bisulfite has a higher solubility in water, and their proposed high-concentration bisulfite reagent was reported to be more effective than the low-concentration bisulfite reagent prepared from the sodium salt. 18,20 Shiraishi et al. proposed using ammonium bisulfite mixed with sodium bisulfite to obtain a 10 M bisulfite reagent for DNA 5mC sequencing (2.08 g sodium bisulfite, 0.67 g ammonium sulfite monohydrate, dissolved in 5.0 ml 50% ammonium bisulfite) 18,20 In an attempt to reproduce these conditions, it was found that the mixture prepared according to this protocol required heating to dissolve the solids and that the bisulfite readily precipitated when the solution was cooled to room temperature. Furthermore, the solution was found to be very viscous and therefore difficult to handle, and was not a homogeneous solution.

[0364] The inventors next generated a bisulfite solution consisting of only ammonium bisulfite and ammonium sulfite. A series of BS conditions, such as BS salt, concentration, pH, temperature and reaction time, were screened.

[0365] A mixture containing 50% ammonium bisulfite (1 mL) and ammonium sulfite (100 mg) as a clear solution (referred to as "R-1G"; bisulfite concentration about 7.0 M, pH about 5.1) was mixed with 5 monomer unit RNA oligonucleotide (SEQ ID NO: 1) (100 ng) in water (1 μL) (9 μL) and incubated at 98°C. MALDI TOF mass spectrometry (MS) was used to monitor the reaction. Since neither A nor G reacts with BS, the mass change before and after BS treatment should only reflect the reaction of cytosine residues with BS. Figure 2A As shown, most of the starting material was consumed within 1 minute to produce an intermediate with MS of +83, indicating that cytosine was directly converted to the corresponding U-BS adduct. Cytosine was almost completely consumed within 2 minutes and completely converted to the U-BS adduct within 3 minutes.

[0366] Interestingly, no C-BS adduct was observed at any time point of the reaction (MS +82 compared to the control), suggesting that the deamination of C-BS to form U-BS adduct was significantly accelerated using the new BS protocol and thus it was no longer the rate-limiting step. This observation may explain why the new BS conditions can significantly accelerate the overall C to U-BS reaction. After the reaction, treatment of the U-BS adduct with a base quantitatively converted U-BS to U (MS +1, compared to the control). Figure 2AIn addition to the much higher C to U conversion rates observed under the new BS conditions, secondary structures in RNA fragments should also be completely denatured at 98°C (e.g., if the incubation time is appropriately long). It is hypothesized that the combination of these changes will significantly reduce conventional RNAm 5 C False positives are frequently encountered in bisulfite sequencing.

[0367] In order to investigate whether the new BS condition would induce undesirable m 5 C deamination, the corresponding m 5 C RNA oligonucleotide (SEQ ID NO: 2) was treated with the same conditions for different lengths of time. No m 5 C reaction with BS, indicating that the new BS reaction did not produce false negatives for at least 30 minutes ( Figure 2B ). To test whether the new BS conditions degrade RNA into fragments that are too small, HeLa cell total RNA was treated with the R-1G BS protocol at 95°C or 98°C for different lengths of time, and then PAGE gel electrophoresis was run to assess the size of RNA fragments. Most RNA fragments showed a size distribution of 150 BP to 300 BP within 10 min of treatment ( Figure 3 Fragmented RNA with this size range can be used directly to construct libraries by random priming methods, or can be further fragmented into smaller sizes (50 BP to 100 BP) to construct libraries by ligation-based methods.

[0368] In order to verify that the new BS method can be used to construct CUs with good read length and efficient CU conversion without causing m 5 C deamination and reduce false positives caused by secondary structure. The method was applied to total RNA isolated from a series of different biological samples (including A549 cells). Total RNA from individual biological samples was treated with protocols R1-G at a range of different temperatures and times, and oligonucleotide libraries were constructed using the NEB Small RNA Kit, followed by next-generation sequencing. There are two confirmed m 5 C site, while other cytosine sites remain unmethylated. These studies attempted to determine whether these two identified m 5 Whether the C site can be detected, and m 5 Does the C site show any undesirable m 5 In addition, human 28S rRNA contains abundant secondary and tertiary structures, so conventional BS sequencing often produces many false positives (e.g., incomplete conversion of unmethylated cytosine to uracil). Figure 4 As shown, with the increase of reaction time, at two known m 5 Undesirable m at C site5 C deamination increases, while background decreases with time. Certain improved incubation conditions described herein are characterized as incubation at 98°C for 9 minutes, under which two known m 5 The average unconversion rate of C sites exceeded 95%, while the unconversion rate of all C sites was less than 5% ( Figure 5 ). To facilitate direct comparison, the new BS method was used with the EZ RNA Methylation Kit TM (Zymo Research) Parallel library construction, EZ RNAMethylation Kit TM It is used to detect m 5 C most widely used test kits and compared the false positive rates. Fig. 6A As shown, the library prepared using the Zymo kit did detect two known m 5 C sites (green dots with vertical lines indicate their locations), however, a large number of false positives (red dots) also occurred. The library dataset obtained using the “optimized” bisulfite conditions (75°C for 4 hours)10 was downloaded. As shown in Figure 6, the false positives were indeed reduced relative to the standard Zymo kit protocol (false positive percentage (FP%) decreased from 17.60% to 0.67%), but some false positives still existed, and the two known m 5 The modified fraction at the C site was also significantly reduced (efficiency decreased from 97.52% to 87.64%) ( Figure 6B ). From the literature 15,21 Two additional datasets were downloaded from , where the researchers used the Zymo BS reagent but performed three cycles of BS at a higher temperature. False positives were further reduced, but a large number of false positives were still detected ( Figure 6C and Fig.6D ). In addition, at two known m 5 Severe and undesirable deamination was also observed at the C site, indicating that the BS conditions in all these references were not optimal.

[0369] The statistical comparison of the BS treatment of the present disclosure with the conventional BS treatment (e.g., Zymo-BS) and other literature conditions is summarized in FIG7 . The false positive rate using the BS treatment conditions of the present disclosure is the lowest ( Fig. 7E ; "preferred conditions"), while m detected at two known sites using the BS treatment conditions disclosed herein 5 C signal is the highest ( Figure 7F; "Preferred conditions"). The inventors also compared the sequencing fragment distribution patterns between the BS treatment conditions of the present disclosure and other methods. Using the R-1G scheme to screen different lengths of incubation time and temperature, it was found that under most conditions, when a 5% unconversion rate cutoff value was used, no false positive sites were detected ( Fig. 7A ). It has been determined that the undesirable m 5 The deamination rate of C increases with the extension of reaction time and the increase of temperature ( Figure 7B Based on these observations, the R-1G protocol with an incubation time of 9 min at 98 °C gave two known m 5 The C site has a very high m 5 The C score was tested for the condition, and the false positive rate was zero when a 5% non-conversion rate cutoff was used ( Figure 7C ). These studies indicate that the new BS conditions resolve the m 5 The main challenge of BS sequencing of C. Fig.7D and Figure 8 As shown, blue ( Fig.7D )black( Figure 8 ) curve represents the sequencing fragment distribution of our method, and the red ( Fig.7D ) curve and the black curve ( Figure 8 ) represents the distribution of sequencing fragments of several other literature methods. Those regions rich in cytosine (e.g., 28S rRNA gene) show sequencing coverage in all published data, and the lighter regions contain more cytosines, resulting in more fragmentation, which is consistent with all methods, indicating that the cytosines reacted in RNA lead to RNA fragmentation, consistent with the proposed RNA fragmentation mechanism during BS treatment. However, compared with the literature methods, the fluctuation of read depth using the method disclosed in this paper is much smaller, indicating that the new BS conditions produce much less RNA fragmentation, so in the estimation of m 5 The deviation is much smaller when the C score is used.

[0370] To further validate the disclosed method, small RNA fractions from wild-type A549 cell line and its NSUN2 KO cell line were sequenced. 5 C is present at positions 48, 49, or 50 of some tRNA species and is a substrate for NSUN2 methyltransferase ( Fig. 9A ). Therefore, m is expected to be 5 The C fragment should be sensitive to NSUN2 knockdown. In contrast, the m 5 The C site is the substrate of DNMT2 ( Fig. 9A ), so some of them are insensitive to NSUN2 knockout. FIG. 9B to FIG. 9D As shown, after NSUN2 knockout, m detected at sites 48, 49, or 505 The C score was significantly reduced, while the m 5 The C scores remained unchanged, further confirming that the disclosed method is effective. Further analysis of the small RNA library showed that most of the m 5 The C site has a high modification score ( Fig. 10A ).For example, Fig. 10B tRNA Gly CCC All C and m 5 The unconversion rate of C sites, all C sites showed very low background, while the two m 5 The C position shows a very high modification score (>90%), while position 48 shows a much lower modification score (<25%). 5 Accurate and quantitative detection of C sites can facilitate the study of related biological functions.

[0371] The BS-seq protocol of the present disclosure was then applied to HeLa mRNA. It was found that most of the detected m 5 The C site is located in the protein-coding RNA ( Fig.11A ), half of which are located in the coding sequence (CDS) region ( Fig. 11B Using the protocol described herein, the inventors were able to identify more m when compared to two recent papers (Huang et al., 2019 and Zhang et al., 2021). 5 C site (Figure 12). 15 and Zhang et al. 21 Those identified in 5 C, most of which were also found in this paper (e.g., 376 / 565 and 222 / 343, respectively), indicating that the BS processing method described in this paper is more accurate and sensitive than previously described methods. 5 C sites have different modification rates ranging from 10% to 100%, with many sites being highly modified ( Fig.13 ). Most of them contain m 5 The gene modified by C has only one m 5 C site, while 2 to 5 m 5 C site ( Fig.14A ). Further gene ontology (GO) analysis showed that m 5 C-modified genes are involved in a variety of gene functions, including glycoprotein metabolism, cytoskeleton organization, cell localization, etc. ( Fig. 14B ), indicating that m 5 C modification may have important biological functions.

[0372] In addition to HeLa mRNA, the inventors also sequenced polyA+ RNA extracted from HEK293T cells. Fig.15A As shown, between HeLa and HEK293T cell lines, m 5 The overall modification level of C sites was consistent, however, there were some different modification sites. 5 C sites showed more G-rich motifs, while m 5 The C site showed more CUCCA motifs ( Fig. 15B NSUN2 and NSUN6 are reported to be the two molecules that deposit mRNA on mRNA. 5 Therefore, the present inventors applied the BS-seq protocol disclosed in the present invention to HeLa cell mRNA extracts knocked down by NSUN2 or NSUN6 and the corresponding shRNA controls ( Fig.16 The sequencing results showed that more than about 90% of the modification sites (mainly in G-rich motifs) in the mRNA extracts of NSUN2 knockdown cells were decreased, indicating that NSUN2 may play a role in the mRNA expression of HeLa cells. 5 C plays a major role in the modification of mRNA. In addition, the inventors also detected a small part of m 5 C sites, mainly in the CUCCA motif, which responded to NSUN6 knockdown. These results also suggest that the differences in modification profiles between cell lines may be related to the differential expression levels of methyltransferases.

[0373] Interestingly, both HeLa and HEK293T cells showed similar m 5 C site enrichment pattern ( Fig.17 ). Combining the ribosome profiling data, the inventors found that the m 5 Evidence that C modification can regulate translation efficiency. Compared with unmethylated genes, genes containing m 5 The genes at the C site were enriched with ribosome density signals in the 5′-UTR of the transcripts (p value = 1.05×10 -6 ), and the 3′-end contains m 5 Genes in the C site did not show significant enrichment of ribosome density signals (p = 0.37, Fig.18A In addition, neither the 5′-end nor the 3′-end methylated genes showed ribosome density enrichment in the CDS region ( Fig.18B ).

[0374] Experimental Procedure

[0375] (1) Identification of BS conditions using RNA model oligomers by Maldi-TOF MS

[0376] 50% ammonium bisulfite and ammonium sulfite were mixed in different ratios to prepare different BS reagents. Then, 9 μL of BS reagent was added and mixed with model RNA (AGCGA, 100 ng) (SEQ ID NO: 1) dissolved in water (1 μL). The mixture was incubated at different temperatures from 70°C to 98°C for different lengths of time, and the reaction was monitored by Maldi-TOF MALDI.

[0377] Table 1

[0378]

[0379] The most effective conditions were found to be the use of BS reagent R-1G (a solution of 1 mL 50% ammonium bisulfite and 100 mg ammonium sulfite) and incubation of the reaction mixture at 98°C, which quantitatively converted C to U-BS adduct within 3 minutes. Further alkaline treatment converted U-BS to U, resulting in complete C to U conversion. Using a similar model RNA (AGm 5 CGA) (SEQ ID NO: 2) as substrate, Maldi-TOF-MS showed no m 5 C-BS adducts were formed, which indicated that this new BS condition was highly selective and did not generate false negatives.

[0380] (2) Analysis of BS conditions by sequencing 28S rRNA from HeLa cells using R-1G

[0381] The incubation temperature is 70°C to 90°C, the incubation time is 20 minutes to 40 minutes, and urea is added or not. The average conversion rate of cytosine is higher than 98%, and the conversion rate of both m 5 The proportion of C sites was more than 90%. There was no significant benefit from adding urea.

[0382] Table 2

[0383]

[0384] Other conditions were tested using R-1G and it was found that the cytosine conversion efficiency was highest when treated at 98°C.

[0385] Table 3

[0386]

[0387] After determining that 98°C was the temperature with the highest cytosine conversion efficiency, various reaction times were tested and it was found that 9 minutes had the highest cytosine conversion efficiency (99.7%) and high m 5 C score (94.5%) (see Table 4 below).

[0388] Table 4

[0389]

[0390] (3) Study of treatment time and temperature using BS reagent R-1G and A549 total RNA by next-generation sequencing

[0391] A mixture of 9 μL BS reagent R-1G and 1 μL A549 total RNA (200 ng) was incubated at 70°C to 98°C for different lengths of time, and then 140 μL water was added. The conventional-BS treatment instructions (e.g., Zymo EZ RNAMethylation TM Kit instructions) for in-column desulfonation reaction. The RNA was further treated with 0.1M NaHCO3 at 95°C for 3 minutes to fragment it to a size of 50nt to 80nt. After OCC purification and 3-repair and 5-phosphorylation using T4·PNK, the RNA fragments were further purified by OCC and eluted with 7μL of water. 6μL of it was used to construct a library using the NEB small RNA library kit, and the library was sequenced by Nova-seq. After data analysis, it was determined that incubation at 98°C for 9 minutes was a condition in which false positives were completely removed and the two known m5C sites in 28S rRNA showed a high ratio. Traditional-BS treatment (such as EZ RNA Methylation from Zymo research) was also used. TM Kit) were used to construct libraries in parallel from equal amounts of A549 total RNA (200 ng). Sequencing results showed that two known m 5 The C site showed a high m 5 C score, but also showed many false positive sites, indicating many unconverted cytosine sites.

[0392] Example 2 - mRNA from low input samples 5 C detection and analysis

[0393] For patient samples, such as blood or embryonic samples, the available sample amount is usually limited (e.g., 10 ng to 100 ng of total RNA). For such a small amount of total RNA, it is not practical to use poly-T magnetic beads to enrich mRNA or use ribo-minus to deplete rRNA to obtain sufficient RNA samples to construct high-quality libraries using ligation-based methods. Therefore, short DNA probes are added to RNA obtained from low-input samples (e.g., blood samples, single-cell RNA), rRNA is annealed, and then RNase H is added to digest the rRNA into small fragments. After purifying other undigested RNA with paramagnetic beads, the RNA is BS treated with R-1G bisulfite reagent at 98°C for 9 minutes, followed by random priming to synthesize cDNA, and then the library is constructed using an ssDNA library construction kit. mRNA was detected in non-rRNA of low-input total RNA samples. 5 C site.

[0394] Example 3 - Bisulfite sequencing for detection and analysis of 5mC in RNA

[0395] Initially, bisulfite conversion was tested on DNA using the R-1G BS protocol applied to the DNA oligonucleotide AGCGA (SEQ ID NO: 3). It was observed that the reaction was slower than that observed for the RNA oligonucleotide and required 5 minutes to complete at 98°C ( Fig.19A Other protocols were screened, and a new protocol, called A7 (1 mL 70% ammonium bisulfite + 100 μL 50% ammonium bisulfite; bisulfite concentration was about 9.5 M, pH was about 5.1), was identified that quantitatively converted dC to dU within 3 minutes ( Fig.19B No significant 5mC deamination was observed within 10 min of treatment ( Fig. 20 ).

[0396] When a DNA oligomer (SEQ ID NO: 8) containing 82 monomer units of C and 5mC was synthesized; treated at 98°C for 4 to 10 minutes using BS protocol A7, Sanger sequencing results showed that 5mC was read as C in all cases, while C was quantitatively read as T after 8 to 12 minutes ( Fig.21 ), confirming that this protocol not only efficiently induced CU conversion in a very short time but also had high selectivity and avoided the undesired deamination of 5mC.

[0397] SEQ ID NO: 8 (DO-16-20)

[0398] GTGAGTGGAGTTGAGAGGTGGTGGTCTTCCGATCTAGATGTGTAGTGCCATCACGT5mCGCAGGTTGAGGGGTGTAGTGAGGGGT (SEQ ID NO: 8)

[0399] For DNA BS sequencing, it is also important to distinguish between 5mC and 4mC. 4mC is known to exist in bacteria and has recently been found in eukaryotic genomic DNA. 27 Previously, the inventors found that conventional BS treatments (e.g., Zymo BS conditions) could only detect 50% of the 28 Deamination of 4mC, therefore 4mC sites may lead to false positive 5mC detection sites when BS sequencing is used. The inventors infer that the reaction conditions disclosed in the present invention, including higher temperatures and BS protocol concentrations, can promote the deamination of 4mC. To test this, a short DNA oligomer containing a 4mC modification (TA4mCTT; SEQ ID NO: 9) was treated with the BS conditions of the present invention, in parallel with traditional-BS treatment (e.g., Zymo BS conditions). Maldi TOF MS data showed that when using traditional-BS treatment, 4mC was partially deaminated to produce the corresponding dU-containing oligomer with an efficiency of approximately 50%, while in contrast, when using the new BS conditions disclosed in this article, 4mC was quantitatively converted to dU ( Fig.22A ). In order to test the deamination efficiency of C, 5mC and 4mC using the BS conditions disclosed herein compared to the previously disclosed traditional-BS treatment (e.g., Zymo kit BS treatment), a synthetic 100 bp DNA oligomer containing C and 5mC and 4mC modifications (SEQ ID NO: 12) was synthesized and treated with the BS conditions disclosed herein or traditional-BS treatment (e.g., Zymo BS conditions). After treatment, Sanger sequencing was performed to evaluate the deamination efficiency of C, 5mC and 4mC. The results showed that after incubation with the BS reagent of the present disclosure at 98°C for 10 minutes, both 4mC and C sites were quantitatively read as T, while the 5mC site was still read as C ( Fig. 22B ), in contrast, when using traditional-BS treatment (e.g., Zymo kit BS treatment), both 4mC sites are read as a 1:1 ratio of C and T. These results indicate that the BS conditions of the present disclosure can completely avoid false positives due to the presence of 4mC in the genome in some cases, which is in stark contrast to the traditional BS treatment previously disclosed.

[0400] SEQ ID NO: 12

[0401] GTGAGTGGAGTTGAGAGGTGTGGTGGTA4mCTTCTGGCA4mCTCATC5mCGATCACGT AGATGTGTAGTGCCATCACGTCGCAGGTTGAGGGGTGTAGTGAGGGGT (SEQ ID NO: 12)

[0402] DNA degradation is a known problem in BS sequencing. Not only does it lead to loss of DNA material, which is a more serious problem in low-input DNA samples, but it can also lead to biased cleavage of DNA, so the detected 5mC fraction may be overestimated. 27 . According to the proposed DNA degradation mechanism in traditional BS treatment19, the C-BS adduct formed in BS treatment is the main substance that leads to deglycosylation to form AP sites, which leads to further breakage of the DNA backbone through β-elimination. Although 5mC does not react with BS, the C site is more easily cleaved than 5mC. Therefore, BS treatment will cause more severe DNA damage in C-rich DNA sequences, and thus DNA fragments containing more abundant C will appear less in the library, resulting in an overestimation of 5mC levels.

[0403] Since several protocols (including A7) of the present disclosure were found to be very effective in converting C-BS to U-BS adducts, using these protocols and the disclosed conditions, the deamination step is no longer the rate-limiting step, and therefore the C-BS adduct is only present in the reaction for a very short time and at a very low concentration. Therefore, it is expected that the use of the disclosed protocols (including A7) and treatment conditions will significantly reduce DNA damage compared to other BS conditions. Although the very high BS concentrations and very high temperatures used to accelerate the BS reaction in the disclosed methods may hypothetically accelerate DNA degradation, it is hypothesized that the much shorter reaction times will outweigh the acceleration of DNA degradation caused by the high temperature and high BS concentration. To test this hypothesis, fish gDNA and synthetic 164 monomer unit dsDNA (mimicking the size of cfDNA; (SEQ ID NO: 13 and antisense SEQ ID NO: 14) were treated with BS protocol A7 for different times and compared in parallel with traditional-BS treatment (e.g., Zymo EZ DNA Methylation-Gold Kit). As FIG. 23A to FIG. 23B As shown, in both cases, protocol A7 (1 mL 70% ammonium bisulfite + 100 μL 50% ammonium bisulfite) was observed to cause less DNA damage within 4 min to 10 min than traditional -BS treatment (e.g., Zymo kit, 98°C for 10 min followed by 64°C for 2.5 h), suggesting that it has the potential to be applied to low input DNA and may overcome the problem of overestimation of the 5mC fraction.

[0404] SEQ ID NO: 13

[0405] GTGAGTGGAGTTGAGAGGTGTGGTACGGTGACTCAGGTTTGGTGCTCTTCCGATCTAGA TGTGTAGTGCCATCCGAT5mCGCATATGCGAGTCACGTACATGCTACTGTCAGTACTGA TGGACCTTTCT5mCGCAGTGGCGACTATGGTTGAGGGGTGTAGTGAGGGGT (SEQ ID NO: 13);

[0406] SEQ ID NO: 14

[0407] ACCCCTCACTACACCCCTCAACCATAGTCGCCACTG5mCGAGAAAGGTCCATCAGTAC TGACAGTAGCATGTA5mCGTGACTCGCATATGCGATCGGATGGCACTACACATCTAGAT CGGAAGAGCACAAACCTGAGTCACCGTACCACACCTCTCAACTCCACTCAC (SEQ ID NO: 14)

[0408] Based on the principles established above, the inventors evaluated the new method using biological DNA containing synthetic internal references. Kit, which is the standard for BS sequencing, so libraries were constructed in parallel for direct comparison. Arabidopsis gDNA has a small genome (approximately 135 megabases) and was previously reported to have 5mC sites, so it was chosen as an exemplary gDNA for these studies. In order to compare the conversion efficiency of all C sites, an internal reference λ DNA without 5mC sites was added to assess the background. A synthetic 164 monomer unit internal reference dsDNA containing four 5mC sites (SEQ ID NO: 13 and antisense SEQ ID NO: 14) was also added to assess the rate of undesired 5mC demethylation. After BS treatment and library construction with the Swift Accel-NGS Methyl-Seq DNA Library Kit (single-stranded DNA library construction) and NGS sequencing, the sequencing data showed that the background was lowest after the incubation time reached 10 minutes, and for all C sites in λ DNA, Scheme A7 achieved an average C to U conversion rate greater than or equal to about 99.2% after a 10-minute reaction (as shown in Figure 2). Fig.24C As shown, the average unconversion rate is 0.82%. Fig.24AAs shown, additional assays resulted in 99.6% conversion and 0.4% unconversion. In comparison, the average conversion for conventional-BS treatment was 98.2% (e.g., the Zymo kit, with an average unconversion of 1.81%, as shown). Fig.24C As shown, additional assays resulted in an average conversion of 97.8% and an unconverted fraction of 2.2%, as Fig.24A shown) (respectively Fig.24C and Fig.24A ), indicating that the disclosed BS protocol and conditions (“new-BS”) gave higher transformation efficiency ( FIG. 24A to FIG. 24E Importantly, when using traditional-BS treatment (e.g., Zymo kit), the unconversion rate of each C site showed greater fluctuations, which required a high cutoff value (10%) to avoid false positives, while under the new-BS protocol and conditions, the unconversion rate of each site was more uniform, with almost all sites having an unconversion rate below 2% ( Fig. 24B and Fig.24E ).

[0409] (1) Identification of BS conditions using DNA model oligomers by Maldi-TOF MS

[0410] 70% ammonium bisulfite and 50% ammonium bisulfite were mixed in different proportions to prepare different BS reagents. Then 9 μL of BS reagent was taken and mixed with model DNA (AGCGA, 100 ng) dissolved in water (1 μL). The mixture was incubated at different temperatures of 98°C for different lengths of time, and the reaction was monitored by Maldi-TOF MALDI. See Table 5 and Table 6 below.

[0411] Table 5

[0412]

[0413] Table 6

[0414]

[0415] It was found that the best results were obtained by quantitatively converting C to U-BS adduct within 3 minutes using BS reagent A7 (a mixture of 1 mL 70% ammonium bisulfite and 100 μL 50% ammonium bisulfite) and incubating the reaction mixture at 98°C. Further base treatment converted U-BS to U, resulting in complete C to U conversion. Using a similar model DNA (AG5mCGA; SEQ ID NO: 4) as a substrate under the same conditions, Maldi-TOF-MS showed almost no T-BS adduct formation within 20 minutes, indicating that the new BS conditions are highly selective.

[0416] (2) Plant gDNA containing λDNA and a synthetic 164 nt DNA oligomer containing two 5mC sites were processed by next-generation sequencing using BS reagent A7.

[0417] A mixture of 9 μL BS reagent A7 and 1 μL plant gDNA (50 ng) containing 0.5 ng of λDNA without 5mC modification and 0.1 ng of synthetic 164 monomer units dsDNA containing four 5mC sites (SEQ ID NO: 13 and antisense SEQ ID NO: 14) was incubated at 98°C for different lengths of time, followed by the addition of 140 μL of water. The conventional-BS treatment (ZymoEZ DNA Kit) for in-column desulfonation reaction and eluted with 7 μL of water. 6 μL of it was used to construct a library using the Swift Accel-NGS Methyl-Seq DNA Library Kit, and the library was sequenced by Nova-seq. After data analysis, it was determined that incubation at 98°C for 10 minutes was the preferred condition, under which the average conversion efficiency of all cytosine sites in the DNA was 99.18% (see Table 7 below). For the two known 5mC sites in the 164bp internal reference DNA, the detection ratio was above 96%. Using traditional-BS treatment (such as Zymo EZ DNA The library was constructed in parallel from equal amounts of DNA using the kit. The sequencing results showed that the average conversion efficiency of all cytosine sites in λDNA was 98.2% using conventional-BS treatment. For the two known 5mC sites in the 164nt internal reference DNA, the detection ratio was 98% using conventional-BS treatment.

[0418] Table 7

[0419]

[0420] Example 4 - 5mC Detection and Analysis of DNA in Low-Input Samples

[0421] Libraries were constructed using the Swift kit in combination with the novel BS treatment conditions using the A7 protocol, starting from 0.1 ng, 1.0 ng, or 10 ng of mouse embryonic stem cell (mES) genomic DNA (gDNA) or from 0.1 ng, 1.0 ng, or 10 ng of human cell-free DNA (cfDNA). Sequencing results were analyzed to identify methylation sites in the DNA.

[0422] The inventors applied the BS protocols disclosed herein (e.g., protocol A7 and incubation at 98°C for 10 minutes) to mouse embryonic stem cell (mESC) gDNA. Since the protocols and conditions disclosed herein produce less DNA damage than traditional BS conditions, the inventors infer that these protocols can be used for the determination of low-input gDNA. In order to evaluate the conversion efficiency, gDNA sequencing libraries treated with the BS protocol disclosed herein were generated, and the resulting libraries had a starting concentration of 10 ng or 3.3 ng mESC gDNA, as well as an internal reference λ DNA without 5mC sites. In addition, a synthetic dsDNA internal reference containing 5mC was added to evaluate the undesired 5mC conversion rate. In order to facilitate direct comparison of the disclosed protocol with current traditional BS protocols, traditional-BS treatments (e.g., Zymo EZ DNA After sequencing, the inventors analyzed the conversion rates of all C sites and two known 5mC sites in the synthetic dsDNA. As shown in Figure 25, the two libraries starting with 3.3ng mESC gDNA gave a slightly higher background ( Fig.25B ). When the two libraries generated using the BS scheme of the present disclosure are compared with the conventional-BS process (compare Fig.25C and Fig.25A ), the new BS protocol gave much lower background. On the other hand, the conversion rate of undesired 5mC was very low in all 4 libraries ( Fig.25D )

[0423] In addition, the methylation levels detected from sequencing libraries generated with conventional-BS treatment systematically showed higher ratios than those of the BS treatment scheme of the present disclosure ( Fig.26 ). This may be due to the higher background noise level of traditional BS treatment compared to the BS scheme disclosed in this article. Studies using traditional BS treatment may overestimate the methylation level in the genome. At the same time, traditional BS treatment data reported more methylation sites in non-CpG motifs ( Fig. 27 ), which may also be the result of the relatively increased background noise level compared to the protocol disclosed herein. Background noise is a random signal that is more easily found at non-CpG sites. When studying non-CpG methylation, the increased background can mislead researchers about the biological significance and may lead to erroneous conclusions. When compared to conventional-BS treated samples, samples treated with the BS protocol disclosed herein showed similar genomic coverage in different GC% regions ( Fig.28A ). However, the conventional-BS treated samples showed a higher proportion of unconverted C, especially in the high GC% region ( Fig.28B In addition, the two libraries generated using the BS protocol of the present disclosure also showed more evenly distributed genome coverage than the libraries generated using the conventional-BS process ( Fig.29A and Fig.29B ), demonstrating the additional advantages of the methods and compositions of the present disclosure compared to conventional-BS treatment.

[0424] The BS protocol described here was used to generate ultra-low or low gDNA input libraries using mES cells with internal reference λDNA (1, 10, and 100 cells, respectively). The BS conversion efficiency of λDNA and mitochondrial DNA (mtDNA) was evaluated because all cytosine sites are free of 5mC modifications. Fig.30 and Fig.31 As shown, the unconverted C background noise decreases when the input amount increases. For example, a 1 cell sample shows a higher background than a 10 cell sample, which in turn shows a higher background than a 100 cell sample. The BS protocol described herein results in much lower background levels than the conventional-BS treatment. For DNA, when 1% was set as the cutoff for background, the conventional-BS treatment showed more than 10 times the false positive level (e.g., the percentage of unconverted C) relative to the BS protocol disclosed herein (e.g., an average of about 4.9% vs. about 0.36% for three 10 cell sample tests, Fig.30 For the highly structured mitochondrial DNA (which typically has higher background levels than λ DNA, likely due to the highly structured nature of mtDNA and the challenges associated with achieving high conversion levels due to incomplete denaturation), when 10% was set as the cutoff for background, the false positive rate using the traditional BS treatment was more than 80 times higher than the BS protocol disclosed herein (e.g., the average false positive rate for three 10-cell sample trials was approximately 86.3% vs. approximately 1.3%, Fig.31 ). These results indicate that the BS treatment protocol disclosed herein outperforms the conventional BS-treatment protocol when using ultra-low input amounts of gDNA.

[0425] Example 5-Detection and analysis of 5hmC in DNA

[0426] DNA oligonucleotides AGXGA (X = 5hmC, 5fC or 5caC) (SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7) were incubated with BS protocol A7 at 98°C for different times and the reaction was monitored using MALDI-TOF MS. It was found that 5hmC reacted most efficiently with BS, and 5hmC was converted to the corresponding cytosine methylenesulfonate (CMS) in only 1 minute ( Fig.32A ), while the reaction with 5fC was the slowest, and 5fC was converted to U-BS adduct within 30 minutes. After desulfonation reaction under alkaline conditions, U-BS was quantitatively converted to U. Therefore, in BS sequencing, 5fC will be converted to U ( Fig.33A). 5caC also reacts quickly with the BS reagent; the reaction is complete within 3 minutes, quantitatively converting 5caC to the U-BS adduct ( Fig.34A ). Therefore, 5fC and 5caC should both be read as U in BS-seq, while 5mC and 5hmC should still be read as C.

[0427] A known disadvantage of BS sequencing is that it cannot distinguish between 5mC and 5hmC, as they are both read as C after BS treatment, although the chemical properties are different, as 5mC does not react with BS at all, while 5hmC is converted to CMS after BS treatment. Recently, ACE-seq28 was reported to sequence 5hmC by exploiting the high deamination reactivity of APOBEC3A towards C and 5mC, although 5hmC can also be partially deaminated.

[0428] Since the published BS conditions quantitatively and spontaneously converted 5hmC to CMS, it was hypothesized that CMS would not be deaminated by APOBEC3A treatment. To test this hypothesis, DNA oligos containing 5hmC were treated with BS protocol A7 to convert 5hmC to CMS, and then probes containing 5mC or CMS were treated in parallel with APOBEC3A. Maldi-TOF MS showed that 5mC was efficiently converted to T, consistent with the literature. However, no reaction was observed for CMS ( Fig.35 ). 82 monomer unit DNA oligomers containing 5mC, 5hmC, or CMS were used for further testing. Without APOBEC3A treatment, all were read as C in Sanger sequencing. However, after APOBEC3A treatment, 5mC was quantitatively read as T, 5hmC was partially read as T, and CMS was quantitatively read as C ( Fig.36 ), further confirming that this new property of CMS can be used to distinguish 5mC from 5hmC.

[0429] This article provides a new method for sequencing 5mC and 5hmC and a method for distinguishing them. Fig.37 As shown, biological DNA can be treated with new BS conditions and then the sample can be divided into two parts. One part without further APOBEC3A treatment will provide 5mC+5hmC sites, while the other part with further APOBEC3A treatment will convert 5mC to T but keep CMS intact, so only the initial 5hmC sites will be read as C. Then subtracting the two sets of data will only give 5mC sites.

[0430] ***

[0431] In light of the present disclosure, all methods disclosed and claimed in the present application can be made and performed without undue experimentation. Although the compositions and methods of the present invention have been described with respect to specific embodiments, it is apparent to those skilled in the art that changes may be applied to the methods described herein and the steps or sequences of steps of the methods without departing from the concept, spirit and scope of the present invention. More specifically, it is apparent that specific reagents that are both chemically and physiologically relevant may replace the reagents described herein while achieving the same or similar results. All such similar substitutions and changes apparent to those skilled in the art are considered to be within the spirit, scope and concept of the present invention as defined by the appended claims.

[0432] References

[0433] To the extent that the following references provide exemplary procedural or other details supplementary to those set forth herein, these references are specifically incorporated herein by reference.

[0434] 1. Chen.

[0435] 2.He.Y.et al.Role of m 5 C-related regulatory genes in the diagnosis and prognosis of hepatocellular carcinoma. Am.J.Transl.Res.122.912-922(2020).

[0436] 3.Cheray.M.et al.Cytosine methylation of mature microRNAs inhibits their functions and is associated with poor prognosis in glioblastomamultiforme. Mol.Cancer 19, 36 (2020).

[0437] 4.Cheng.J.X.et al.RNA cytosine methylation and methyltransferasesmediate chromatin organization and 5-azacytidine response and resistance inleukaemia.Nat.Commun.9,1163(2018).

[0438] 5.Edelhcit.S..Schwartz,S.,Mumbach.M.R.,Wurtzel.O.&Sorek,R.Transcriptome-wide mapping of 5-methylcytidine RNA modifications inbacteria,archaea,and yeast reveals m 5 C within archaeal mRNAs.PLoS Genet.9,e1003602(2013).

[0439] 6.Khoddarmi.V.&Cairns.B.R.Identification of direct targets andmodified bases of RNA cytosine methyltransferases.Nat.Biotechnol.31,458-464(2013).

[0440] 7.Hussain,S.,Aleksic,J.,Blanco,S.,Dietmann.S.&Frye,M.Characterizing5-methylcytosine in the mammalian epitranscriptome.Genome Biol.14.215(2013).

[0441] 8.Schaefer,M.,Pollex.T.,Hanna,K.&Lyko.F.RNA cytosine methylationanalysis by bisulfite sequencing.Nucleic Acids Res.37,e12(2009).

[0442] 9.Cui,X.et al.5-Meethylcytosine RNA Methylation in ArabidopsisThaliana.Mol.Plant 10,1387-1399(2017).

[0443] 10.Yang,X.et al.5-methylcytosine promotes mRNA export-NSUN2 as themethyltransferase and ALYREF as an m 5 C reader.Cell Res.27,606-625(2017).

[0444] 11.Janin,M.et al.Epigenetic loss of RNA-methyltransferase NSUN5 inglioma targets ribosomes to drive a stress adaptive translationalprogram.Acta Neuropathol.(Berl.)138,1053-1074(2019).

[0445] 12.Blanco.S.et al.Aberrant methylation of tRNAs links cellular stressto neuro-developmental disorders.EMBO J.33,2020-2039(2014).

[0446] 13.Squires,J.E.et al.Widespread occurrence of 5-methylcytosine inhuman coding and non-coding RNA.Nucleic Acids Res.40.5023-5033(2012).

[0447] 14.Legrand,C.et al.Statistically robust methylation calling forwhole-transcriptome bisulfite sequencing reveals distinct methylationpatterns for mouse RNAs.Genome Res.27,1589-1596(2017).

[0448] 15.Huang,T.,Chen,W.,Liu,J.,Gu,N.&Zhang,R.Genome-wide identificationof mRNA 5-methylcytosine in mammals.Nat.StrucL Mol.Biol.26,380-388(2019).

[0449] 16.Sono.M.,Wataya,Y.&Hayatsu,H.Role of bisulfite in the deaminationand the hydrogen isotope exchange of cytidylic acid.J.Am.Chem.Soc.95,4745-4749(1973).

[0450] 17.Shapiro,R.,DiFate,V.&Welcher.M.Deamination of cytosine derivativesby bisulfite.Mechanism of the reaction.J.Am.Chem.Soc.96.906-912(1974).

[0451] 18.Hayatsu,H.,Negishi,K.&Shiraishi,M.DNA methylation analysis:speedupof bisulfite-mediated deamination of cytosine in the genomic sequencingprocedure.Proc.Jpn.Acad.Ser,B Phys.Biol.Sci.80,189(2004).

[0452] 19.Tanaka,K.&Okamoto,A.Degradation of DNA by bisulfite treatrment.Bioorg.Med.Chem.Lett.17.1912-1915(2007).

[0453] 20.Shiraishi,M.&Hayatsu,H.High-speed conversion of cytosine to uracilin bisulfite genomic sequencing analysis of DNA methylation.DNARes.Int.J.Rapid Publ.Rep.Genes Genomes 11,409-415(2004).

[0454] 21.Zhang,Z.et al.Systematic calibration of epitranscriptomic mapsusing a synthetic modification-free RNA library.Nat.Methods 18,1213-1222(2021).

[0455] 22.Hayatsu,H,Discovery of bisulfite-mediated cytosine conversion touracil,the key reaction for DNA methylation analysis--a personalaccount.Proc.Jpn.Acad.Ser.B Phys.Biol.Sci.84,321-330(2008).

[0456] 23.Hayatsu.H.Bisulfite Modification of Cytosine and 5-Methylcytosineas used in Epigenetic Studies.Genes Environ.28,1-8(2006).

[0457] 24.Hayatsu,H.The bisulfite genomic sequencing used in the analysis ofepigenetic states,a technique in the emerging environmental genotoxicologyresearch.Mutat.Res.659.77-82(2008).

[0458] 25.Genereux,D.P.,Johnson.W.C.,Burden,A.F., R.&Laird.C.D.Errorsin the bisulfite conversion of DNA:modulating inappropriate-and failed-conversion frequencies.Nucleic Acids Res.36,e150(2008).

[0459] 26.Yi,S.,Long,F.,Cheng,J.&Huang,D.An optimized rapid bisulfiteconversion method with high recovery of cell-free DNA.BMC Mol.Biol.18,24(2017).

[0460] 27.Olova,N.et al.Comparison of whole-genome bisulfite sequencinglibrary preparation strategies identifies sources of biases affecting DNAmethylation data.Genome Biol.19,33(2018).

[0461] 28.Schutsky,E.K.et al.Nondestructive,base-resolution sequencing of 5-hydroxymethylcytosine using a DNA deaminase.Nat.Biotechnol.(2018)doi:10.1038 / nbt.4204.

Claims

1. A method for DNA processing, the method comprising: (a) incubating a solution comprising DNA molecules and ammonium bisulfite at a temperature of at least 95° C. for up to 12 minutes, wherein the solution does not comprise added sodium bisulfite; and (b) Place the DNA molecules under alkaline conditions.

2. The method of claim 1, wherein the solution does not contain added ammonium sulfite.

3. The method of claim 1 or 2, wherein the solution does not contain ammonium sulfite at a level greater than about 1 / 10 of the level of ammonium bisulfite.

4. The method of claim 1 or 2, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 of the level of ammonium bisulfite.

5. The method according to claim 1 or 2, wherein the bisulfite concentration of the solution is 6.5M to 10M.

6. The method according to claim 1 or 2, wherein the bisulfite concentration of the solution is 8M to 10M.

7. The method of claim 1 or 2, wherein the bisulfite concentration of the solution is 9M to 10M.

8. The method of claim 1 or 2, wherein the bisulfite concentration of the solution is about 9.5 M.

9. The method of claim 1 or 2, wherein the solution comprises 50 to 70 wt% of ammonium bisulfite.

10. The method of claim 9, wherein the solution comprises 60 to 70 wt% ammonium bisulfite.

11. The method of claim 10, wherein the solution comprises 65 to 68 wt% ammonium bisulfite.

12. The method of claim 11, wherein the solution comprises about 66.7% by weight ammonium bisulfite.

13. The method according to claim 1 or 2, wherein the pH value of the solution is 4.8 to 5.

4.

14. The method of claim 13, wherein the pH of the solution is about 5.

1.

15. The method of claim 1 or 2, wherein (a) comprises incubating the solution at a temperature of about 98°C.

16. The method of claim 15, wherein (a) comprises incubating the solution for up to 10 minutes.

17. The method of claim 16, wherein (a) comprises incubating the solution for up to 8 minutes.

18. The method of claim 1 or 2, wherein the DNA molecule comprises N4-methylcytosine (4mC), and wherein more than 50% of the 4mC is deaminated after incubation.

19. The method of claim 18, wherein greater than 75% of 4mC is deaminated after incubation.

20. The method of claim 19, wherein substantially all of the 4mC is deaminated after incubation.

21. A method for DNA processing, the method comprising: (a) generating a solution comprising DNA molecules and ammonium bisulfite, wherein the solution does not include added sodium bisulfite; (b) incubating the solution at a temperature of at least 95°C; and (c) Removal of DNA molecules from the solution at most 12 minutes after (a).

22. The method of claim 21 wherein the solution does not contain added ammonium sulfite.

23. The method of claim 21, wherein the solution does not contain ammonium sulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

24. The method of claim 21 or 22, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

25. The method of claim 21 or 22, wherein the bisulfite concentration of the solution is 6.5M to 10M.

26. The method of claim 21 or 22, wherein the bisulfite concentration of the solution is 8M to 10M.

27. The method of claim 21 or 22, wherein the bisulfite concentration of the solution is 9M to 10M.

28. The method of claim 21 or 22, wherein the bisulfite concentration of the solution is about 9.5 M.

29. The method of claim 21 or 22, wherein the solution comprises 50% to 70% by weight of ammonium bisulfite.

30. The method of claim 29, wherein the solution comprises 60 to 70 weight percent ammonium bisulfite.

31. The method of claim 30, wherein the solution comprises 65 to 68 weight percent ammonium bisulfite.

32. The method of claim 31, wherein the solution comprises about 66.7% by weight ammonium bisulfite.

33. The method of claim 21 or 22, wherein the pH of the solution is 4.8 to 5.

4.

34. The method of claim 33, wherein the pH of the solution is about 5.

1.

35. The method of claim 21 or 22, wherein (b) comprises incubating the solution at a temperature of about 98°C.

36. The method of claim 21 or 22, wherein (c) comprises removing the DNA molecules in the solution at most 10 minutes after (a).

37. The method of claim 36, wherein (c) comprises removing the DNA molecules in the solution at most 8 minutes after (a).

38. The method of claim 21 or 22, wherein (a) comprises mixing a 70% ammonium bisulfite solution and a 50% bisulfite solution.

39. The method of claim 21 or 22, wherein the DNA molecule comprises 4mC, and wherein greater than 50% of the 4mC is deaminated after incubation.

40. The method of claim 39, wherein greater than 75% of 4mC is deaminated after incubation.

41. The method of claim 40, wherein substantially all of the 4mC is deaminated following incubation.

42. A method for processing a nucleic acid sample, the method comprising incubating a solution comprising DNA molecules and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes, wherein the solution does not contain added sodium bisulfite, wherein each DNA molecule contains one or more than one cytosine residue, and wherein after incubation of the solution, greater than 99% of the DNA molecules do not contain cytosine residues.

43. The method of claim 42, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

44. The method of claim 42, further comprising subjecting the plurality of DNA molecules to alkaline conditions.

45. A method according to claim 42 or 44, wherein the solution comprises 50% to 70% by weight of ammonium bisulfite.

46. ​​The method of claim 42 or 44, wherein the solution comprises 60 to 70 weight percent ammonium bisulfite.

47. The method of claim 42 or 44, wherein the solution comprises 65 to 68 weight percent ammonium bisulfite.

48. The method of claim 42 or 44, wherein the solution comprises about 66.7% by weight ammonium bisulfite.

49. The method of claim 42 or 44, wherein the solution does not contain added ammonium sulfite.

50. The method of claim 42 or 44, wherein the solution does not contain ammonium sulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

51. The method of claim 42 or 44, wherein the bisulfite concentration of the solution is 6.5M to 10M.

52. The method of claim 51 , wherein the bisulfite concentration of the solution is 8M to 10M.

53. The method of claim 52, wherein the bisulfite concentration of the solution is 9M to 10M.

54. The method of claim 53, wherein the bisulfite concentration of the solution is about 9.5 M.

55. The method of claim 42 or 44, wherein the pH of the solution is between 4.8 and 5.

4.

56. The method of claim 42 or 44, wherein the DNA molecule comprises 4mC and greater than 50% of the 4mC is deaminated after incubation.

57. The method of claim 56, wherein greater than 75% of 4mC is deaminated after incubation.

58. The method of claim 57, wherein substantially all of the 4mC is deaminated following incubation.

59. A DNA processing kit comprising: (a) a solution comprising ammonium bisulfite, the solution having a bisulfite concentration of 6.5 M to 10 M, wherein the solution does not contain sodium bisulfite; and (b) Instructions for processing the DNA sample.

60. The kit of claim 59, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

61. The kit of claim 59, wherein the bisulfite concentration of the solution is 8M to 10M.

62. The kit of claim 59, wherein the bisulfite concentration of the solution is 9M to 10M.

63. The kit of claim 59, wherein the bisulfite concentration of the solution is about 9.5 M.

64. The kit of claim 59, wherein the solution comprises 50% to 70% by weight ammonium bisulfite.

65. The kit of claim 64, wherein the solution comprises 60% to 70% by weight ammonium bisulfite.

66. The kit of claim 65, wherein the solution comprises 65% to 68% by weight of ammonium bisulfite.

67. The kit of claim 66, wherein the solution comprises about 66.7% by weight ammonium bisulfite.

68. The kit of claim 59 or 64, wherein the pH of the solution is between 4.8 and 5.

4.

69. The kit of claim 68, wherein the pH of the solution is about 5.

1.

70. The kit of claim 59 or 64, wherein the instructions include instructions for incubating the DNA sample with the solution at a temperature of at least 95°C for up to 12 minutes.

71. The kit of claim 59 or 64, wherein the instructions include instructions for incubating the DNA sample with the solution at a temperature of about 98°C.

72. The kit of claim 59 or 64, wherein the instructions include instructions for incubating the DNA sample with the solution for up to 10 minutes.

73. The kit of claim 70, wherein the instructions include instructions for incubating the DNA sample with the solution for up to 8 minutes.

74. The kit of claim 59 or 64, wherein the solution does not contain added ammonium sulfite.

75. The kit of claim 59 or 64, wherein the solution does not contain ammonium sulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

76. The kit of claim 59 or 64, further comprising an alkaline solution.

77. The kit of claim 59 or 64, further comprising one or more than one buffer.

78. A method for RNA processing, the method comprising: (a) incubating a solution comprising an RNA molecule, ammonium sulfite and ammonium bisulfite at a temperature of at least 95° C. for up to 12 minutes, wherein the solution does not comprise added sodium bisulfite; and (b) The RNA molecule is placed under alkaline conditions.

79. The method of claim 78, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium sulfite.

80. The method of claim 78, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

81. The method of claim 78, wherein the solution has a bisulfite concentration of 6.5 M to 10 M.

82. The method of claim 78, wherein the bisulfite concentration of the solution is 6.5 M to 7.5 M.

83. The method of claim 78, wherein the bisulfite concentration of the solution is about 7.0 M.

84. The method of claim 78 or 81, wherein the pH of the solution is between 4.8 and 5.

4.

85. The method of claim 78 or 81, wherein the solution comprises 5 to 15 weight percent ammonium sulfite.

86. The method of claim 85, wherein the solution comprises 8 to 12 weight percent ammonium sulfite.

87. The method of claim 86, wherein the solution comprises about 10% by weight ammonium sulfite.

88. The method of claim 78 or 81, wherein (a) comprises incubating the solution at a temperature of about 98°C.

89. The method of claim 78 or 81, wherein (a) comprises incubating the solution for up to 10 minutes.

90. The method of claim 89, wherein (a) comprises incubating the solution for up to 8 minutes.

91. A method for RNA processing, the method comprising: (a) generating a solution comprising RNA molecules, ammonium sulfite and ammonium bisulfite, wherein the solution does not include added sodium bisulfite; (b) incubating the solution at a temperature of at least 95°C; and (c) Removal of RNA molecules from the solution at most 12 minutes after (a).

92. The method of claim 91, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium sulfite.

93. The method of claim 91, wherein the solution does not contain sodium bisulfite at levels greater than about 1 / 10 the level of ammonium bisulfite.

94. The method of claim 91, wherein the solution has a bisulfite concentration of 6.5 M to 10 M.

95. The method of claim 91, wherein the solution has a bisulfite concentration of 6.5 M to 7.5 M.

96. The method of claim 91, wherein the bisulfite concentration of the solution is about 7.0 M.

97. The method of claim 91 or 94, wherein the pH of the solution is between 4.8 and 5.

4.

98. The method of claim 97, wherein the pH of the solution is about 5.

1.

99. The method of claim 91 or 94, wherein the solution comprises 5 to 15 weight percent ammonium sulfite.

100. The method of claim 99, wherein the solution comprises 8 to 12 weight percent ammonium sulfite.

101. The method of claim 100, wherein the solution comprises about 10% by weight ammonium sulfite.

102. The method of claim 91 or 94, wherein (b) comprises incubating the solution at a temperature of about 98°C.

103. The method of claim 91 or 94, wherein (c) comprises removing RNA molecules from the solution at most 10 minutes after (a).

104. The method of claim 103, wherein (c) comprises removing RNA molecules from the solution at most 8 minutes after (a).

105. A method for processing a nucleic acid sample, the method comprising incubating a solution comprising RNA molecules, ammonium sulfite and ammonium bisulfite at a temperature of at least 95°C for up to 12 minutes, wherein the solution does not contain added sodium bisulfite, wherein each RNA molecule contains one or more than one cytosine residue, and wherein after incubating the solution, greater than 99% of the RNA molecules do not contain cytosine residues.

106. The method of claim 105, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium sulfite.

107. The method of claim 105, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

108. The method of claim 105, wherein the pH of the solution is between 4.8 and 5.

4.

109. The method of claim 108, wherein the pH of the solution is about 5.

1.

110. The method of claim 105 or 108, wherein the solution comprises 5 to 15 weight percent ammonium sulfite.

111. The method of claim 105 or 108, wherein the solution comprises 8 to 12 weight percent ammonium sulfite.

112. The method of claim 111, wherein the solution comprises about 10% by weight ammonium sulfite.

113. The method of claim 105 or 108, wherein (a) comprises incubating the solution at a temperature of about 98°C.

114. The method of claim 105 or 108, wherein (a) comprises incubating the solution for up to 10 minutes.

115. The method of claim 114, wherein (a) comprises incubating the solution for up to 8 minutes.

116. The method of claim 105 or 108, wherein the solution has a bisulfite concentration of 6.5 M to 10 M.

117. The method of claim 116, wherein the solution has a bisulfite concentration of 6.5 M to 7.5 M.

118. The method of claim 117, wherein the bisulfite concentration of the solution is about 7.0 M.

119. The method of claim 105 or 108, further comprising subjecting the plurality of RNA molecules to alkaline conditions.

120. An RNA processing kit comprising: (a) a solution comprising ammonium sulfite and ammonium bisulfite, the bisulfite concentration of the solution being between 6.5 M and 8 M, wherein the solution does not comprise sodium bisulfite; (b) Instructions for processing RNA samples.

121. The kit of claim 120, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium sulfite.

122. The kit of claim 120, wherein the solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

123. The kit of claim 120, wherein the bisulfite concentration of the solution is about 7.0 M.

124. The kit of claim 120 or 123, wherein the pH of the solution is between 4.8 and 5.

4.

125. The kit of claim 124, wherein the pH of the solution is about 5.

1.

126. The kit of claim 120 or 123, wherein the solution comprises 5% to 15% by weight of ammonium sulfite.

127. The kit of claim 126, wherein the solution comprises 8% to 12% by weight ammonium sulfite.

128. The kit of claim 127, wherein the solution comprises about 10% by weight ammonium sulfite.

129. The kit of claim 120 or 123, wherein the instructions include instructions for incubating the RNA sample with the solution at a temperature of at least 95°C for up to 12 minutes.

130. The kit of claim 120 or 123, wherein the instructions include instructions for incubating the RNA sample with the solution at a temperature of about 98°C.

131. The kit of claim 120 or 123, wherein the instructions include instructions for incubating the RNA sample with the solution for up to 10 minutes.

132. A method for 5-hydroxymethylcytosine analysis, the method comprising: (a) incubating a first solution comprising a first DNA molecule and ammonium bisulfite at a temperature of at least 95° C. for up to 12 minutes; (b) incubating a second solution comprising a second DNA molecule and ammonium bisulfite at a temperature of at least 95° C. for up to 12 minutes; (c) placing the first DNA molecule under alkaline conditions; (d) placing the second DNA molecule under alkaline conditions; (e) treating the second DNA molecule with APOBEC deaminase; and (f) sequencing the first DNA molecule and the second DNA molecule.

133. The method of claim 132, wherein the first solution does not comprise added sodium bisulfite.

134. The method of claim 132, wherein the first solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

135. The method of claim 132 or 133, wherein the second solution does not comprise added sodium bisulfite.

136. The method of claim 132, wherein the second solution does not contain sodium bisulfite at a level greater than about 1 / 10 the level of ammonium bisulfite.

137. The method of claim 132, wherein the first solution and the second solution are the same solution.

138. The method of claim 132, wherein the first solution and the second solution are different solutions.

139. The method of claim 132 or 133, wherein (a) and (b) are performed simultaneously.

140. The method of claim 132 or 133, wherein (c) and (d) are performed simultaneously.

141. The method of claim 132 or 133, wherein the first DNA molecule and the second DNA molecule have the same nucleotide sequence.

142. The method of claim 132 or 133, wherein the APOBEC deaminase is APOBEC3A.

Images