Plant cytosine single-base editor and construction method and application thereof

Abstract

The invention provides a plant cytosine single-base editor as well as a construction method and application thereof, and relates to the technical field of plant genetic engineering. The single-base editor provided by the invention is named as hyPopCBE, and has a structural formula shown in the description, the editor comprises hA3A / Y130F cytosine deaminase, an optimized human-derived Rab51 single-stranded DNA binding protein structural domain, a fusion protein of nCas9 nuclease and a uracil glycosylase inhibitor, a fusion protein expression unit of phage MS2 coat protein and the uracil glycosylase inhibitor, and a guide RNA transcription expression unit integrated with an MS2 binding sequence. Compared with an existing plant cytosine single-base editor, the single-base editor constructed by the method can remarkably improve the editing efficiency of plant alleles, and the stability is higher; when the herbicide-resistant poplar gene is applied to poplar, a new herbicide-resistant poplar germplasm can be successfully created, and a technical support is provided for research and molecular breeding of a poplar functional genome.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to a plant cytosine single-base editor and a construction method and application thereof. Background Art

[0002] Poplar (Populus L.), as a tree species with important economic and ecological significance, is widely used in landscaping, agriculture, bioenergy and industry. As a model organism for woody plant research, poplar has the advantages of moderate genome size, high genetic diversity and fast growth rate. In-depth research on the functions of key genes of poplar and their expression regulation is of great significance to the germplasm improvement and application production of poplar. Obtaining mutant materials of specific genes is a key step in the functional research and germplasm improvement of poplar. However, due to the biological characteristics of poplar such as long generation cycle, high genetic heterozygosity and complex genome, traditional breeding methods have the disadvantages of long cycle, high investment and low efficiency. With the rapid development of biotechnology, CRISPR / Cas-mediated genome editing technology has provided new possibilities for achieving precise gene mutations, greatly accelerating the process of forest genome functional research and genetic improvement.

[0003] Although the CRISPR / Cas9 system-mediated single-base editing technology has developed rapidly and provided new technical support for poplar improvement and creation of new germplasm, its application in poplar is still limited. At present, only two studies have successfully used single-base editing technology to edit poplar genes at fixed sites: Li et al. successfully produced single-base editing using A3A / Y130F-BE3 and PmCDA1-BE3 in '717 Poplar'. However, this study only counted the data of C to T and C to indel mutations produced by the two vectors, and did not explore the situation of other editing byproducts in depth. In addition, the editing efficiency of the two vectors at most editing sites was low, and the proportion of indel mutations was high; Yao et al. used pHEE901 (BE3) for single-base editing in poplar, but the editing efficiency of this vector was low. Only two of the 25 transgenic plants produced C to T editing, with an efficiency of only 8%, and after high-throughput sequencing of these two transgenic lines, a large number of C to G / A and indel mutation data were observed.

[0004] It can be seen that there is currently no efficient CBE base editing tool in poplar. Therefore, it is urgent to develop more accurate and efficient single-base editing technology in poplar to lay a technical foundation for precise breeding of poplar genome editing. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a plant cytosine single-base editor and its construction method and application. The single-base editor constructed by the present invention can significantly improve the editing efficiency of plant alleles and has stronger stability. The single-base editor of the present invention can be successfully used in poplars to create new herbicide-resistant poplar germplasm.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a plant cytosine single-base editor, which is named hyPopCBE, and comprises a fusion protein expression unit of hA3A / Y130F cytosine deaminase and nCas9 nuclease and a guide RNA transcription expression unit;

[0008] The amino acid sequence of the hA3A / Y130F cytosine deaminase is shown in SEQ ID NO.1;

[0009] The amino acid sequence of the nCas9 nuclease is shown in SEQ ID NO.2;

[0010] The guide RNA transcription expression unit comprises, from the 5' end to the 3' end, an sgRNA cloning site and an sgRNA backbone sequence comprising an MS2 binding sequence; the nucleotide sequence of the sgRNA backbone comprising an MS2 binding sequence is SEQ ID NO.3.

[0011] Preferably, the fusion protein expression unit of hA3A / Y130F cytosine deaminase and nCas9 nuclease comprises the following functional modules from N-terminus to C-terminus: hA3A / Y130F deaminase coding region, XTEN linker, BPSV40NLS signal peptide, hRab51 DBD poplar optimized Coding region, nCas9 coding region, Nucleoplasmin NLS signal peptide, UGI coding region, SV40NLS signal peptide, T2A coding region, SV40NLS signal peptide, MCP coding region, 5×GS linker, UGI coding region, SV40NLS signal peptide.

[0012] Preferably, the hRab51 DBD poplar optimized The amino acid sequence encoded by the coding region is shown in SEQ ID NO.4.

[0013] Preferably, the complete amino acid sequence of the single-base editor is as shown in SEQ ID NO.5.

[0014] The present invention also provides a polynucleotide, which is a polynucleotide encoding the single-base editor hyPopCBE.

[0015] Preferably, the sequence of the polynucleotide is as shown in SEQ ID NO.6.

[0016] Preferably, the nucleotide sequence encoding hA3A / Y130F cytosine deaminase is shown as SEQ ID NO.7; the nucleotide sequence encoding nCas9 nuclease is shown as SEQ ID NO.8.

[0017] The present invention also provides a single-base editor or an application of the polynucleotide in single-base editing of plant genomes.

[0018] The present invention also provides a use of the single-base editor or the polynucleotide in preparing herbicide-resistant poplar varieties.

[0019] Preferably, the poplar is 84K poplar.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides a plant efficient cytosine single-base editor, which is based on the efficient dicotyledonous plant single-base editor A3A / Y130F-BE3, and has been improved in terms of nuclear localization signal, fusion protein connecting peptide, vector skeleton, etc. In order to increase the expression level and nuclear localization ability of nCas9 fusion protein and improve editing efficiency, the present invention selects a highly efficient nuclear localization signal peptide BPSV40NLS (bpNLS) at the N-terminus of nCas9. Secondly, in order to prolong the action time of deaminase and nCas9 during single-base editing and increase the stability of single-base editing, the present invention adds a human Rad51 single-stranded binding protein sequence optimized by poplar codons between A3A / Y130F deaminase and nCas9 protein. Finally, in order to enrich more copies of UGI and improve the editing efficiency and editing accuracy of C to T, the present invention introduces the MCP-MS2 system into the vector skeleton to recruit UGI. MCP and UGI sequences were added to the C-terminus of UGI in the A3A / Y130F-BE3 vector, and the expressed protein was cleaved using the T2A sequence to form two fusion proteins, A3A / Y130F deaminase-DBD-nCas9-UGI and MCP-UGI. MS2 binding sequences were added to the 13th and 53rd base positions of the guide RNA (sgRNA) backbone, respectively.

[0022] The present invention constructs a plant single-base editor hyPopCBE with high editing efficiency based on the A3A / Y130F-BE3 vector. Experimental results show that the single-base editor hyPopCBE constructed by the present invention has more efficient editing efficiency and strong stability. The present invention applies the single-base editor hyPopCBE to poplars, which can significantly improve the efficiency and purity of poplar single-base editing, improve the efficiency of poplar allele editing, and successfully create new herbicide-resistant poplar germplasm. Therefore, the plant single-base editor hyPopCBE constructed by the present invention provides technical support for the research of poplar functional genome and molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the core unit structure of the plant cytosine single base editor. In the figure, a is the core unit structure of the dicotyledonous plant cytosine single base editor A3A / Y130F-BE3, and b is the core unit structure of the plant cytosine single base editor hyPopCBE optimized by the present invention.

[0024] Figure 2 This is a schematic diagram of the application of the plant cytosine single-base editor hyPopCBE of the present invention in directional base editing in tobacco;

[0025] Figure 3 The gDNA corresponding to each base editing result is obtained by high-throughput sequencing technology (Hi-TOM) after the plant cytosine single-base editor hyPopCBE and A3A / Y130F-BE3 vector of the present invention are transiently expressed in tobacco. In the figure, a is the editing result of A3A / Y130F-BE3, and b is the editing result of hyPopCBE;

[0026] Figure 4 Schematic diagram of the sgRNA sequence and target amino acid of PagALS designed for the present invention;

[0027] Figure 5 The comparison result of the editing efficiency between the plant cytosine single base editor hyPopCBE and A3A / Y130F-BE3 of the present invention;

[0028] Figure 6 The results of the directed base editing efficiency of the plant cytosine single-base editors hyPopCBE and A3A / Y130F-BE3 in poplar trees of the present invention are shown in FIG. a is a comparison result of the editing efficiency from C to T, b is a comparison result of the editing efficiency from C to G, c is a comparison result of the editing efficiency from C to base deletion, and d is the number of plants and genes in which base deletion events occurred;

[0029] Figure 7The off-target mutation efficiency results of the plant cytosine single-base editor hyPopCBE in poplar;

[0030] Figure 8 This is a comparison diagram of the growth status of the herbicide-resistant poplar prepared by the plant cytosine single-base editor hyPopCBE of the present invention and the wild-type poplar. In the figure, a is a comparison diagram of the growth status of the mutant and the wild-type potted seedlings 45 days after spraying 3000 mg / L Tribenuron on the roots, and b is a comparison diagram of the growth status of the mutant and the wild-type tissue culture seedlings 30 days after adding 0.5 mg / L Nicosulfuron to the culture medium. DETAILED DESCRIPTION

[0031] The present invention provides a plant cytosine single-base editor, which is named hyPopCBE, and the editor comprises hA3A / Y130F cytosine deaminase, a human Rab51 single-stranded DNA binding protein domain optimized by poplar codons, a fusion protein of nCas9 nuclease and uracil glycosylase inhibitor, a fusion protein expression unit of bacteriophage MS2 coat protein and uracil glycosylase inhibitor, and a guide RNA transcription expression unit integrated with an MS2 binding sequence; the plant cytosine single-base editor hyPopCBE of the present invention is improved based on the efficient dicotyledonous plant cytosine single-base editor A3A / Y130F-BE3: the present invention replaces the 3×Flag tag protein and SV40 nuclear localization signal sequence between the A3A / Y130F cytosine deaminase and the nCas9 protein on the A3A / Y130F-BE3 vector with a bp nuclear localization signal and a human Rad51 DNA single-stranded binding protein (DBD) sequence optimized by poplar codons. Secondly, the MS2 binding protein sequence (MCP) and the UGI protein sequence are added to the C-terminus of the UGI protein sequence of the A3A / Y130F-BE3 vector, and the self-cleaving polypeptide 2A (T2A) sequence is used to achieve independent expression of these proteins. Finally, the MS2 binding sequence is added after the 13th and 50th base positions of the sgRNA backbone, respectively. The single-base editor hyPopCBE constructed by the present invention can improve the single-base editing efficiency and allele editing efficiency of plants, and greatly reduce the by-product editing efficiency. In the present invention, the amino acid sequence of the hA3A / Y130F cytosine deaminase is shown in SEQ ID NO.1; the amino acid sequence of the nCas9 nuclease is shown in SEQ ID NO.2; the guide RNA transcription expression unit includes the sgRNA cloning site and the sgRNA backbone sequence of the MS2 binding sequence from the 5' end to the 3' end; the nucleotide sequence of the sgRNA backbone of the MS2 binding sequence is SEQ ID NO.3. In the present invention, the synthetic fragment of the human Rab51 single-stranded DNA binding protein domain optimized by poplar codons is preferably obtained by codon preference optimization using the optimization service of Qingke.

[0032] In the present invention, the fusion protein expression unit of hA3A / Y130F cytosine deaminase and nCas9 nuclease comprises the following functional modules from N-terminus to C-terminus: hA3A / Y130F deaminase coding region, XTEN linker, BPSV40NLS (bpNLS) signal peptide, hRab51 DBD poplar optimizedCoding region, nCas9 coding region, Nucleoplasmin NLS signal peptide, UGI coding region, SV40NLS signal peptide, T2A coding region, SV40NLS signal peptide, MCP coding region, 5 Gly and Ser connecting peptides (5×GS linker), UGI coding region, SV40NLS signal peptide. In the present invention, the amino acid sequence of the XTEN linker is located at positions 200 to 217 of SEQ ID NO.5; the amino acid sequence of the bpNLS signal peptide is located at positions 218 to 234 of SEQ ID NO.5; in the present invention, the hRab51 DBD poplar optimized The amino acid sequence is located at positions 235 to 348 of SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.4. In the present invention, the full amino acid sequence of the single-base editor is shown in SEQ ID NO.5.

[0033] The present invention also provides a polynucleotide, which is a polynucleotide encoding the single-base editor hyPopCBE. In the present invention, the sequence of the polynucleotide is shown in SEQ ID NO.6. In the present invention, the nucleotide sequence encoding hA3A / Y130F cytosine deaminase is shown in SEQ ID NO.7; the nucleotide sequence encoding nCas9 nuclease is shown in SEQ ID NO.8.

[0034] The present invention also provides a single-base editor, or an application of the polynucleotide in single-base editing of plant genomes. The single-base editor provided by the present invention can improve the allele editing efficiency and homozygous editing efficiency of plant single-base editing, thereby narrowing the editing window.

[0035] The present invention also provides a single-base editor or a use of the polynucleotide in preparing a herbicide-resistant poplar variety. The test results show that the plant cytosine single-base editing system hyPopCBE constructed by the present invention can successfully mediate base replacement of the target gene in poplar. By editing the 197th proline site of the PagALS gene, the poplar acquires significant herbicide resistance.

[0036] In the present invention, the poplar is preferably 84K poplar.

[0037] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0038] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0039] Example 1 Plant cytosine single-base editor and construction method thereof

[0040] The present invention is based on A3A / Y130F-BE3 vector ( Figure 1 a) Construct a plant single-base editor hyPopCBE with high editing efficiency, which contains two core units: a fusion protein expression unit of hA3A / Y130F cytosine deaminase and nCas9 nuclease, and a guide RNA (sgRNA) transcription expression unit. These two core units are driven by Pol II type promoter Ubi and Pol III type promoter AtU3 for transcription respectively; the single-base editor is UbiPromoter-hA3A / Y130F-XTEN linker-bpNLS-hRad51DBD from 5' to 3'. poplar optimized _nCas9ORF-Nucleoplasmin NLS-UGI-SV40 NLS-T2A-SV40 NLS-MCP-5×GS linker-UGI-SV40NLS-AtU3 Promoter-sgRNA cloning scaffold-AtU3 Terminator( Figure 1 b); hA3A / Y130F is the cytosine deaminase coding region; hRad51 DBD poplar optimized It is a human Rad51 single-stranded binding protein optimized by poplar codons; nCas9 ORF is the coding frame of the D10A mutant of Cas9 nuclease protein of Streptococcus pyogenes; T2A is a self-cleaving peptide derived from Thoseaasigna virus; MCP is an MS2 binding protein; and sgRNA cloning scaffold is an sgRNA skeleton containing two MS2 binding sites.

[0041] The fusion protein expression unit of hA3A / Y130F cytosine deaminase and nCas9 nuclease includes the following functional modules from N-terminus to C-terminus: hA3A / Y130F coding region, XTEN linker, bpNLS signal peptide, hRab51 DBD poplar optimized Coding region, nCas9 coding region, Nucleoplasmin NLS signal peptide, UGI coding region, SV40NLS signal peptide, T2A coding region, SV40NLS signal peptide, MCP coding region, GS linker, UGI coding region, SV40NLS signal peptide.

[0042] The amino acid sequence encoded by the hA3A / Y130F cytosine deaminase coding region is The nucleotide sequence encoding hA3A / Y130F cytosine deaminase is , It is shown as 1999bp to 2596bp in SEQ ID NO.6.

[0043] The amino acid sequence of the nCas9 nuclease is

[0044] , As shown in amino acids 380 to 1746 in SEQ ID NO.5;

[0045] The nucleotide sequence encoding the nCas9 nuclease is

[0046]

[0047]

[0048] hRab51 DBD poplar optimized The amino acid sequence encoded by the coding region is The hRab51 DBD poplar optimized The nucleotide sequence is

[0049] The single-base editor further comprises a guide RNA transcription expression unit, wherein the guide RNA transcription expression unit comprises, from the 5' end to the 3' end, an sgRNA cloning site and an sgRNA backbone sequence comprising an MS2 binding sequence; the nucleotide sequence of the sgRNA backbone comprising an MS2 binding sequence is , the underlined part is the MS2 binding sequence.

[0050] The construction method of plant cytosine single-base editor hyPopCBE, the specific steps are as follows:

[0051] Using the dicotyledon single base editing vector A3A / Y130F-BE3 (commercial vector, purchased from the addgene plasmid website) as the basic framework, the XTEN linker peptide, 3×FlAG tag protein, and SV40NLS between the A3A / Y130F deaminase and nCas9 were first removed using NcoI and SbfI restriction endonucleases. Subsequently, the artificially synthesized human Rad51 DBD sequence containing the XTEN linker peptide, bpNLS signal peptide, and poplar codon optimized was ligated to the digested vector using T4 DNA ligase. Next, A3A / Y130F-BE3 was digested with NotI, and the artificially synthesized T2A, SV40NLS, MS2, 5xGS, UGI, SV40NLS, and Nucleoplasmin NLS fusion protein sequences were inserted at the incision. Finally, the original sgRNA multiple cloning site and sgRNA scaffold sequence of A3A / Y130F-BE3 were removed by double restriction enzyme digestion with BsmBI and EcoRI, and the vector backbone without the original sgRNA multiple cloning site and sgRNA scaffold sequence was connected with the artificially synthesized sgRNA multiple cloning site and scaffold sequence containing the MS2 binding site by T4 DNA ligase. The successful construction of the vector was confirmed by sequencing verification, thus obtaining the plant cytosine single base editor hyPopCBE.

[0052] Example 2 Preliminary verification of targeted base editing of plant cytosine single base editor in tobacco

[0053] In order to verify whether the plant cytosine single base editor hyPopCBE obtained in Example 1 can successfully produce base substitutions in dicotyledonous plants, and evaluate its specific improvement relative to the A3A / Y130F-BE3 vector, the present invention selects tobacco NbPDS as the target gene, designs a sgRNA targeting NbPDS (Taeget NbPDS), and the nucleotide sequence of the sgRNA targeting NbPDS is ATACCCCTGAACAAAGAATT (SEQ ID NO.10), and the above-mentioned sgRNA forward and reverse single-stranded primers NbPDS-F / R with added BsmBI restriction sites are incubated in a water bath at 95°C for 3 minutes, and then slowly cooled to room temperature in water to form sgRNA primer dimers. At the same time, the single base editor hyPopCBE vector and the A3A / Y130F-BE3 vector constructed in Example 1 are digested using BsmBI restriction endonuclease. Then, the sgRNA dimer was connected to the hyPopCBE and A3A / Y130F-BE3 vectors after restriction digestion using T4 DNA ligase, thereby constructing the hyPopCBE editing vector and A3A / Y130F-BE3 editing vector targeting the NbPDS gene. The A3A / Y130F-BE3 and hyPopCBE vectors targeting the NbPDS sgRNA were transiently infected into tobacco leaves by Agrobacterium-mediated transient expression. After 3 days of treatment, the genomic DNA of the infected leaves was extracted by CTAB method, and the 123bp NbPDS gene fragment near the target site was amplified by hi-tom-NbPDS-F / R primers. The cytosine editing results of the target region were analyzed by high-throughput sequencing using Hi-TOM ( Figure 2 ). The results showed that, consistent with the performance of the A3A / Y130F-BE3 vector, the single-base editor hyPopCBE also has a wide editing window and is able to edit all potential cytosine sites within the target site. In addition to the expected C to T conversion, the editing process also produced editing byproducts such as C to G / A and C to indel. It is worth noting that compared with A3A / Y130F-BE3 ( Figure 3 a), single base editor hyPopCBE( Figure 3 b) The proportion of editing byproducts was effectively reduced, and the overall byproduct editing efficiency of the four cytosine sites was reduced from 6.80% to 3.53%.

[0054] The above results show that the single-base editor hyPopCBE can successfully achieve base replacement in dicotyledonous plants, while effectively reducing the production of editing by-products.

[0055] Table 1 Primer sequence information involved in constructing NbPDS target

[0056]

[0057] Example 3 Preliminary verification of targeted base editing of plant cytosine single base editor in poplar

[0058] Plant material: Poplar (84K Populus alba×P. glandulosa)

[0059] After confirming the feasibility of the plant cytosine single-base editor hyPopCBE vector in tobacco, it was further verified in poplar. The present invention selects the 197th proline of the poplar herbicide resistance gene PagALS as the target amino acid, which has 4 homologous genes in poplar. A sgRNA (Target PagALS) was designed to simultaneously target 4 PagALS homologous genes, and the sgRNA sequence is CAGGTTCCGCGGCGAATGAT (SEQ ID NO.15). The above-mentioned sgRNA forward and reverse single-stranded primers PagALS-F / R with added BsmBI restriction sites were incubated in a water bath at 95°C for 3 minutes, and then slowly cooled to room temperature in water to form sgRNA primer dimers. At the same time, the single-base editor hyPopCBE vector and the A3A / Y130F-BE3 vector constructed in Example 1 were single-digested using the BsmBI restriction endonuclease. Then, the sgRNA dimer was connected to the hyPopCBE and A3A / Y130F-BE3 vectors after restriction digestion using T4 DNA ligase, thereby constructing the hyPopCBE editing vector and A3A / Y130F-BE3 editing vector targeting the PagALS gene. Figure 4 ). The A3A / Y130F-BE3 vector and the hyPopCBE vector carrying the PagALS sgRNA were transformed into 84K poplar leaves through Agrobacterium-mediated leaf disc transformation to obtain regenerated poplar plants. The genomic DNA of all regenerated poplar plants was extracted by the CTAB method, and the genomic DNA of the regenerated plants was PCR amplified using nCas9-F / R primers. After testing, 43 transgenic poplars containing the A3A / Y130F-BE3 vector and 42 transgenic poplars containing the hyPopCBE vector were obtained. The genomic DNA of the transgenic poplars obtained above was PCR amplified using PagALS15-F / R and PagALS12-F / R as primers, respectively, to obtain the target regions of the four PagALS homologous genes, and Sanger sequencing was performed. According to the sequencing results, the editing of each cytosine in the target site was counted, and the editing efficiency of each cytosine in the target site was calculated ( Figure 5 ).

[0060] Compared with the A3A / Y130F-BE3 vector, the editing efficiency of hyPopCBE at C7 and C8 sites was increased by 5.17% and 5.57%, respectively, while at C 10 and C 13 The editing efficiency of the C7 and C8 sites decreased by 12.69% and 27.64%, respectively. Further comparison of the editing efficiency from C to T revealed that the editing efficiency of hyPopCBE at the C7 and C8 sites increased by 15.73% and 9.76%, respectively, while at the C 10 and C 13 The sites decreased by 1.54% and 8.72% respectively ( Figure 6 a). These results indicate that the editing window of hyPopCBE is significantly narrowed, and the editing efficiency of C to T at C7 and C8 sites is greatly improved, making the editing range more precise.

[0061] In terms of editing byproducts, hyPopCBE also showed significant advantages compared to A3A / Y130F-BE3 vectors. 10 , C 13 site, the C to G byproduct ratios of hyPopCBE decreased by 5.61%, -2.97%, 3.41%, and 3.95%, respectively ( Figure 6 b); the ratio of C to del byproducts decreased by 4.95%, 6.04%, 7.74% and 8.94% respectively ( Figure 6 c). In addition, statistical analysis of the transgenic lines obtained revealed that 19 plants in the transgenic lines edited by A3A / Y130F-BE3 showed a loss of 32 PagALS homologous genes, while only 10 plants in the transgenic lines edited by hyPopCBE showed a loss of 12 PagALS homologous genes ( Figure 6 d). These data fully demonstrate that hyPopCBE not only significantly improves the C to T editing efficiency and editing accuracy, but also greatly reduces the proportion of editing byproducts, providing a powerful tool for more precise gene editing.

[0062] Table 2 Primer sequence information involved in cloning and detection of PagALS gene

[0063]

[0064] Example 4 Application of plant cytosine single base editor in improving the allele editing efficiency and homozygous editing efficiency of poplar single base editing

[0065] There are four PagALS homologous genes in 84K poplar, of which PagALSA01 and PagALSG01, PagALSA02 and PagALSG02 are alleles respectively. For woody plants with heterozygous genomes and containing many alleles, simultaneous knockout of alleles is crucial. The present invention counts the plants in which alleles are effectively edited (plants in which only C to T conversion occurs) in the transgenic plants obtained by A3A / Y130F-BE3 and hyPopCBE, and the statistical method is consistent with the editing efficiency statistical method in Example 3, and the proportion of plants in which alleles are effectively edited from C to T in all transgenic plants is counted.

[0066] The results showed that the proportion of plants with effective allele editing in the transgenic lines edited by A3A / Y130F-BE3 was 27.91%, while that of hyPopCBE was 45.24%. In terms of homozygous editing (all four homologous genes were edited), 4.65% of the lines edited by A3A / Y130F-BE3 underwent homozygous editing, while that of hyPopCBE was 21.43%. The results showed that compared with A3A / Y130F-BE3, the plant cytosine single-base editor hyPopCBE of the present invention significantly improved the editing efficiency of alleles and homozygous genes ( Figure 5 ).

[0067] In order to ensure the specificity and safety of the vector, the present invention also evaluated the off-target effect of hyPopCBE. CRISPR-GE software (http: / / skl.scau.edu.cn) was used to predict potential sgRNA off-target sites with less than 5 base mismatches. According to the prediction score, the following three most likely off-target sites were selected for verification: Offtargte1: TGGGATCTGCGGCGAATGAA (SEQ ID NO.24), Offtargte2: CGGGATCCGTGGCAGATGAT (SEQ ID NO.25), Off target 3: CGGGTTTCGCGGCGGATGGT (SEQ ID NO.26), and three edited transgenic lines obtained by hyPopCBE vector were randomly selected. The predicted potential off-target sites were amplified by PCR using specific primers OFF-T1-F / R, OFF-T2-F / R, and OFF-T3-F / R, and analyzed by sanger sequencing. Sequencing results showed that there was no difference between edited plants and wild-type plants in these potential off-target sites, indicating that the plant cytosine single-base editor hyPopCBE exhibits low off-target mutation efficiency in poplar ( Figure 7 ).

[0068] Table 3 Primer sequence information involved in detecting non-target mutations

[0069]

[0070] In summary, the hyPopCBE system significantly improved the single-base editing efficiency and allele editing efficiency of poplar, and significantly reduced the by-product editing efficiency, which provides new strategies and methods for genome editing of complex genomes of woody plants.

[0071] Example 5 Application of plant cytosine single base editor in preparing herbicide-resistant poplar varieties

[0072] In order to verify the application of the plant efficient cytosine single-base editor hyPopCBE of the present invention in functional gene research, this example analyzes the herbicide resistance of PagALS transgenic plants obtained by the single-base editor hyPopCBE. Among the 42 transgenic plants obtained in Example 3, 11 transgenic plants only had a substitution of proline to leucine at position 197, and 4 of the 4 plants had a substitution of proline to leucine at position 197 in all 4 PagALS homologous genes.

[0073] Transgenic strains in which the 197th proline to leucine substitution occurred in all four PagALS homologous genes were selected for exogenous herbicide spraying and endogenous absorption experiments. In the exogenous herbicide spraying experiment, 3000 mg / L of bensulfuron-methyl herbicide was used for treatment, once every other day, for a total of seven treatments. The growth status of wild-type and transgenic plants was observed, and the results showed that the wild-type plants first showed leaf damage, with yellowing, withering and even falling leaves, while the transgenic plants showed stronger resistance and growth vitality under herbicide treatment. After 45 days of treatment, the wild-type plants showed obvious wilting, the top leaves withered and necrotic, and the plants died. In contrast, the transgenic plants continued to grow ( Figure 8 a); In addition, the transgenic plants and wild-type plants were directly cultured in a rooting medium with 0.5 mg / L of nicosulfuron herbicide. After one month of culture, the growth state of the transgenic plants was significantly better than that of the wild-type plants ( Figure 8 b) These results show that the plant cytosine single-base editing system hyPopCBE constructed by the present invention can successfully mediate base substitution of the target gene in poplar. By editing the 197th proline site of the PagALS gene, the poplar acquired significant herbicide resistance, which not only confirms the effectiveness of the plant cytosine single-base editor obtained by the present invention, but also provides a powerful tool for genetic improvement and functional gene research of poplar.

[0074] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A plant cytosine single base editor, characterized in that: The single-base editor is named hyPopCBE, and the single-base editor comprises a fusion protein expression unit of hA3A / Y130F cytosine deaminase and nCas9 nuclease and a guide RNA transcription expression unit; The amino acid sequence of the hA3A / Y130F cytosine deaminase is shown in SEQ ID NO.1; The amino acid sequence of the nCas9 nuclease is shown in SEQ ID NO.2; The guide RNA transcription expression unit comprises, from the 5' end to the 3' end, a sgRNA multiple cloning site and a sgRNA backbone sequence comprising an MS2 binding sequence; the nucleotide sequence of the sgRNA backbone comprising an MS2 binding sequence is SEQ ID NO.

3.

2. The single base editor according to claim 1, characterized in that The fusion protein expression unit of hA3A / Y130F cytosine deaminase and nCas9 nuclease comprises the following functional modules from N-terminus to C-terminus: hA3A / Y130F deaminase coding region, XTEN linker, BPSV40NLS signal peptide, hRab51DBD poplaroptimized Coding region, nCas9 coding region, NucleoplasminNLS signal peptide, UGI coding region, SV40NLS signal peptide, T2A coding region, SV40NLS signal peptide, MCP coding region, 5×GS linker, UGI coding region, SV40NLS signal peptide.

3. The single base editor according to claim 1, characterized in that hRab51DBD poplaroptimized The amino acid sequence encoded by the coding region is shown in SEQ ID NO.

4.

4. The single base editor according to claim 1, characterized in that The complete amino acid sequence of the single-base editor is shown in SEQ ID NO.

5.

5. A polynucleotide, characterized in that A polynucleotide encoding the single-base editor hyPopCBE according to any one of claims 1 to 4.

6. The polynucleotide according to claim 5, characterized in that The sequence of the polynucleotide is shown as SEQ ID NO.

6.

7. The polynucleotide according to claim 5, characterized in that The nucleotide sequence encoding hA3A / Y130F cytosine deaminase is shown in SEQ ID NO.7; the nucleotide sequence encoding nCas9 nuclease is shown in SEQ ID NO.

8.

8. Use of the single-base editor according to any one of claims 1 to 4, or the polynucleotide according to any one of claims 5 to 7 in single-base editing of plant genomes.

9. Use of the single-base editor according to any one of claims 1 to 4, or the polynucleotide according to any one of claims 5 to 7 in the preparation of herbicide-resistant poplar varieties.

10. The use according to claim 9, characterized in that: The poplar is 84K poplar.

Images