ARNATAR compounds and methods for enhancing cellular uptake

Abstract

The present invention relates generally to the field of compounds and methods for enhancing cellular uptake. In particular, the present invention relates to N-acetylgalactosamine compounds and conjugates thereof. Also provided are methods for preparing these molecules and possible uses thereof, in particular in medicine.

Description

[0001] This application is a divisional application of a patent application with application number 202380022163.7, application date December 18, 2023, and invention name “ARNATAR compounds and methods for enhancing cellular uptake”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This PCT application claims priority to U.S. Provisional Application No. 63 / 433,730 filed on December 19, 2022, U.S. Provisional Application No. 63 / 533,273 filed on August 17, 2023, and U.S. Provisional Application No. 63 / 602,245 filed on November 22, 2023, the entire contents of each of which are incorporated herein by reference.

[0004] Incorporation by Reference of Electronically Submitted Materials

[0005] The computer readable nucleotide / amino acid sequence listing filed concurrently herein is incorporated herein by reference in its entirety and is identified as follows: text file designated "P11885-I-DIV. Sequence Listing".

[0006] This application quotes various publications throughout. All publications, gene transcript identifiers, patents and patent applications mentioned in this specification are incorporated herein by reference to the same extent as each individual publication, gene transcript identifier, patent or patent application was specifically and individually indicated to be incorporated herein by reference. Technical Field

[0007] The present invention generally relates to the field of compounds and methods for enhancing cellular uptake. Specifically, the present invention relates to N-acetylgalactosamine compounds and conjugates thereof. Also provided are methods for preparing these molecules and their uses, particularly in medicine. Background Art

[0008] Drugs, such as oligomeric compounds (e.g., oligonucleotides), need to enter target cells to become active. Oligomeric compounds have been delivered to target cells in a variety of ways, including viral delivery vectors, lipid-based delivery, polymer-based delivery, and conjugate-based delivery (Paunovska et al., Drug Delivery Systems for RNA Therapeutics, 2022, Nature Reviews Genetics, 23(5): 265-280; Chen et al., 2022, Molecular Therapy, Nucleic Acids, 29: 150-160).

[0009] Conjugation of N-acetylgalactosamine (GalNAc) compounds to oligomeric compounds has become a major delivery strategy for delivering oligomeric compounds to cells, such as hepatocytes. Various GalNAc compound conjugates have been previously described in the literature, including the following, all of which are incorporated herein by reference: Sharma et al., 2018, Bioconjugate Chem, 29:2478-2488; Nair et al., 2014, J. Am. Chem. Soc. 136(49):16958-16961; Keam, 2022, Drugs, 82:1419-1425; U.S. Patent No. 10,087,208; Prakash et al., 2014, Nucleic Acids Res, 42(13):8796-807; Debacker et al., 2020, Molecular Therapy, 28(8):1759-1771; Huang et al., 2017, Bioconjugate Chem, 28:283-295; Nairet et al., 2014, Nucleic Acids Res, 42(13):8796-807; Debacker et al., 2020, Molecular Therapy, 28(8):1759-1771; Huang et al., 2017, Bioconjugate Chem, 28:283-295; Nairet et al., 2014, Nucleic Acids Res, 42(13):8796-807; Debacker et al., 2020, Molecular Therapy, 28(8):1759-1771; Huang et al., 2017, Bioconjugate Chem, 28:283-295; al., 2017, Nucleic Acids Res, 45(19): 10969-10977; US Patent 11,110,174; US Patent 9,796,756; US Patent 9,181,549; US Patent 10,344,275; US Patent 10,570,169; US Patent 9,506,030; US Patent 7,582,744; US 8,106,022; US Patent 11,692,001; WO 2022162161; WO 2022162154; WO 2022136466; WO 2021257917; and WO 2021257916.

[0010] Several oligomeric compounds with various types of GalNAc compound conjugates have been approved by the U.S. Food and Drug Administration (FDA) (Moumné et al, Oligonucleotide Therapeutics: From Discovery and Development to Patentability, Pharmaceutics, 2022, 14(2): 260; Friedrich and Aigner, Therapeutic siRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36(5): 549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: 101). However, improved GalNAc compounds for conjugation with pharmaceutical agents are still being sought. Summary of the invention

[0011] The present invention generally relates to novel GalNAc compounds for conjugation with pharmaceutical agents, GalNAc compound conjugates, and preparation processes and uses thereof.

[0012] In one aspect, the present invention relates to compounds having the structure of formula (0):

[0013]

[0014] in

[0015] k is an integer from 1 to 5,

[0016] m is an integer from 0 to 11,

[0017] n is an integer from 0 to 5,

[0018] X is a hydroxyl protecting group or an H atom,

[0019] Y is a hydroxyl protecting group, an H atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0020] R 1 are independently selected from hydroxyl protecting groups and H atoms.

[0021] In one aspect, the present invention relates to a process for preparing a compound having a structure of formula (0):

[0022]

[0023] in

[0024] k is an integer from 1 to 5,

[0025] m is an integer from 0 to 11,

[0026] n is an integer from 0 to 5,

[0027] X is a hydroxyl protecting group or an H atom,

[0028] Y is a hydroxyl protecting group, an H atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0029] R 1 are independently selected from hydroxyl protecting groups and H atoms,

[0030] The process comprises the steps of reacting a compound having the structure of formula (III):

[0031]

[0032] in

[0033] k is an integer from 1 to 5, preferably 3,

[0034] R 2 represents an amino protecting group or a H atom,

[0035] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0036] R 6 represents a hydroxyl protecting group, preferably dimethoxytrityl (DMT) or monomethoxytrityl (MMT), more preferably MMT.

[0037] In another aspect, the present invention relates to a compound having the structure of formula (III):

[0038]

[0039] in

[0040] k is an integer from 1 to 5,

[0041] R 2 represents an amino protecting group or a H atom,

[0042] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0043] R 6represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT. This compound is used in some embodiments of the present invention to prepare a compound of formula (0).

[0044] In another aspect, the present invention relates to compounds having a structure of formula (0) for use in medicine:

[0045]

[0046] in

[0047] k is an integer from 1 to 5,

[0048] m is an integer from 0 to 11,

[0049] n is an integer from 0 to 5,

[0050] X is a H atom,

[0051] Y is a load optionally linked via a spacer, and

[0052] R 1 It is an H atom.

[0053] In a related aspect, the invention relates to the compounds for use in a method of treating a subject comprising cells expressing the asialoglycoprotein receptor (ASGPR) with a cargo.

[0054] In one aspect, the present invention relates to a method for delivering a cargo into a cell expressing an asialoglycoprotein receptor (ASGPR), comprising the step of administering a compound having the structure of formula (0):

[0055]

[0056] in

[0057] k is an integer from 1 to 5,

[0058] m is an integer from 0 to 11,

[0059] n is an integer from 0 to 5,

[0060] X is a H atom,

[0061] Y is a load optionally linked via a spacer, and

[0062] R 1 is a H atom,

[0063] Wherein the cargo is delivered to cells expressing the asialoglycoprotein receptor (ASGPR) in the subject in an amount sufficient to treat the subject with the cargo.

[0064] In another aspect, the present invention relates to a pharmaceutical composition comprising a compound having a structure of formula (0):

[0065]

[0066] in

[0067] k is an integer from 1 to 5,

[0068] m is an integer from 0 to 11,

[0069] n is an integer from 0 to 5, preferably 3,

[0070] X is a H atom,

[0071] Y is a load optionally linked via a spacer, and

[0072] R 1 is a H atom,

[0073] and pharmaceutically acceptable carriers, excipients and / or diluents.

[0074] Additionally, kits and pharmaceutical compositions comprising the compounds of the present invention are also contemplated, including methods of preparation and use. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 : Shows the LMNA mRNA level 51 hours after free uptake of different doses (μM) of GalNAc-conjugated siRNA by human primary hepatocytes (hPH).

[0076] Figure 2 : Shows LMNA mRNA levels over time after free uptake of GalNAc-conjugated siRNA (5 μM) by human primary hepatocytes (hPH).

[0077] Figure 3 : Shows LMNA mRNA levels 60 hours after free uptake of different doses (μM) of GalNAc-conjugated siRNA by mouse hepatocytes (mPH).

[0078] Figure 4 : Shows PCSK9 mRNA levels 4 days after free uptake of different doses (μM) of GalNAc-conjugated siRNA by human primary hepatocytes (HPH). DETAILED DESCRIPTION

[0079] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and do not limit the claimed invention. Herein, unless otherwise expressly stated, the use of the singular includes the plural. As used herein, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms (such as "includes" and "included") is not restrictive. In addition, unless otherwise expressly stated, terms (such as "element" or "component") cover both multiple elements and components comprising one unit and multiple elements and components comprising more than one subunit.

[0080] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety and in the portions of the documents discussed herein.

[0081] definition

[0082] Unless specific definitions are provided, the terms and procedures and techniques used in connection with analytical chemistry, synthetic organic chemistry, and medicine and pharmaceutical chemistry described herein are well known in the art and are commonly used. Standard techniques can be used for chemical synthesis and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK accession numbers, and other data mentioned in the full text of the relevant sequence information and disclosures herein that can be obtained through databases such as the National Center for Biotechnology Information (NCBI) are incorporated by reference to the parts of the files discussed herein and their full text.

[0083] Unless otherwise stated, the following terms have the following meanings:

[0084] "2'-O-methoxyethyl" (also known as 2'-MOE and 2'-O(CH 2 ) 2 -OCH 3 ) refers to an O-methoxyethyl modification at the 2' position of the furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0085] "2'-MOE nucleosides" (also known as 2'-O-methoxyethyl nucleosides) means nucleosides comprising a 2'-MOE modified sugar moiety. "2'-MOE nucleotides" (also known as 2'-O-methoxyethyl nucleotides) means nucleotides comprising a 2'-MOE modified sugar moiety.

[0086] "2'-O-methyl" (also known as 2'-OCH 3 and 2'-OMe) refers to an O-methyl modification at the 2' position of the furanose ring. A 2'-O-methyl modified sugar is a modified sugar.

[0087] "2'-OMe nucleosides" (also known as 2'-O-methyl nucleosides) means nucleosides comprising a 2'-OMe modified sugar moiety. "2'-OMe nucleotides" (also known as 2'-O-methyl nucleotides) means nucleotides comprising a 2'-OMe modified sugar moiety.

[0088] "2'-substituted nucleosides" means nucleosides containing substituents other than H or OH at the 2'-position of the furanose ring. In certain embodiments, 2'-substituted nucleosides include nucleosides with fluorine (2'-F), O-methyl (2'-OMe), O-methoxyethyl (2'-MOE) or bicyclic sugar modifications.

[0089] "5-methylcytosine" means cytosine modified with a methyl group attached to the 5 position. 5-Methylcytosine is a modified nucleobase.

[0090] "About" means within ±7% of a value. For example, if it is stated that "the compound inhibits mRNA by at least about 70%", it implies that the mRNA level is inhibited in the range of 63% to 77%.

[0091] "Animal" refers to human and non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including but not limited to monkeys and chimpanzees.

[0092] "Antibody" refers to a molecule characterized by reacting specifically with an antigen in some manner, wherein antibody and antigen are defined relative to each other. Antibody can refer to a complete antibody molecule or any antigen-binding fragment or region thereof. Examples of such antigen-binding fragments or regions include the heavy chain, light chain, F chain, ab Area and F c district.

[0093] "Antisense oligonucleotide" or "ASO" means a single-stranded oligonucleotide having a nucleobase sequence that allows hybridization with a corresponding region or segment of a target nucleic acid. In certain embodiments, the antisense oligonucleotide comprises one or more ribonucleosides (RNA nucleosides) and / or deoxyribonucleosides (DNA nucleosides). The antisense oligonucleotide may be modified; examples of such modifications include 5-methylcytosine and 2'-MOE.

[0094] "Base complementarity" refers to the ability of a nucleobase of an oligonucleotide to base pair (i.e., hybridize) with a corresponding nucleobase in a target nucleic acid, and is mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonds between the corresponding nucleobases. Base complementarity also refers to classical base pairing (e.g., A:U, A:T, or C:G) or non-classical base pairing (e.g., A:G, A:U, G:U, I:U, I:A, or I:C).

[0095] "Bicyclic sugar" means a furanose ring modified by bridging two non-geminal carbon atoms. Bicyclic sugars are modified sugars.

[0096] "Cap structure" or "terminal cap moiety" means a chemical modification that has been incorporated at either terminus of an oligomeric compound.

[0097] "Chemical modification" means modifying the structure or elements of a naturally occurring molecule. For example, a siRNA compound is composed of linked ribonucleosides (sometimes referred to herein as RNA), and therefore, replacing ribonucleosides with deoxyribonucleosides (sometimes referred to herein as DNA) is considered a chemical modification of a siRNA compound.

[0098] A "chemically distinct region" refers to a region of an oligomeric compound that is chemically distinct in some way from another region of the same oligomeric compound. For example, a region having 2'-OMe nucleotides is chemically distinct from a region having nucleotides without 2'-OMe modification.

[0099] "Chimeric oligomeric compound" means an oligomeric compound having at least two chemically distinct regions, with multiple subunits at each position. For example, as disclosed herein, an siRNA may comprise a peripheral region and a central region. The peripheral region comprises motifs having various modified or unmodified nucleobases to confer increased stability, specificity, safety, and efficacy, while the central region comprises various modified or unmodified nucleobases to serve as substrates for RISC-mediated degradation.

[0100] "Complementarity" refers to the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0101] "Adherence" means that an individual follows the recommended therapy.

[0102] “Comprise,” “comprises” and “comprising” will be understood to imply the inclusion of stated steps or elements or groups of steps or elements but not the exclusion of any other steps or elements or groups of steps or elements.

[0103] "Consecutive nucleobases" means nucleobases that are immediately adjacent to each other.

[0104] "Deoxyribonucleoside" means a nucleoside with a hydrogen at the 2' position of the sugar portion of the nucleoside. Deoxyribonucleosides are sometimes referred to herein as DNA nucleosides, "D" or "d". Deoxyribonucleosides may be modified with any of a variety of substituents and may be linked by covalent bonds other than naturally occurring phosphodiesters (e.g., phosphorothioates).

[0105] "Deoxyribonucleotide" means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides are sometimes referred to herein as DNA nucleotides, "D" or "d". Deoxyribonucleotides may be modified with any of a variety of substituents and may be linked by covalent bonds other than naturally occurring phosphodiesters (e.g., phosphorothioates).

[0106] "Designing" or "design" refers to the process of designing an oligomeric compound that specifically hybridizes to a target nucleic acid molecule.

[0107] "Efficacy" means the ability to produce a desired effect.

[0108] "Expression" includes all functions of converting genetically encoded information into structures that exist and function within the cell. Such structures include, but are not limited to, products of transcription and translation.

[0109] "Fully complementary" or "100% complementary" means that every nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, the first nucleic acid is an oligomeric compound and the target nucleic acid is a second nucleic acid.

[0110] "Fully modified motif" refers to an oligomeric compound comprising a sequence of consecutive nucleosides, wherein substantially every nucleoside has a chemical modification.

[0111] “GalNAc” means “N-acetylgalactosamine.” Thus, a “GalNAc compound” means a compound comprising one or more N-acetylgalactosamine units.

[0112] "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include but are not limited to oligomeric compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include but are not limited to siRNA and nucleic acid targets.

[0113] "Immediately adjacent" means that there are no intervening elements between the adjacent elements.

[0114] "Subject" means a human or non-human animal selected for treatment or therapy.

[0115] "Induce", "inhibit", "enhance", "promote", "increase", "decrease", etc. usually indicate the quantitative difference between two states.

[0116] "Inhibiting expression or activity" means reducing, blocking expression or activity, and does not necessarily mean completely eliminating expression or activity.

[0117] "Internucleoside linkage" refers to the chemical bond between nucleosides.

[0118] "Linked nucleosides" means adjacent nucleosides (e.g., A, G, C, T, or U) linked together by an internucleoside bond. Examples of linked nucleosides include deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) or ribonucleosides (sometimes referred to herein as RNA nucleosides).

[0119] "Mismatch" or "non-complementary nucleobase" refers to a situation where a nucleobase of a first nucleic acid cannot pair with the corresponding nucleobase of a second or target nucleic acid via Watson-Crick base pairing (eg, A:T, A:U, or C:G).

[0120] "Modified internucleoside linkage" refers to a substitution or any alteration of a naturally occurring internucleoside linkage (ie, a phosphodiester internucleoside linkage).

[0121] "Modified base" means any base other than adenine, cytosine, guanine, thymidine or uracil. "Unmodified base" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

[0122] "Modified nucleosides" means nucleosides independently having modified sugar moieties and / or modified nucleobases. As used herein, in the case where the oligomeric compound is based on RNA, the substitution of ribonucleosides with deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) is considered to be a modification of the oligomeric compound. In addition, in the case where the oligomeric compound is based on DNA, the substitution of deoxyribonucleosides with ribonucleosides (sometimes referred to herein as RNA nucleosides) is considered to be a modification of the oligomeric compound.

[0123] "Modified nucleotides" means nucleotides independently having modified sugar moieties, modified internucleoside linkages, deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) substituted for ribonucleosides (sometimes referred to herein as RNA nucleosides), ribonucleosides (sometimes referred to herein as RNA nucleosides) substituted for deoxyribonucleosides (sometimes referred to herein as DNA nucleosides), and / or modified nucleobases.

[0124] By "modified oligonucleotide" is meant an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, a deoxyribonucleoside (sometimes referred to herein as a DNA nucleoside) substituted for a ribonucleoside (sometimes referred to herein as an RNA nucleoside), a ribonucleoside (sometimes referred to herein as an RNA nucleoside) substituted for a deoxyribonucleoside (sometimes referred to herein as a DNA nucleoside), and / or a modified nucleobase.

[0125] "Modified sugar" means the substitution and / or any alteration of a natural sugar moiety.

[0126] "Moiety" means one of the parts into which something is divided, i.e., a portion or component of something. For example, the sugar moiety of a nucleotide is the sugar component of the nucleotide.

[0127] "Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0128] "Motif" means the pattern of modifications in an oligomeric compound. For example, as disclosed herein, ARNATAR designed oligomeric compounds comprising motifs with various modified nucleobases and internucleoside bonds to improve the delivery, stability, specificity, safety, and efficacy of the compounds.

[0129] By "natural sugar moiety" is meant a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0130] By "naturally occurring internucleoside linkage" is meant a 3' to 5' phosphodiester linkage.

[0131] "Non-complementary nucleobases" refers to a pair of nucleobases that do not hydrogen bond or otherwise support hybridization with each other.

[0132] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), messenger RNA (mRNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA) and microRNA (miRNA).

[0133] "Nucleobase" means a heterocyclic moiety capable of base pairing with another nucleic acid.

[0134] "Nucleobase complementarity" refers to a nucleobase that can pair with another nucleobase (also called complementarity). If a nucleobase at a position of an oligomeric compound can form a hydrogen bond with a nucleobase at a position of a target nucleic acid, the position where the oligomeric compound and the target nucleic acid form a hydrogen bond at the nucleobase pair is considered to be complementary. For example, in DNA, adenine (A) is complementary to thymine (T); in RNA, adenine (A) is complementary to uracil (U); and in DNA and RNA, guanine (G) is complementary to cytosine (C). Base pairs or complementary nucleobases are typically classical Watson-Crick base pairs (C:G, A:U or A:T), but also include non-classical base pairs, such as Hoogsteen base pairs (e.g., A:G or A:U), Wobble base pairs (e.g., G:U, I:U, I:A or I:C, where I is hypoxanthine), etc. Nucleobase complementarity facilitates hybridization of an oligomeric compound described herein to its target nucleic acid.

[0135] "Nucleobase sequence" means the order of consecutive nucleobases independent of any sugar, linkage and / or nucleobase modification.

[0136] "Nucleoside" means a nucleobase linked to a sugar.

[0137] "Nucleoside mimetics" include those structures that are not necessarily bonds, such as nucleoside mimetics with morpholinyl, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclic or tricyclic sugar mimetics, such as non-furanose sugar units. Nucleotide mimetics include structures that are used to replace nucleosides and bonds at one or more positions of oligomeric compounds (such as peptide nucleic acids or morpholino compounds (-N (H) -C (=O) -O- or other non-phosphodiester bond-connected morpholino compounds)). Sugar substitutes overlap with slightly wider nucleoside mimetics, but they are only intended to indicate the replacement of sugar units (furanose rings). The tetrahydropyran ring provided herein shows examples of sugar substitutes, wherein the furanose group has been replaced by the tetrahydropyran ring system. "Mockups" refer to groups that replace sugars, core bases and / or nucleoside interkeys. Typically, mimetics are used to replace sugars or sugar-nucleoside interkey combinations, and retain core bases to hybridize with selected targets.

[0138] "Nucleotide" means a nucleoside having a linking group (e.g., a phosphate (P) or phosphorothioate (PS) group) covalently linked to the sugar portion of the nucleoside. Nucleotides include ribonucleotides and deoxyribonucleotides. Ribonucleotides are linked nucleotide units that form RNA. Deoxyribonucleotides are linked nucleotide units that form DNA.

[0139] "Off-target effects" refer to undesirable or deleterious biological effects associated with modulation of RNA or protein expression of genes other than the intended target nucleic acid.

[0140] "Oligomerization activity" means any detectable or measurable activity produced by the hybridization of an oligomeric compound with its target nucleic acid. In certain embodiments, the oligomerization activity is a reduction in the amount or expression of a target nucleic acid or a protein encoded by the target nucleic acid. The oligomerization activity can be regulated by an oligomeric compound (e.g., siRNA).

[0141] "Oligomeric compound" means a connected monomer subunit sequence that can hybridize to at least one region of a target nucleic acid by hydrogen bonding. The monomer subunit can be a modified or unmodified nucleotide or nucleoside. The oligomeric compound acts as a template for RISC, recognizes complementary messenger RNA (mRNA) transcripts, and targets specific mRNA transcripts for cutting. Cutting of the target mRNA blocks the translation of the target mRNA and silences the target gene. Examples of oligomeric compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, ssRNA, siRNA, shRNA, and miRNA.

[0142] "Oligomerization inhibition" means that the level of a target nucleic acid is reduced in the presence of an oligomeric compound that is complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of the oligomeric compound.

[0143] "Oligomerization mechanism" includes RISC or RNase H related mechanisms involving hybridization of an oligomeric compound to a target nucleic acid, wherein the outcome or effect of the hybridization is target degradation and inhibition of gene expression.

[0144] As used herein, "oligonucleotide" means a series of interconnected nucleosides, each of which can be modified or unmodified independently of one another. Oligonucleotide can have a linking group (e.g., phosphorothioate=phosphorothioate group) in addition to a phosphate group, used as a linking portion between nucleosides. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA nucleosides) and / or deoxyribonucleosides (DNA nucleosides).

[0145] As used herein, "load" means any substance transported into a cell by a solvent, and the solvent of the present invention is a GalNAc compound. In the sense of the present invention, "load" includes a pharmaceutical agent, i.e., an agent that provides a biological effect in a cell, such as a therapeutic treatment that causes a disease or condition, or a diagnosis of a disease or condition. Preferred representatives of loads are further described below.

[0146] As used herein, a "peptide" is a compound comprising at least two amino acids linked into a chain, usually by peptide bonds. The peptide may comprise modified amino acids.

[0147] As used herein, a "pharmaceutical agent" is any compound that is pharmaceutically active, ie, a compound that is useful in therapeutic and / or diagnostic methods.

[0148] "Phosphorothioate bond" or "PS" refers to a bond between nucleosides in which the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate bond is a modified internucleoside bond.

[0149] "Portion" means a defined number of consecutive (i.e., connected) nucleobases in a nucleic acid. In certain embodiments, a portion is a defined number of consecutive nucleobases in a target nucleic acid. In certain embodiments, a portion is a defined number of consecutive nucleobases in an oligomeric compound.

[0150] A "region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function, or characteristic.

[0151] "RNA" or "ribonucleic acid" consists of ribose nucleotides or ribonucleotides (nitrogenous bases attached to ribose) linked by phosphodiester bonds, forming chains of varying lengths. The nitrogenous bases in RNA are adenine, guanine, cytosine, and uracil.

[0152] "Ribonucleotide" means a nucleotide having a hydroxyl group at the 2' position of the nucleotide sugar portion. Ribonucleotides may be modified with various substituents and may be linked by covalent bonds other than naturally occurring phosphodiesters (e.g., phosphorothioates). Ribonucleotides are sometimes referred to herein as RNA.

[0153] A "segment" is defined as a smaller region or sub-portion within a target nucleic acid.

[0154] As used herein, a "site" is defined as a unique nucleobase position within a target nucleic acid.

[0155] "Specifically hybridize" refers to an oligomeric compound (e.g., siRNA) that has sufficient complementarity with a target nucleic acid to induce the desired effect, while exhibiting minimal or no effect on non-target nucleic acids under conditions where specific binding is desired (i.e., under physiological conditions in the context of in vivo assays and therapeutic treatments).

[0156] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a very small number of other sequences.

[0157] "Subject" means a human or non-human animal selected for treatment, diagnosis, or therapy.

[0158] "Target" refers to a protein or nucleic acid sequence (eg, mRNA) whose modulation is desired.

[0159] "Target gene" refers to a gene encoding a target.

[0160] "Targeting" means the process of designing and selecting oligomeric compounds that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0161] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all mean a nucleic acid capable of being targeted by an oligomeric compound.

[0162] "Target region" means a portion of a target nucleic acid to which one or more oligomeric compounds are targeted.

[0163] "Target segment" means the nucleotide sequence of the target nucleic acid to which the oligomeric compound is targeted. "5' target site" refers to the 5'-most nucleotide of the target segment. "3' target site" refers to the 3'-most nucleotide of the target segment. In embodiments, the target segment is at least a 12 nucleobase portion of the target region to which the oligomeric compound is targeted (i.e., at least 12 consecutive nucleobases).

[0164] "Therapeutic effect" refers to the effectiveness of a therapeutic compound (eg, an oligomeric compound). Therapeutic effect can be improved by improving the delivery, stability, specificity, safety, and efficacy of the therapeutic compound.

[0165] "Unmodified" RNA nucleobases refer to the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). "Unmodified" DNA nucleobases refer to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T) and cytosine (C). In certain embodiments, when a DNA nucleobase replaces an RNA nucleobase, the unmodified RNA nucleobase is considered modified. In certain embodiments, when an RNA nucleobase replaces a DNA nucleobase, the unmodified DNA nucleobase is considered modified.

[0166] "Unmodified nucleotide" means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside bonds. In certain embodiments, the unmodified nucleotide is an RNA nucleotide or a DNA nucleotide.

[0167] Subject matter of the invention

[0168] The present invention provides novel N-acetylgalactosamine-containing compounds (i.e., GalNAc compounds) for enhancing cellular uptake. Interestingly and completely unexpectedly, it has been found that when conjugated to a payload (e.g., an oligonucleotide), the novel GalNAc compounds have enhanced activity in cells compared to prior art GalNAc compounds that are very close in structure.

[0169] The present invention also provides a novel method for preparing the novel GalNAc compound and an intermediate compound that is very suitable for the novel method. In addition, the present invention also provides possible uses and methods of the novel GalNAc compound, especially uses in medicine.

[0170] GalNAc compounds

[0171] In one aspect, the present invention relates to compounds having the structure of formula (0):

[0172]

[0173] in

[0174] k is an integer from 1 to 5, preferably 2 or 3, more preferably 3,

[0175] m is an integer from 0 to 11, preferably from 7 to 9, more preferably 7, and

[0176] n is an integer from 0 to 5, preferably 2 or 3, more preferably 3,

[0177] X is a hydroxyl protecting group or an H atom,

[0178] Y is a hydroxyl protecting group, an H atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0179] R 1 are independently selected from hydroxyl protecting groups and H atoms.

[0180] Compound (0) comprises a trimerization unit comprising an N-acetylgalactosamine (GalNAc) unit. In the compounds of the present invention, the cyclic sugar moiety is based on D-galactose, i.e. (2R,3S,4S,5R)-2,3,4,5,6-pentahydroxyhexanal. 1 In the case of the compound (O), the compound (O) may be a GalNAc compound conjugate having a load (e.g., compound (I)) or an intermediate GalNAc compound (e.g., compound (II)) for synthesizing a GalNAc compound conjugate. As used herein, the term "GalNAc compound" encompasses a GalNAc compound conjugate having a load and an intermediate GalNAc compound.

[0181] The GalNAc units are connected by a linker containing three variable moieties that can contain different numbers of -CH 2 - group or -OCH 2-repetition of the group, represented by the integer k, m or n, respectively. Herein, k is an integer from 1 to 5, preferably 2 or 3, more preferably 3; m is an integer from 0 to 11, preferably 7 to 9, more preferably 7; and n is an integer from 0 to 5, preferably 2 or 3, more preferably 3. In one embodiment, the sum of k and m is an integer from 8 to 12, preferably 10. It has been found that this length of linker is particularly useful in GalNAc compounds. In a preferred embodiment, k is 3, m is 7 and n is 3, and the compound has the structure of formula (0a):

[0182]

[0183] In compound (0) and / or compound (0a), residues X, Y and R 1 R may represent a hydroxyl protecting group or a H (hydrogen) atom. The residue may be independently selected from all possible hydroxyl protecting groups and H atoms. Preferred hydroxyl protecting groups include acetyl, benzoyl, phenoxyacetyl, pivaloyl, monomethoxytrityl (MMT), dimethoxytrityl (DMT), isobutyryl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triisopropylsilyl and isopropyldimethylsilyl. Preferred hydroxyl protecting groups are residues R 1 The acetyl group of residue X and / or the monomethoxytrityl (MMT) or dimethoxytrityl (DMT) of residue X have been found to be particularly useful in the synthesis of the GalNAc compounds of the present invention and the coupling of the payload to the intermediate GalNAc compound. In particular, MMT will be used in oligonucleotide synthesis. 2 OX and -CH 2 The symmetry of the OY groups therefore includes these groups in the formula regardless of the preparation process. However, it should be understood that if the solid support is present as a Y residue, the oligonucleotide will be attached to the other residue, namely the X residue.

[0184] Residues X and R 1 Each of X and R may represent an H atom. In one embodiment of the GalNAc compound conjugate with a load, preferably X and R 1 The residues are each H atoms.

[0185] Residue Y may also be a cargo or solid support, optionally linked via a spacer.

[0186] In one embodiment, residue Y is a load. In this embodiment, the GalNAc compound can be a final conjugate for introducing into cells or for therapeutic use. As defined above, load is any substance transported to cells by a solvent, and the solvent of the present invention is a GalNAc compound. In the sense of the present invention, load includes a medicament, i.e., a reagent providing a biological effect in a cell, such as a therapeutic treatment causing a disease or condition, or a diagnosis of a disease or condition. In the present invention, a preferred load includes an oligomeric compound, including any oligonucleotide (i.e., modified or unmodified), a peptide, an antibody, an antibody fragment, or a compound with pharmaceutical activity. It should be understood that each of these compounds can be directly or by a spacer suitable for each compound conjugated to a (intermediate) GalNAc compound conjugated. Therefore, even if it is not explicitly stated, the load within the meaning of the present invention can also include a spacer.

[0187] In some embodiments, the load comprises an oligomeric compound, preferably an oligonucleotide. Oligomeric compounds include, but are not limited to, single-stranded oligomeric compounds, such as microRNA (miRNA), single-stranded RNA (ssRNA) and antisense oligonucleotides (ASO); and double-stranded oligomeric compounds, such as short hairpin RNA (shRNA) and small interfering RNA (siRNA). The oligomeric compound can be "antisense" or contain an "antisense strand" for a target nucleic acid, which means that it can hybridize with the target nucleic acid through hydrogen bonding.

[0188] In certain embodiments, the oligomeric compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted. For example, in certain such embodiments, the siRNA comprises an antisense strand that has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted.

[0189] In certain embodiments, the length of the oligomeric compound is 12-30 subunits (e.g., nucleotides or nucleosides). In certain embodiments, the length of the oligomeric compound is 18 to 30 subunits. In certain embodiments, the length of the oligomeric compound is 12 to 22 subunits. In some embodiments, the oligomeric compound is siRNA.

[0190] It is possible to increase or decrease the length of an oligomeric compound (e.g., siRNA), and / or introduce base mismatches without eliminating activity (U.S. Pat. No. 7,772,203, incorporated herein by reference). For example, it is possible to introduce non-classical base pairings (e.g., A:G, A:C, G:U, I:U, I:A, or I:C) into an oligomeric compound without eliminating activity. In certain embodiments, an oligomeric compound designed to have one or more non-classical base pairings (i.e., mismatches) enhances the activity of the oligomeric compound.

[0191] The oligomeric compound may contain mismatches to the target, mismatches between oligomeric strands within the duplex, or a combination of both. Mismatches may occur throughout the siRNA, for example in the overhang region or in the duplex region.

[0192] In several embodiments, the oligomeric compound is single-stranded (e.g., single-stranded oligonucleotides, single-stranded RNA (ssRNA)) or double-stranded (e.g., shRNA and siRNA), and is modified. The single-stranded oligomeric compound comprises a sense strand or an antisense strand. The double-stranded oligomeric compound comprises a sense strand and an antisense strand. The antisense strand can be fully or partially complementary to the target nucleic acid.

[0193] Oligomeric compounds, preferably oligonucleotides, can generally be modified and / or unmodified compounds. Nucleoside is a base-sugar combination. The core base (also referred to as base) portion of a nucleoside is generally a heterocyclic base portion. Nucleotide is a nucleoside that further includes a covalent bond (e.g., a phosphate group or a chemically modified bond as described below) with the sugar portion of a nucleoside. Oligonucleotides are formed by covalently linking adjacent nucleotides to each other to form a linear polymeric oligonucleotide. In the oligonucleotide structure, a bond group is generally referred to as a nucleoside bond forming an oligonucleotide. Oligomeric compounds are composed of one (e.g., ssRNA, antisense oligonucleotide or miRNA) or multiple oligonucleotides (e.g., siRNA or shRNA).

[0194] Modifications to oligomeric compounds encompass substitutions or changes to nucleobases, internucleoside bonds, or sugar moieties. Modified oligomeric compounds are generally more preferred than native or unmodified forms because modified oligomeric compounds have desired properties, e.g., enhanced delivery (e.g., increased cellular uptake), enhanced specificity or affinity to nucleic acid targets, increased stability in the presence of nucleases, enhanced safety (e.g., fewer side effects after compound administration to a subject) or enhanced efficacy (e.g., inhibitory activity).

[0195] The modified oligomeric compound, preferably a modified oligonucleotide, preferably comprises a modified nucleobase or an internucleoside linkage. In some embodiments, the oligomeric compound, preferably an oligonucleotide, is modified to resist degradation, reduce toxicity and / or enhance activity.

[0196] In certain embodiments, the oligomeric compounds disclosed herein have chemically modified subunits arranged in motifs to give the oligomeric compounds beneficial properties, including but not limited to: enhanced inhibitory activity to improve efficacy; increased binding affinity to increase specificity to target nucleic acids, thereby limiting off-target effects and improving safety; or enhancing resistance to in vivo nuclease degradation, thereby improving stability and durability. In certain embodiments, the oligomeric compound is a chimera, wherein the peripheral core base of the oligomeric compound comprises a motif with various modified or unmodified core bases, thereby giving increased stability, specificity, safety and efficacy, and the central region of the compound comprises various modified or unmodified core bases to serve as substrates for RISC-mediated degradation. Each different region may contain uniform sugar moieties, modified or alternating sugar moieties. Each region may contain different patterns of phosphate and phosphorothioate bonds.

[0197] In certain embodiments, the sense strand comprises one or more phosphorothioate internucleotide (PS) bonds between two nucleosides. In further embodiments, the sense strand comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). The PS bond can be adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side or both sides. The PS bond can also be adjacent to two nucleosides at the 5' end of the chain and / or adjacent to two nucleosides at the 3' end of the chain. In one embodiment, the oligomeric compound is ssRNA or siRNA.

[0198] The oligomeric compound (preferably an oligonucleotide) can be attached to the GalNAc compound via the 3' or 5' end of the chain. In some embodiments, the oligomeric compound (preferably an oligonucleotide) is attached to the GalNAc compound via the 3' end of the sense strand. In some embodiments, the oligomeric compound (preferably an oligonucleotide) is attached to the GalNAc compound via the 5' end of the sense strand.

[0199] In several embodiments, the oligomeric compound is a modified and / or unmodified oligonucleotide. In some embodiments, the oligonucleotide is a modified oligonucleotide, which is modified to resist degradation, reduce toxicity and / or enhance activity. Preferably, the modified and / or unmodified oligonucleotide is combined with the target nucleotide sequence and modifies the expression of the gene encoded by the target nucleotide sequence. In some embodiments, the modified and / or unmodified oligonucleotide suppresses the expression of the gene encoded by the target nucleotide sequence, preferably by suppressing the transcription or translation of the target nucleotide sequence. In some embodiments, the target nucleotide sequence of the modified and / or unmodified oligonucleotide is related to liver disease (preferably metabolic liver disease), for example, the target nucleotide sequence of the modified and / or unmodified oligonucleotide encodes a gene related to a disease expressed in the liver, or a gene related to liver disease (preferably metabolic liver disease).

[0200] In certain embodiments, the oligomeric compounds (preferably oligonucleotides) described herein inhibit expression of a target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0201] Several embodiments relate to regulating gene expression by inhibition by oligomeric compounds.In several embodiments, the target nucleotide sequence is messenger RNA (mRNA).

[0202] In certain embodiments, inhibition of laminin (LMNA) gene expression in a cell is intended and comprises administering to the cell an oligomeric compound targeted to an mRNA transcript of LMNA.

[0203] In certain embodiments, inhibition of apolipoprotein C3 (ApoC3) gene expression in a cell is intended and comprises administering to the cell an oligomeric compound targeted to ApoC3 mRNA transcripts.

[0204] In certain embodiments, inhibition of nucleolin (NCL) gene expression in a cell is intended and comprises administering to the cell an oligomeric compound targeted to an mRNA transcript of NCL.

[0205] In some embodiments, hybridization occurs between an oligomeric compound and an mRNA.The most common hybridization mechanism involves hydrogen bonding (eg, Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of nucleic acid molecules.

[0206] The GalNAc-load conjugates according to the present invention can be specifically designed to bind to the asialoglycoprotein receptor (ASGPR). Thus, according to some embodiments, the GalNAc-load conjugates according to the present invention have a strong affinity for ASGPR. For the purposes of the present invention, "strong affinity" means that the binding affinity is determined by IC 50 The affinity is characterized by an IC value of less than 50 nM, preferably 25 nM or lower, more preferably 10 nM or lower, more preferably 5 nM or lower. 50 is the concentration of GalNAc-loaded conjugate that inhibits the binding of labeled ligand to ASGPR by 50%. 50 It can be determined by the method described in Rensen et al. 2001 Journal of Biological Chemistry Vol 276 pp 37577. Briefly, hepatocytes (primary or cultured) are incubated with the ligand in the presence of increasing amounts of the GalNAc-loaded conjugate to be investigated. 125I-labeled sialylated serum mucoid (ASOR) is incubated at a certain concentration (e.g., 5 nM) at 4 °C for 2 h. The concentration can be from 0.2 nM to 200 nM at increasing concentrations. The binding of labeled ASOR is followed in the presence of the GalNAc-load conjugate to be studied. Nonspecific binding can be determined in the presence of 100 mM GalNAc. Displacement binding data can be analyzed using a single-site binding model and the IC can be calculated. 50 .

[0207] The asialoglycoprotein receptor (ASGPR) is usually expressed on hepatocytes, and therefore, the GalNAc-load conjugate according to the present invention is particularly suitable for transport to hepatocytes. Therefore, the GalNAc-load conjugate can be specifically designed by selecting the corresponding load for the prevention, treatment or diagnosis of liver diseases or disorders or metabolism triggered by the liver. Specifically, the cargo can be designed to treat diseases such as hepatitis (including viral hepatitis, such as HBV or HCV), hepatic steatosis (including metabolic dysfunction), atherosclerosis, hyperlipidemia, hypercholesterolemia, familial hypercholesterolemia (e.g., gain-of-function mutations in apolipoprotein B), HDL / LDL cholesterol imbalance, dyslipidemia (e.g., familial hyperlipidemia (e.g., familial combined hyperlipidemia (FCH), familial hypercholesterolemia (FH)), acquired hyperlipidemia, statin-resistant hypercholesterolemia, coronary artery disease (CAD) and coronary heart disease (CHD), acute coronary syndrome (ACS), liver fibrosis (or diseases associated with liver fibrosis), cirrhosis and cancer. Thus, in some embodiments, the GalNAc-cargo conjugate is designed to treat a liver disorder (preferably a metabolic liver disorder) and / or for use in treating a liver disorder (preferably a metabolic liver disorder).

[0208] The asialoglycoprotein receptor (ASGPR) is also expressed on testicular cells.Thus, in some embodiments, the GalNAc-payload conjugate is designed for and / or for use in treating a testicular disorder.

[0209] The asialoglycoprotein receptor (ASGPR) is also expressed on cells other than liver and testis. In some embodiments, the GalNAc-cargo conjugate is designed to deliver the GalNAc-cargo conjugate to cells expressing the ASGPR.

[0210] In a preferred embodiment of the GalNAc compound conjugate with a load, the GalNAc compound has the structure of formula (I):

[0211]

[0212] Wherein Oligo represents a modified and / or unmodified oligonucleotide, as described above.

[0213] In an even more preferred embodiment of the conjugate with a loaded GalNAc compound, the GalNAc compound has the structure of formula (Ia):

[0214]

[0215] Embodiments of conjugates having a loaded GalNAc compound having a structure of Formula (I) or Formula (Ia) can be prepared using any of the features and any of the embodiments described above.

[0216] In addition to oligomeric compounds, the load may also include peptides, antibodies, antibody fragments or compounds with pharmaceutical activity. Due to the general definition of load herein, any molecule will have pharmaceutical activity. Several drugs based on peptides, antibodies or antibody fragments or other compounds are known in the art. Generally, it is possible to use the GalNAc compound of the present invention to conjugate with these molecules for transport to cells, where these molecules can show their pharmaceutical activity.

[0217] In one embodiment, the load comprises a peptide. Preferably, the peptide comprises a sequence of at least 2 amino acids (e.g., at least 3 or at least 4 amino acids or more amino acids). The amino acids may be natural amino acids and modified amino acids. Modified amino acids are known in the art. In a preferred embodiment, the peptide is the amino acid sequence of a specific protein. As used herein, a peptide may encompass a portion of a specific protein or the entire amino acid sequence of a specific protein, wherein the amino acids may be modified and / or unmodified. Therapeutic peptides are known in the art, and, for example, described in Wang et al., Therapeuticpeptides: current applications and future directions. Sig Transduct Target Ther 7, 48 (2022), which is incorporated herein by reference. Examples of therapeutic peptides for treating liver diseases are PGPIPN and FFW, as disclosed in Qi et al., Therapeutic hexapeptide (PGPIPN) prevents and cures alcoholic fatty liver disease by affecting the expressions of genes related with lipidmetabolism and oxidative stress. Oncotarget. 2017 Sep 30; 8(50): 88079-88093; or National University of Singapore. "Scientists develop novel drug that could potentially treat liver cancer more effectively: Peptide drug FFW shows promise in reducing tumour growth and slowing down spread of cancer cells." ScienceDaily, 2 August 2018. www.sciencedaily.com / releases / 2018 / 08 / 180802102347.htm.Peptide compounds with potential for treating liver fibrosis are disclosed in Xun et al., Peptide mediated therapy in fibrosis: Mechanisms, advances and prospects, Biomedicine & Pharmacotherapy, Volume 157, 2023, 113978.

[0218] In one embodiment, the payload comprises an antibody or antibody fragment. Antibody fragments are preferably F fragments that can be generated from the variable region of an antibody (e.g., IgG and / or IgM). (ab’)2 、F ab 、F ab’ and F v fragment, and is an antigen-binding fragment.

[0219] In one embodiment, the load comprises a chemical compound with pharmaceutical activity. Preferably, the chemical compound is different from other molecules described as loads because it is a non-peptide compound, a non-oligonucleotide compound and does not contain any antibody or antibody fragment. Typically, the chemical compound is an organic molecule with biological activity, such as a so-called "small molecule" used as a drug. Suitable compounds for treating liver diseases are, for example, described in Muriel P, Rivera-Espinoza Y. Beneficial drugs for liver diseases. J Appl Toxicol. 2008 Mar; 28 (2): 93-103. doi: 10.1002 / jat.1310. PMID: 17966118. Suitable examples are colchicine, corticosteroids, curcumin, glycyrrhizic acid, interferon, resveratrol, sulfadenosylmethionine and thalidomide.

[0220] In one embodiment of the compound of formula (0), residue Y is a solid support, optionally including a spacer. In this embodiment, the corresponding GalNAc compound can be used to synthesize a GalNAc compound conjugate. In principle, any solid support known in the art for attaching compounds, particularly attaching and solid phase synthesis nucleotide sequences can be used. In certain embodiments, the solid support is a CPG solid support, such as a LCAA (log chain alkylamine) spacer CPG support. In certain embodiments, the solid support is a polymer support known in the art for solid phase synthesis, such as a polystyrene solid support, such as an aminomethyl polystyrene support. The synthesis on a solid support is well known in the art, and, for example, is described in Current Protocols in Nucleic Acid Chemistry (2000) 3.1.1-3.1.28.

[0221] In a preferred embodiment, the GalNAc compound is connected to the solid support via a spacer. The spacer may comprise a spacer (2) and / or a spacer (1). The spacer (2) is typically a spacer specific for the particular solid support used. Typically, the solid support is already attached with a spacer (2) when purchased. It may be, for example, an LCAA (log-chain alkylamine) spacer (such as for a CPG support) or a spacer specific for an aminomethyl polystyrene support (typically containing an amine spacer). The spacer (1) may comprise or be a dicarboxylic acid derivative portion. The dicarboxylic acid derivative portion may comprise two carboxyl groups, or one or both of the two carboxyl groups may be modified to an amide group. In a particular embodiment, the spacer (1) comprises at least one carboxyl group, and the carboxyl group reacts with the amine-containing group of the spacer (2) to obtain an amide group. Preferably, the dicarboxylic acid derivative portion has 3 to 10 carbon atoms, i.e., it may have 1 to 8 carbon atoms between the carboxyl and / or amide groups. 1 to 8 carbon atoms may be a straight or branched chain alkylene group having 1 to 8 carbon atoms (one or more of which may be replaced by O, S, NH and / or N-(C 1 -C 3 Preferably, the dicarboxylic acid-derived moiety is derived from succinic acid, 2,2-dimethylsuccinic acid, glutaric acid, adipic acid, 1,2-cyclohexanedicarboxylic acid, dimethyl ether, dimethyl sulfide and / or dimethylamine. The spacer (1) can be prepared by using the anhydride of the respective dicarboxylic acid.

[0222] In general, the spacer of residue Y can be any moiety suitable for its intended function to provide space between two or more units. Preferably, the spacer comprises an alkylene moiety, for example, C 2-10 The alkylene group is optionally substituted with heteroatoms to facilitate removal of the spacer after reaction of the GalNAc compound with the payload.

[0223] The residue Y may also be an H atom or a hydroxyl protecting group, such as any of the groups defined above. In one embodiment, the residue Y is an H atom. In another embodiment, the residue Y is a hydroxyl protecting group, preferably selected from any of the hydroxyl protecting groups defined above.

[0224] In a preferred embodiment, the GalNAc compound used to synthesize the GalNAc compound conjugate has the structure of formula (II):

[0225]

[0226] in

[0227] k, m and n are as defined above,

[0228] R 1 independently selected from hydroxyl protecting groups and H atoms as defined above, preferably an acetyl group,

[0229] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, and

[0230] R 7 The part of formula (VI):

[0231]

[0232] in

[0233] R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom,

[0234] Z represents NH or O, and

[0235] R 8 represents a straight or branched alkylene group having 1 to 8 carbon atoms, wherein one or more carbon atoms are optionally replaced by O, S, NH and / or N—(C 1 -C 3 alkyl) (e.g., N-methyl, N-ethyl and / or N-propyl); and / or a cycloalkylene group having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene, 1,2-cyclohexylene, dimethylene oxide, dimethylene sulfide and / or dimethylene methylamine.

[0236] In some preferred embodiments, R 7 Represents a portion of any one of formulae (VIa1) to (VIa8):

[0237]

[0238]

[0239] In some preferred embodiments, R 7 It represents a part of either formula (VIa3) or formula (VIa4).

[0240] In a further preferred embodiment, the GalNAc compound used to synthesize the GalNAc compound conjugate has the structure of formula (IIa):

[0241]

[0242] Where R 1 , R 6 and R 7 As defined above.

[0243] In some embodiments of the compound of Formula (II) or Formula (IIa), wherein the moiety R 7 In Z represents NH group, residue R represents amino protecting group, and amino protecting group preferably comprises 9-fluorenylmethyl carbamate (Fmoc), tert-butyl carbamate (Boc), benzyl carbamate, acetamide, trifluoroacetamide, benzylamine, triphenylmethylamine (tritylamine), p-toluenesulfonamide and / or toluenesulfonamide.Although use above terms, it will be appreciated by those skilled in the art that residue R constitutes aforesaid group together with N-unit.Amino protecting group can also be used, by eliminating H atom from N atom, forming phthalimide and benzylimine.

[0244] In some embodiments of the compound of Formula (II) or Formula (IIa), wherein the moiety R 7 wherein Z represents an O atom, the residue R represents a hydroxyl protecting group, and the hydroxyl protecting group is preferably selected from acetyl, benzoyl, phenoxyacetyl, pivaloyl, dimethoxytrityl (DMT), monomethoxytrityl (MMT), isobutyryl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triisopropylsilyl and isopropyldimethylsilyl.

[0245] In certain embodiments, the structures of Formula (II) and Formula (IIa) are 7 The residue R in is a solid support, optionally connected via a spacer, in particular a solid support as defined above. The respective (intermediate) GalNAc compounds are particularly suitable for the attachment of nucleotides and are therefore suitable for the preparation of GalNAc compounds conjugated to oligonucleotides, such as those shown in the structures of formula (I) and formula (Ia), respectively.

[0246] Compounds for preparing GalNAc compounds

[0247] In one aspect, the present invention relates to compounds, i.e., intermediate compounds, for preparing the GalNAc compounds of the present invention. In one embodiment, the intermediate compound is a compound having a structure of formula (III):

[0248]

[0249] in

[0250] k is an integer as defined above, preferably 3,

[0251] R 2 represents an amino protecting group or a H atom,

[0252] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0253] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0254] In some embodiments of the compound of formula (III), the residue R 2 represents an amino protecting group, and the amino protecting group preferably comprises 9-fluorenylmethylcarbamate (Fmoc), tert-butylcarbamate (Boc), benzylcarbamate, acetamide, trifluoroacetamide, benzylamine, triphenylmethylamine (tritylamine), p-toluenesulfonamide and / or toluenesulfonamide. Although the above terms are used, those skilled in the art will understand that the residue R 2 Together with the N unit, the above-mentioned groups are formed. It is also possible to use amino protecting groups to form phthalimides and benzylimides by eliminating H atoms from N atoms.

[0255] In some embodiments of the compound of formula (III), the residue R 3 represents a solid support, optionally linked via a spacer or a hydroxyl protecting group.

[0256] In some embodiments of the compound of formula (III), the residue R 3 represents a hydroxyl protecting group, which is preferably as described above for X, Y and R 1 The hydroxyl protecting group of the residue is defined as follows.

[0257] In some specific embodiments of the compound of formula (III), the residue R 2 represents an amino protecting group, preferably 9-fluorenylmethylcarbamate (Fmoc), and / or the residue R 3 Represents an H atom. In a specific embodiment, the compound of formula (III) has the structure of formula (IIIa):

[0258]

[0259] In some specific embodiments of the compound of formula (III), the residue R 2 represents H atoms, and / or residues R 3 Represents a solid support, optionally connected via a spacer. In some further specific embodiments, the compound of formula (III) has the structure of any one of formulas (IIIb1) to (IIIb5):

[0260]

[0261]

[0262] in

[0263] R represents a solid support, optionally linked via a spacer, an amino protecting group or an H atom, and

[0264] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0265] In some specific embodiments, the compound of formula (III) has the structure of any of formula (IIIb3) or formula (IIIb4) as defined above.

[0266] In certain embodiments of compounds of formula (IIIb1) to (IIIb5), the R residue is a solid support, optionally linked via a spacer, as defined above for a solid support (eg, as defined for a Y residue).

[0267] Process for preparing GalNAc compounds

[0268] In one aspect, the present invention relates to a process for preparing a compound having a structure of formula (0) in any of the above embodiments (e.g., compound (0a)). In some embodiments, the process is a process for preparing a compound having a structure of formula (I) and / or formula (II) in any of the above embodiments (e.g., compound (Ia) and / or compound (IIa)).

[0269] The process comprises the step of reacting a compound having the structure of formula (III) as defined above. This compound is very suitable as an intermediate compound for preparing the GalNAc compound of the present invention.

[0270] In some embodiments of the process, the process includes the step of reacting a compound having the structure of formula (IV):

[0271]

[0272] in

[0273] m is an integer as defined above,

[0274] R 4 express and

[0275] R 5 represents a hydroxyl protecting group, preferably a benzyl group.

[0276] It has been found that the compound of formula (IV) is very suitable as a further intermediate compound for preparing the GalNAc compound of the present invention and provides the GalNAc compound in high yield.

[0277] In some embodiments, the process includes the following steps:

[0278] a) providing a compound having the structure of formula (III):

[0279]

[0280] in

[0281] k is an integer as defined above,

[0282] R 2 represents H atoms,

[0283] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0284] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT;

[0285] b) providing a compound having a structure of formula (V):

[0286]

[0287] in

[0288] m and n are integers as defined above, and

[0289] R 1 independently selected from hydroxy protecting groups, e.g., as defined above, preferably an acetyl group; and

[0290] c) reacting the compound of formula (III) provided in step a) with the compound of formula (V) provided in step b) to obtain a compound of formula (O), wherein Y is an H atom, a hydroxyl protecting group or a solid support, optionally linked via a spacer, and X is a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, or to obtain a compound of formula (II) in any embodiment as defined above.

[0291] In some embodiments, the process further comprises a step d) of reacting the compound obtained in step c) to obtain a compound of formula (0), wherein Y is a charge, and X and R 1Each is an H atom, or to obtain a compound of formula (I) in any embodiment as defined above. This step may include the direct addition of a load or a load precursor, and / or further reaction of the compound obtained in step c) to add an optional linker and a solid support. The load precursor may be any compound that results in the attachment of the load to the (intermediate) GalNAc compound. Due to -CH 2 OX and -CH 2 The symmetry of the OY groups, regardless of how they are prepared, includes these groups in the formula. However, it should be understood that if the solid support is present as a Y residue, the payload will be attached to another residue, namely the X residue.

[0292] In these embodiments, the residue R 3 Preferably, the residue R in the compound of formula (0) is as defined above, including the above-mentioned solid support and the definition of the hydroxyl protecting group of the Y residue. 3 and the residue R in the intermediate compound (III) 3 are the same or are H atoms. More preferably, R 3 With R 7 are the same, and represent a portion of any one of formulae (VIa1) to (VIa5):

[0293] Preferably, compound (V) is prepared by using compound (IV) and further reacted with the compound of formula (III) provided in step a) of the process.

[0294] In certain embodiments, a compound of formula (II) or (IIa) is prepared in step c) and can be further reacted to give a compound comprising a charge, such as a compound of formula (I) or (Ia).

[0295] In some embodiments of the process, the compound of formula (III) comprises a solid support, i.e., the residue R 3 Represents a solid support, optionally connected by a spacer. Thus, compound (V) reacts directly with compound (III) comprising a solid support, and a load can be attached in step d), which is followed by the reaction of step c). In particular, embodiments of this process are very suitable for preparing GalNAc compound conjugates with oligonucleotides, such as those of formula (I) or formula (Ia).

[0296] In a preferred embodiment, in step d) of the process, the compound of formula (I) is formed by adding modified and / or unmodified nucleotides and cleaving the GalNAc compound conjugate from the solid support using standard phosphoramidite chemistry (as described in the Examples section herein). In this way, a GalNAc compound conjugate with an oligonucleotide can be easily provided.

[0297] In some embodiments, in step d) of the process, a compound of formula (0), wherein Y is a hydroxyl protecting group, an H atom, or a solid support, optionally linked through a spacer, is reacted with a load or a load precursor to give a compound of formula (0), wherein Y is a load and X is an H atom.

[0298] Application of GalNAc compound conjugates

[0299] In one aspect, the invention relates to compounds having the structure of formula (0) as defined above, wherein all residues X and R 1 Each is an H atom and residue Y is a payload, for use in a method of treating a subject or diagnosing a subject with a disease or disorder comprising a cell expressing an asialoglycoprotein receptor (ASGPR). The payload may be any of the payloads in the above embodiments.

[0300] In some embodiments, the compound used has the structure of formula (I). In some preferred embodiments, the compound used has the structure of formula (Ia). In one embodiment, the modified and / or unmodified oligonucleotides in formula (I) or formula (Ia) are combined with the target nucleotide sequence in the hepatocyte, and modify the expression of the gene encoded by the target nucleotide sequence. Expression modification is understood herein to change expression by increasing or decreasing the expression rate. In some preferred embodiments, modified and / or unmodified oligonucleotides inhibit the expression of the gene encoded by the target nucleotide sequence.

[0301] In one aspect, the present invention relates to a method for delivering a cargo into a cell expressing an asialoglycoprotein receptor (ASGPR), comprising the step of administering a compound having a structure of formula (0) as defined above, wherein residues X and R 1 All are H atoms, and residue Y is a cargo, wherein the cargo is transported to cells expressing asialoglycoprotein receptor (ASGPR) in a subject in an amount sufficient to treat the subject with the cargo. The cargo can be any cargo in the above embodiments.

[0302] In some embodiments of the method, the compound has the structure of formula (I). In some preferred embodiments of the method, the compound has the structure of formula (Ia). In some embodiments of the method, modified and / or unmodified oligonucleotides in formula (I) or formula (Ia) are combined with the target nucleotide sequence in hepatocytes, and modify the expression of the gene encoded by the target nucleotide sequence. Expression modification should be understood herein as changing expression by increasing or decreasing expression rate. In some preferred embodiments of the method, modified and / or unmodified oligonucleotides suppress the expression of the gene encoded by the target nucleotide sequence. The compound can be applied in any form suitable for application to a subject. In some preferred embodiments of the method, the compound is applied to a subject subcutaneously or intravenously.

[0303] In one aspect, the present invention relates to a pharmaceutical composition comprising a compound having a structure of formula (0) as defined above, wherein the residues X and R 1 All are H atoms, and the residue Y is a load, and a pharmaceutically acceptable carrier, excipient and / or diluent. The load can be any load in the above embodiments.

[0304] In some embodiments of the pharmaceutical composition, the compound has the structure of formula (I). In some preferred embodiments of the pharmaceutical composition, the compound has the structure of formula (Ia). In some embodiments of the pharmaceutical composition, modified and / or unmodified oligonucleotides in formula (I) or formula (Ia) are combined with the target nucleotide sequence in the hepatocyte, and modify the expression of the gene encoded by the target nucleotide sequence. Expression modification should be understood herein as changing expression by increasing or decreasing the expression rate. In some preferred embodiments of the pharmaceutical composition, modified and / or unmodified oligonucleotides suppress the expression of the gene encoded by the target nucleotide sequence. The pharmaceutical composition can be applied in any form suitable for application to a subject. In some preferred embodiments of the pharmaceutical composition, the pharmaceutical composition is suitable for subcutaneous or intravenous administration to a subject.

[0305] Reagent test kit

[0306] In some embodiments, the compounds and pharmaceutical compositions of the present disclosure are provided in kit form. In various aspects, the kit includes compounds as unit doses. For the purposes of this article, "unit dose" refers to a discrete amount dispersed in a suitable carrier. In various aspects, a unit dose is an amount sufficient to provide a desired effect (e.g., reducing target gene expression) to a subject. Therefore, a kit is provided herein, which includes compounds of the present disclosure optionally provided in unit doses. In various aspects, the kit includes several unit doses, for example, a unit dose of a weekly or monthly supply, optionally, each of which is individually packaged or otherwise packaged separately from other unit doses. In some embodiments, the components of the kit / unit dose are packaged together with instructions for application to the patient. In some embodiments, the kit includes one or more devices applied to the patient, for example, a needle and / or a syringe, etc. In some aspects, the compounds of the present disclosure, their pharmaceutically acceptable salts are pre-packaged into ready-to-use forms, for example, syringes and / or intravenous injection bags, etc. In some aspects, the kit further includes other therapeutic agents or diagnostic agents or pharmaceutically acceptable carriers (e.g., solvents, buffers and / or diluents, etc.), including any carrier described herein. In certain aspects, the kit comprises a compound of the disclosure, together with an agent (eg, a therapeutic agent).

[0307] Specific implementation plan

[0308] Embodiment 1 of the present invention comprises a compound having a structure of formula (0):

[0309]

[0310] in

[0311] k is an integer from 1 to 5,

[0312] m is an integer from 0 to 11,

[0313] n is an integer from 0 to 5,

[0314] X is a hydroxyl protecting group or a hydrogen atom,

[0315] Y is a hydroxyl protecting group, a hydrogen atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0316] R 1 are independently selected from hydroxyl protecting groups and H atoms.

[0317] Embodiment 2 of the present invention comprises compounds according to embodiment 1, wherein Y is a cargo, wherein the cargo comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment or a pharmaceutically active compound.

[0318] Embodiment 3 of the present invention comprises compounds according to embodiment 1 or 2, wherein X and R 1 Each represents a H atom.

[0319] Embodiment 4 of the present invention comprises a compound according to any one of the preceding embodiments having the structure of formula (I):

[0320]

[0321] in

[0322] k is an integer from 1 to 5,

[0323] m is an integer from 0 to 11,

[0324] n is an integer from 0 to 5, and

[0325] Oligo refers to modified and / or unmodified oligonucleotides.

[0326] Embodiment 5 of the present invention comprises compounds according to embodiment 4, wherein the modified and / or unmodified oligonucleotide is a single-stranded or double-stranded modified and / or unmodified oligonucleotide.

[0327] Embodiment 6 of the present invention comprises compounds according to embodiment 4, wherein the modified and / or unmodified oligonucleotide is a single-stranded oligonucleotide, a micro RNA (miRNA) or a single-stranded RNA (ssRNA).

[0328] Embodiment 7 of the present invention comprises compounds according to embodiment 4, wherein the modified and / or unmodified oligonucleotide is a double-stranded oligonucleotide and is a short hairpin RNA (shRNA) or a small interfering RNA (siRNA).

[0329] Embodiment 8 of the present invention comprises compounds according to any one of embodiments 4 to 7, wherein the modified and / or unmodified oligonucleotide is attached via the 3' end of the sense strand.

[0330] Embodiment 9 of the present invention comprises compounds according to any one of embodiments 4 to 8, wherein the modified and / or unmodified oligonucleotide binds to a target nucleotide sequence and modifies the expression of a gene encoded by the target nucleotide sequence.

[0331] Embodiment 10 of the present invention comprises compounds according to embodiment 9, wherein the modified and / or unmodified oligonucleotide inhibits the expression of the gene encoded by the target nucleotide sequence, preferably by inhibiting the transcription or translation of the target nucleotide sequence.

[0332] Embodiment 11 of the present invention comprises compounds according to embodiment 10, wherein the modified and / or unmodified oligonucleotide inhibits the expression of a gene by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0333] Embodiment 12 of the present invention comprises compounds according to any one of embodiments 4 to 11, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide is messenger RNA (mRNA).

[0334] Embodiment 13 of the present invention comprises compounds according to any one of embodiments 4 to 12, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide encodes a gene associated with a disease expressed in the liver, or a gene associated with a liver disorder (preferably a metabolic liver disorder).

[0335] Embodiment 14 of the present invention comprises compounds according to any one of embodiments 4 to 13, wherein the oligonucleotide is a modified oligonucleotide modified to resist degradation, reduce toxicity and / or enhance activity.

[0336] Embodiment 15 of the present invention comprises a compound according to embodiment 1, which has the structure of formula (II):

[0337]

[0338] in

[0339] k is an integer from 1 to 5,

[0340] m is an integer from 0 to 11,

[0341] n is an integer from 0 to 5, and

[0342] R 1 independently selected from hydroxyl protecting groups and H atoms, preferably acetyl groups,

[0343] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, and

[0344] R 7 The part of formula (VI):

[0345]

[0346] in

[0347] R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom,

[0348] Z represents NH or O, and

[0349] R 8 represents a straight-chain or branched alkylene group having 1 to 8 carbon atoms, wherein one or more of the carbon atoms are optionally replaced by O, S, NH and / or N-(C 1 -C 3 and / or cycloalkylene having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene or 1,2-cyclohexylene.

[0350] Embodiment 16 of the present invention comprises a compound according to any one of the preceding embodiments,

[0351] in

[0352] k is 2 or 3,

[0353] m is 7, 8, or 9, and

[0354] n is 2 or 3.

[0355] Embodiment 17 of the present invention comprises compounds according to any one of the preceding embodiments, wherein the sum of k and m is an integer from 8 to 12, and preferably is 10.

[0356] Embodiment 18 of the present invention comprises a compound according to any one of the preceding embodiments, wherein the compound has the structure of Formula (0a), Formula (Ia) or Formula (IIa):

[0357]

[0358]

[0359] Among them, X, Y, Oligo, R 1 , R 6 and R 7 As defined in the preceding embodiments.

[0360] Embodiment 19 of the present invention comprises a compound having a structure of formula (III):

[0361]

[0362] in

[0363] k is an integer from 1 to 5,

[0364] R 2 represents an amino protecting group or a H atom,

[0365] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0366] R 6represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0367] Embodiment 20 of the present invention comprises compounds according to embodiment 19, wherein k is 2 or 3, preferably 3.

[0368] Embodiment 21 of the present invention comprises compounds according to embodiment 19 or 20, wherein R 2 represents an amino protecting group, preferably fluorenylmethoxycarbonyl (Fmoc), and / or R 3 Represents an H atom.

[0369] Embodiment 22 of the present invention comprises a compound according to any one of embodiments 19 to 21, wherein the compound has the structure of formula (IIIa):

[0370]

[0371] in

[0372] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0373] Embodiment 23 of the present invention comprises compounds according to embodiment 19 or 20, wherein R 2 represents H atoms, and / or R 3 represents a solid support, optionally connected via a spacer.

[0374] Embodiment 24 of the present invention comprises a compound according to any one of embodiments 19, 20 and 23, wherein the compound has the structure of any one of formula (IIIb1) to formula (IIIb5):

[0375]

[0376] in

[0377] R represents a solid support, optionally linked via a spacer, an amino protecting group or an H atom, and

[0378] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0379] Embodiment 25 of the present invention includes a process for preparing a compound having a structure of formula (0):

[0380]

[0381] in

[0382] k is an integer from 1 to 5,

[0383] m is an integer from 0 to 11,

[0384] n is an integer from 0 to 5,

[0385] X is a hydroxyl protecting group or a hydrogen atom,

[0386] Y is a hydroxyl protecting group, a hydrogen atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0387] R 1 are independently selected from hydroxyl protecting groups and H atoms,

[0388] The process includes the step of reacting a compound having the structure of formula (III) with compound (V), for example by standard amide coupling:

[0389]

[0390] in

[0391] k is an integer from 1 to 5,

[0392] R 2 represents an amino protecting group or a H atom, and

[0393] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0394] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0395] Embodiment 26 of the present invention comprises a process according to embodiment 25, wherein the compound of formula (0) has the structure of formula (I):

[0396]

[0397] in

[0398] k is an integer from 1 to 5,

[0399] m is an integer from 0 to 11,

[0400] n is an integer from 0 to 5, and

[0401] Oligo refers to modified and / or unmodified oligonucleotides.

[0402] Embodiment 27 of the present invention comprises a process according to embodiment 25, wherein the compound of formula (0) has the structure of formula (II):

[0403]

[0404] in

[0405] k is an integer from 1 to 5,

[0406] m is an integer from 0 to 11,

[0407] n is an integer from 0 to 5, and

[0408] R 1 independently selected from hydroxyl protecting groups and H atoms, preferably acetyl groups,

[0409] R 6 represents a hydroxyl protecting group, preferably MMT, and

[0410] R 7 The part of formula (VI):

[0411]

[0412] in

[0413] R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom,

[0414] Z represents NH or O, and

[0415] R 8 represents a straight-chain or branched alkylene group having 1 to 8 carbon atoms, wherein one or more of the carbon atoms are optionally replaced by O, S, NH and / or N-(C 1 -C 3 and / or cycloalkylene having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene or 1,2-cyclohexylene.

[0416] Embodiment 28 of the present invention includes a process according to any one of Embodiments 25 to 27, comprising the step of reacting a compound having a structure of formula (IV):

[0417]

[0418] in

[0419] m is an integer from 0 to 11, preferably 7,

[0420] R 4 express and

[0421] R 5 represents a hydroxyl protecting group, preferably a benzyl group.

[0422] Embodiment 29 of the present invention comprises a process according to any one of embodiments 25 to 28, comprising the following steps:

[0423] a) providing a compound having the structure of formula (III):

[0424]

[0425] in

[0426] k is an integer from 1 to 5, preferably 3,

[0427] R 2 represents H atoms,

[0428] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0429] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT;

[0430] b) providing a compound having a structure of formula (V):

[0431]

[0432] in

[0433] m is an integer from 0 to 11, preferably 7,

[0434] n is an integer from 0 to 5, preferably 3,

[0435] R 1 independently selected from hydroxy protecting groups, preferably acetyl groups; and

[0436] c) reacting the compound of formula (III) provided in step a) with the compound of formula (V) provided in step b) to obtain a compound of formula (O), wherein Y is an H atom, a hydroxyl protecting group or a solid support, optionally connected through a spacer, and X is a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, or to obtain a compound of formula (II).

[0437] Embodiment 30 of the present invention comprises the process according to embodiment 29, further comprising the following steps:

[0438] d) reacting the compound obtained in step c) to obtain a compound of formula (0) wherein Y is a load optionally linked via a spacer, and X and R 1 are each a H atom, or give a compound of formula (I).

[0439] Embodiment 31 of the present invention comprises a process according to any one of embodiments 25 to 30, wherein in step d) of the process, the compound of formula (II) is reacted with at least two modified and / or unmodified nucleotides and / or nucleosides to obtain a compound of formula (I).

[0440] Embodiment 32 of the present invention includes a process according to any one of embodiments 25 to 30, wherein in step d) of the process, a compound of formula (0), wherein Y is a hydroxyl protecting group, an H atom or a solid support, optionally linked via a spacer, is further reacted with a load or a load precursor to obtain a compound of formula (0), wherein Y is a load optionally linked via a spacer.

[0441] Embodiment 33 of the present invention comprises a process according to embodiment 32, wherein the payload comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment or a compound having pharmaceutical activity.

[0442] Embodiment 34 of the present invention comprises a process according to any one of embodiments 25 to 33, wherein step b) of the process comprises the step of reacting a compound having a structure of formula (IV):

[0443]

[0444] in

[0445] m is an integer from 0 to 11, preferably 7,

[0446] R 4 express and

[0447] R 5 represents a hydroxyl protecting group, preferably a benzyl group.

[0448] Embodiment 35 of the present invention includes a method for preparing a compound having a structure of formula (0):

[0449]

[0450] in

[0451] k is an integer from 1 to 5,

[0452] m is an integer from 0 to 11,

[0453] n is an integer from 0 to 5,

[0454] X is a hydroxyl protecting group or an H atom,

[0455] Y is a hydroxyl protecting group, a hydrogen atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0456] R 1 are independently selected from hydroxyl protecting groups and H atoms,

[0457] The method comprises the step of reacting a compound having a structure of formula (III) with a compound having a structure of formula (V), for example by amide coupling:

[0458]

[0459] in

[0460] k is an integer from 1 to 5,

[0461] R 2 represents an amino protecting group or a H atom, and

[0462] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0463] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT,

[0464] Among them, the compound having the structure of formula (V) is:

[0465]

[0466] Embodiment 36 of the present invention includes a method according to embodiment 35, wherein the compound of formula (0) has the structure of formula (I):

[0467]

[0468] in

[0469] k is an integer from 1 to 5,

[0470] m is an integer from 0 to 11,

[0471] n is an integer from 0 to 5, and

[0472] Oligo refers to modified and / or unmodified oligonucleotides.

[0473] Embodiment 37 of the present invention includes a method according to embodiment 35, wherein the compound of formula (0) has the structure of formula (II):

[0474]

[0475] in

[0476] k is an integer from 1 to 5,

[0477] m is an integer from 0 to 11,

[0478] n is an integer from 0 to 5, and

[0479] R 1 independently selected from hydroxyl protecting groups and H atoms, preferably acetyl groups,

[0480] R 6 represents a hydroxyl protecting group, preferably MMT, and

[0481] R 7 The part of formula (VI):

[0482]

[0483] in

[0484] R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom,

[0485] Z represents NH or O, and

[0486] R 8 represents a straight-chain or branched alkylene group having 1 to 8 carbon atoms, wherein one or more of the carbon atoms are optionally replaced by O, S, NH and / or N-(C 1 -C 3 and / or cycloalkylene having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene or 1,2-cyclohexylene.

[0487] Embodiment 38 of the present invention includes a method according to any one of embodiments 35 to 37, comprising the step of reacting a compound having a structure of formula (IV):

[0488]

[0489] in

[0490] m is an integer from 0 to 11, preferably 7,

[0491] R 4 express and

[0492] R 5 represents a hydroxyl protecting group, preferably a benzyl group.

[0493] Embodiment 39 of the present invention includes a method according to any one of embodiments 35 to 38, comprising the steps of:

[0494] a) providing a compound having the structure of formula (III):

[0495]

[0496] in

[0497] k is an integer from 1 to 5, preferably 3,

[0498] R 2 represents H atoms,

[0499] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0500] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT;

[0501] b) providing a compound having a structure of formula (V):

[0502]

[0503] in

[0504] m is an integer from 0 to 11, preferably 7,

[0505] n is an integer from 0 to 5, preferably 3,

[0506] R 1 are independently selected from hydroxy protecting groups, preferably acetyl groups; and

[0507] c) reacting the compound of formula (III) provided in step a) with the compound of formula (V) provided in step b) to obtain a compound of formula (O), wherein Y is an H atom, a hydroxyl protecting group or a solid support, optionally connected through a spacer, and X is a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, or to obtain a compound of formula (II).

[0508] Embodiment 40 of the present invention includes the method according to embodiment 39, further comprising the steps of:

[0509] d) reacting the compound obtained in step c) to obtain a compound of formula (0) wherein Y is a load optionally linked via a spacer, and X and R 1 are each a H atom, or give a compound of formula (I).

[0510] Embodiment 41 of the present invention comprises a method according to any one of embodiments 35 to 40, wherein in step d) of the process, the compound of formula (II) is reacted with at least two modified and / or unmodified nucleotides and / or nucleosides to obtain a compound of formula (I).

[0511] Embodiment 42 of the present invention includes a method according to any one of embodiments 35 to 40, wherein in step d) of the process, the compound of formula (0), wherein Y is a hydroxyl protecting group, an H atom or a solid support, optionally connected through a spacer, is further reacted with a load or a load precursor to obtain a compound of formula (0), wherein Y is a load optionally connected through a spacer.

[0512] Embodiment 43 of the present invention comprises a method according to embodiment 42, wherein the payload comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment or a pharmaceutically active compound.

[0513] Embodiment 44 of the present invention includes a method according to any one of embodiments 35 to 43, wherein step b) of the process includes the step of reacting a compound having a structure of formula (IV):

[0514]

[0515] in

[0516] m is an integer from 0 to 11, preferably 7,

[0517] R 4 express and

[0518] R 5 represents a hydroxyl protecting group, preferably a benzyl group.

[0519] Embodiment 45 of the present invention includes compounds having the structure of formula (0):

[0520]

[0521] in

[0522] k is an integer from 1 to 5, preferably 3,

[0523] m is an integer from 0 to 11, preferably 7,

[0524] n is an integer from 0 to 5, preferably 3,

[0525] X is a H atom,

[0526] Y is a load, optionally linked via a spacer, and

[0527] R 1 is an H atom for use in a method of treating a subject or diagnosing a subject having a disease or disorder, the subject comprising cells expressing asialoglycoprotein receptor (ASGPR).

[0528] Embodiment 46 of the present invention comprises the compound for use according to embodiment 45, wherein the payload comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment or a pharmaceutically active compound.

[0529] Embodiment 47 of the present invention includes compounds used according to embodiment 45 or 46, wherein the compound has the structure of formula (I):

[0530]

[0531] in

[0532] k is an integer from 1 to 5,

[0533] m is an integer from 0 to 11,

[0534] n is an integer from 0 to 5, and

[0535] Oligo refers to modified and / or unmodified oligonucleotides.

[0536] Embodiment 48 of the present invention comprises the compound for use according to embodiment 47, wherein the modified and / or unmodified oligonucleotide is a single-stranded or double-stranded modified and / or unmodified oligonucleotide.

[0537] Embodiment 49 of the present invention includes compounds for use according to embodiment 47, wherein the modified and / or unmodified oligonucleotide is a single-stranded oligonucleotide, micro RNA (miRNA) or single-stranded RNA (ssRNA).

[0538] Embodiment 50 of the present invention includes compounds for use according to embodiment 47, wherein the modified and / or unmodified oligonucleotide is a double-stranded oligonucleotide and is a short hairpin RNA (shRNA) or a small interfering RNA (siRNA).

[0539] Embodiment 51 of the present invention comprises a compound for use according to any one of embodiments 47 to 50, wherein the modified and / or unmodified oligonucleotide is attached via the 3' end of the sense strand.

[0540] Embodiment 52 of the present invention includes compounds for use according to any one of embodiments 47 to 51, wherein the modified and / or unmodified oligonucleotide binds to a target nucleotide sequence and modifies the expression of a gene encoded by the target nucleotide sequence.

[0541] Embodiment 53 of the present invention includes compounds for use according to embodiment 52, wherein the modified and / or unmodified oligonucleotide inhibits the expression of the gene encoded by the target nucleotide sequence, preferably by inhibiting the transcription or translation of the target nucleotide sequence.

[0542] Embodiment 54 of the present invention includes compounds for use according to embodiment 53, wherein the modified and / or unmodified oligonucleotide inhibits gene expression by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0543] Embodiment 55 of the present invention includes compounds for use according to any one of embodiments 47 to 54, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide is messenger RNA (mRNA).

[0544] Embodiment 56 of the present invention includes compounds for use according to any one of embodiments 47 to 55, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide encodes a gene associated with a disease expressed in the liver, or a gene associated with a liver disorder (preferably a metabolic liver disorder).

[0545] Embodiment 57 of the present invention includes compounds for use according to any one of embodiments 47 to 56, wherein the oligonucleotide is a modified oligonucleotide modified to resist degradation, reduce toxicity and / or enhance activity.

[0546] Embodiment 58 of the present invention includes compounds for use according to any one of embodiments 47 to 57, wherein

[0547] k is 2 or 3,

[0548] m is 7, 8, or 9, and

[0549] n is 2 or 3.

[0550] Embodiment 59 of the present invention includes compounds for use according to any one of embodiments 47 to 58, wherein the sum of k and m is an integer from 8 to 12, and preferably is 10.

[0551] Embodiment 60 of the present invention includes compounds used according to any one of embodiments 47 to 59, wherein the compound has the structure of formula (Ia):

[0552]

[0553] Embodiment 61 of the present invention includes a method for delivering a cargo into a cell expressing an asialoglycoprotein receptor (ASGPR), comprising the step of administering a compound having a structure of formula (0):

[0554]

[0555] in

[0556] k is an integer from 1 to 5,

[0557] m is an integer from 0 to 11,

[0558] n is an integer from 0 to 5,

[0559] X is a H atom,

[0560] Y is a load optionally linked via a spacer, and

[0561] R 1 is a H atom,

[0562] Wherein the cargo is delivered to cells expressing the asialoglycoprotein receptor (ASGPR) in the subject in an amount sufficient to treat the subject with the cargo.

[0563] Embodiment 62 of the present invention includes a method according to embodiment 61, wherein the payload comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment, or a pharmaceutically active compound.

[0564] Embodiment 63 of the present invention includes a method according to embodiment 61 or 62, wherein the compound has the structure of formula (I):

[0565]

[0566] in

[0567] k is an integer from 1 to 5,

[0568] m is an integer from 0 to 11,

[0569] n is an integer from 0 to 5, and

[0570] Oligo refers to modified and / or unmodified oligonucleotides.

[0571] Embodiment 64 of the present invention comprises a method according to embodiment 63, wherein the modified and / or unmodified oligonucleotide is a single-stranded or double-stranded modified and / or unmodified oligonucleotide.

[0572] Embodiment 65 of the present invention includes a method according to embodiment 63, wherein the modified and / or unmodified oligonucleotide is a single-stranded oligonucleotide, a micro RNA (miRNA) or a single-stranded RNA (ssRNA).

[0573] Embodiment 66 of the present invention includes a method according to embodiment 63, wherein the modified and / or unmodified oligonucleotide is a double-stranded oligonucleotide and is a short hairpin RNA (shRNA) or a small interfering RNA (siRNA).

[0574] Embodiment 67 of the present invention comprises a method according to any one of embodiments 63 to 66, wherein the modified and / or unmodified oligonucleotide is attached via the 3' end of the sense strand.

[0575] Embodiment 68 of the present invention includes a method according to any one of embodiments 63 to 67, wherein the modified and / or unmodified oligonucleotide binds to a target nucleotide sequence and modifies the expression of a gene encoded by the target nucleotide sequence.

[0576] Embodiment 69 of the present invention includes a method according to embodiment 68, wherein the modified and / or unmodified oligonucleotide inhibits the expression of the gene encoded by the target nucleotide sequence, preferably by inhibiting the transcription or translation of the target nucleotide sequence.

[0577] Embodiment 70 of the invention includes a method according to embodiment 69, wherein the modified and / or unmodified oligonucleotide inhibits expression of the gene by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0578] Embodiment 71 of the present invention includes a method according to any one of embodiments 63 to 70, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide is messenger RNA (mRNA).

[0579] Embodiment 72 of the present invention includes a method according to any one of embodiments 63 to 71, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide encodes a gene associated with a disease expressed in the liver, or a gene associated with a liver disorder (preferably a metabolic liver disorder).

[0580] Embodiment 73 of the present invention includes methods according to any one of embodiments 63 to 72, wherein the oligonucleotide is a modified oligonucleotide modified to resist degradation, reduce toxicity and / or enhance activity.

[0581] Embodiment 74 of the present invention includes a method according to any one of embodiments 63 to 73, wherein

[0582] k is 2 or 3,

[0583] m is 7, 8, or 9, and

[0584] n is 2 or 3.

[0585] Embodiment 75 of the present invention includes a method according to any one of embodiments 63 to 74, wherein the sum of k and m is an integer from 8 to 12, and preferably is 10.

[0586] Embodiment 76 of the present invention includes a method according to any one of embodiments 63 to 75, wherein the compound has the structure of formula (Ia):

[0587]

[0588] Embodiment 77 of the present invention includes for use a compound according to any one of embodiments 45 to 60 or a method according to any one of embodiments 61 to 76, wherein the compound is administered to the subject subcutaneously or intravenously.

[0589] Embodiment 78 of the present invention comprises a pharmaceutical composition comprising a compound having a structure of formula (0):

[0590]

[0591] in

[0592] k is an integer from 1 to 5, preferably 3,

[0593] m is an integer from 0 to 11, preferably 7,

[0594] n is an integer from 0 to 5, preferably 3,

[0595] X is a H atom,

[0596] Y is a load, optionally linked via a spacer, and

[0597] R 1 is a H atom,

[0598] and pharmaceutically acceptable carriers, excipients and / or diluents.

[0599] Embodiment 79 of the present invention comprises a pharmaceutical composition according to embodiment 78, wherein the cargo comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment or a chemical compound having pharmaceutical activity.

[0600] Embodiment 80 of the present invention comprises a pharmaceutical composition according to embodiment 78 or 79, wherein the compound has the structure of formula (I):

[0601]

[0602] in

[0603] k is an integer from 1 to 5,

[0604] m is an integer from 0 to 11,

[0605] n is an integer from 0 to 5, and

[0606] Oligo refers to modified and / or unmodified oligonucleotides.

[0607] Embodiment 81 of the present invention comprises a pharmaceutical composition according to embodiment 80, wherein the modified and / or unmodified oligonucleotide is a single-stranded or double-stranded modified and / or unmodified oligonucleotide.

[0608] Embodiment 82 of the present invention comprises a pharmaceutical composition according to embodiment 80, wherein the modified and / or unmodified oligonucleotide is a single-stranded oligonucleotide, a micro RNA (miRNA) or a single-stranded RNA (ssRNA).

[0609] Embodiment 83 of the present invention comprises a pharmaceutical composition according to embodiment 80, wherein the modified and / or unmodified oligonucleotide is a double-stranded oligonucleotide and is a short hairpin RNA (shRNA) or a small interfering RNA (siRNA).

[0610] Embodiment 84 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 83, wherein the modified and / or unmodified oligonucleotide is attached via the 3' end of the sense strand.

[0611] Embodiment 85 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 84, wherein the modified and / or unmodified oligonucleotide binds to a target nucleotide sequence and modifies the expression of a gene encoded by the target nucleotide sequence.

[0612] Embodiment 86 of the present invention comprises a pharmaceutical composition according to embodiment 85, wherein the modified and / or unmodified oligonucleotide inhibits the expression of the gene encoded by the target nucleotide sequence, preferably by inhibiting the transcription or translation of the target nucleotide sequence.

[0613] Embodiment 87 of the present invention comprises a pharmaceutical composition according to embodiment 86, wherein the modified and / or unmodified oligonucleotide inhibits the expression of the gene by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0614] Embodiment 88 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 87, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide is messenger RNA (mRNA).

[0615] Embodiment 89 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 88, wherein the target nucleotide sequence of the modified and / or unmodified oligonucleotide encodes a gene associated with a disease expressed in the liver, or a gene associated with a liver disorder (preferably a metabolic liver disorder).

[0616] Embodiment 90 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 89, wherein the oligonucleotide is a modified oligonucleotide modified to resist degradation, reduce toxicity and / or enhance activity.

[0617] Embodiment 91 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 90, wherein

[0618] k is 2 or 3,

[0619] m is 7, 8, or 9, and

[0620] n is 2 or 3.

[0621] Embodiment 92 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 91, wherein the sum of k and m is an integer from 8 to 12, and preferably is 10.

[0622] Embodiment 93 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 92, wherein the compound has the structure of formula (Ia):

[0623]

[0624] Embodiment 94 of the present invention comprises a pharmaceutical composition according to any one of embodiments 80 to 93, wherein the pharmaceutical composition is suitable for subcutaneous or intravenous administration to a subject.

[0625] Exemplary embodiments

[0626] The following exemplary embodiments are provided, the numbering of which should not be construed as designating a level of importance:

[0627] Example 1. A compound having a structure of formula (0):

[0628]

[0629] in

[0630] k is an integer from 1 to 5,

[0631] m is an integer from 0 to 11,

[0632] n is an integer from 0 to 5,

[0633] X is a hydroxyl protecting group or an H atom,

[0634] Y is a hydroxyl protecting group, an H atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0635] R 1 are independently selected from hydroxyl protecting groups and H atoms.

[0636] Example 2. A compound according to Example 1, wherein Y is a payload, wherein the payload comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment, or a compound having pharmaceutical activity.

[0637] Example 3. The compound according to Example 1 or 2, wherein X and R 1 Each represents a H atom.

[0638] Example 4. A compound according to any one of the preceding examples, having a structure of formula (I):

[0639]

[0640] in

[0641] k is an integer from 1 to 5,

[0642] m is an integer from 0 to 11,

[0643] n is an integer from 0 to 5, and

[0644] Oligo refers to modified and / or unmodified oligonucleotides.

[0645] Example 5. The compound according to Example 4, wherein the modified and / or unmodified oligonucleotide is a single-stranded or double-stranded modified and / or unmodified oligonucleotide.

[0646] Example 6. A compound according to any one of Examples 4 to 5, wherein the modified and / or unmodified oligonucleotide is attached via the 3' end of the sense strand.

[0647] Example 7. A compound according to any one of Examples 4 to 6, wherein the modified and / or unmodified oligonucleotide binds to a target nucleotide sequence and modifies the expression of a gene encoded by the target nucleotide sequence.

[0648] Example 8. The compound according to Example 1, which has the structure of formula (II):

[0649]

[0650] in

[0651] k is an integer from 1 to 5,

[0652] m is an integer from 0 to 11,

[0653] n is an integer from 0 to 5, and

[0654] R 1 independently selected from hydroxyl protecting groups and H atoms, preferably acetyl groups,

[0655] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, and

[0656] R 7 The part of formula (VI):

[0657]

[0658] in

[0659] R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom,

[0660] Z represents NH or O, and

[0661] R 8 represents a straight-chain or branched alkylene group having 1 to 8 carbon atoms, wherein one or more of the carbon atoms are optionally replaced by O, S, NH and / or N-(C 1 -C 3 and / or cycloalkylene having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene or 1,2-cyclohexylene.

[0662] Example 9. A compound according to any one of the preceding examples,

[0663] in

[0664] k is 2 or 3,

[0665] m is 7, 8, or 9, and

[0666] n is 2 or 3.

[0667] Example 10. A compound according to any one of the preceding examples, wherein the sum of k and m is an integer from 8 to 12, and preferably 10.

[0668] Example 11. A compound according to any of the preceding examples, wherein the compound has a structure of Formula (0a), Formula (Ia) or Formula (IIa):

[0669]

[0670] Among them, X, Y, Oligo, R 1 , R 6 and R 7 As defined in the previous examples.

[0671] Example 12. A compound having a structure of formula (III):

[0672]

[0673] in

[0674] k is an integer from 1 to 5,

[0675] R 2represents an amino protecting group or a H atom,

[0676] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0677] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0678] Example 13. A compound according to Example 12, wherein k is 2 or 3, preferably 3.

[0679] Example 14. The compound according to Example 12 or 13, wherein R 2 represents an amino protecting group, preferably a fluorenylmethoxycarbonyl group (Fmoc), and / or R 3 Represents an H atom.

[0680] Example 15. A compound according to any one of Examples 12 to 14, wherein the compound has a structure of Formula (IIIa):

[0681]

[0682] in

[0683] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0684] Example 16. The compound according to Example 12 or 13, wherein R 2 represents H atoms, and / or R 3 represents a solid support, optionally connected via a spacer.

[0685] Example 17. A compound according to any one of Examples 12, 13 and 16, wherein the compound has a structure of any one of Formula (IIIb1) to Formula (IIIb5):

[0686]

[0687]

[0688] in

[0689] R represents a solid support, optionally linked via a spacer, an amino protecting group or an H atom, and R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

[0690] Example 18. A method for preparing a compound having a structure of formula (0):

[0691]

[0692] in

[0693] k is an integer from 1 to 5,

[0694] m is an integer from 0 to 11,

[0695] n is an integer from 0 to 5,

[0696] X is a hydroxyl protecting group or an H atom,

[0697] Y is a hydroxyl protecting group, an H atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and

[0698] R 1 are independently selected from hydroxyl protecting groups and H atoms,

[0699] The method comprises the step of reacting a compound having a structure of formula (III) with a compound having a structure of formula (V):

[0700]

[0701] in

[0702] k is an integer from 1 to 5,

[0703] R 2 represents an amino protecting group or a H atom, and

[0704] R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and

[0705] R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT,

[0706] The compound having the structure of formula (V) is:

[0707]

[0708] Example 19. The method according to Example 18, wherein the compound of formula (0) has a structure of formula (I):

[0709]

[0710] in

[0711] k is an integer from 1 to 5,

[0712] m is an integer from 0 to 11,

[0713] n is an integer from 0 to 5, and

[0714] Oligo refers to modified and / or unmodified oligonucleotides.

[0715] Example 20. The method according to Example 19, wherein the compound of formula (0) has a structure of formula (II):

[0716]

[0717] in

[0718] k is an integer from 1 to 5,

[0719] m is an integer from 0 to 11,

[0720] n is an integer from 0 to 5, and

[0721] R 1 independently selected from hydroxyl protecting groups and H atoms, preferably acetyl groups,

[0722] R 6 represents a hydroxyl protecting group, preferably MMT, and

[0723] R 7 The part of formula (VI):

[0724]

[0725] in

[0726] R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom,

[0727] Z represents NH or O, and

[0728] R 8 represents a straight-chain or branched alkylene group having 1 to 8 carbon atoms, wherein one or more of the carbon atoms are optionally replaced by O, S, NH and / or N-(C 1 -C 3 and / or cycloalkylene having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene or 1,2-cyclohexylene.

[0729] Example 21. A pharmaceutical composition comprising a compound having a structure of formula (0):

[0730]

[0731] in

[0732] k is an integer from 1 to 5, preferably 3,

[0733] m is an integer from 0 to 11, preferably 7,

[0734] n is an integer from 0 to 5, preferably 3,

[0735] X is a H atom,

[0736] Y is a load optionally linked via a spacer, and

[0737] R 1 is a H atom,

[0738] and pharmaceutically acceptable carriers, excipients and / or diluents.

[0739] Example 22. A pharmaceutical composition according to Example 21, wherein the payload comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment, or a compound having pharmaceutical activity.

[0740] Example 23. A pharmaceutical composition according to Example 21 or 22, wherein the compound has a structure of formula (I):

[0741]

[0742] in

[0743] k is an integer from 1 to 5,

[0744] m is an integer from 0 to 11,

[0745] n is an integer from 0 to 5, and

[0746] Oligo refers to modified and / or unmodified oligonucleotides.

[0747] Example

[0748] NON-LIMITING DISCLOSURE AND INCORPORATION BY REFERENCE

[0749] Although certain compounds, compositions and methods described herein have been specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to be limiting thereof. Each reference cited in this application is incorporated herein by reference in its entirety.

[0750] Example 1: Preparation of GalNAc compounds with solid support

[0751] ARNATAR GalNAc-Linker-Solid Support Synthesis Procedure

[0752] Two synthetic procedures for producing trivalent GalNAc solid supports are shown below: Reaction Scheme 1 and Reaction Scheme 2.

[0753] Reaction Scheme 1

[0754]

[0755] In the presence of DIEA (diisopropylethylamine) and HBTU (benzotriazole tetramethyl urea hexafluorophosphate), 10-(benzyloxy)-10-oxodecanoic acid (CAS No.: 67852-88-4, compound (2)) (4.80 g / 16.00 mmol) and tris[[2-(tert-butoxycarbonyl)ethoxy]methyl]methylamine (CAS No.: 175724-30-8, compound (1)) (8.00 g / 16.00 mmol) were reacted in DCM (dichloromethane) at RT for 16 hours to obtain compound (3) with a yield of 70.4%.

[0756]

[0757] Compound (3) (9.20 g / 11.80 mmol) was treated in formic acid at 25°C for 24 hours to remove the tert-butyl protecting group to give compound (4) in a yield of 86.1%. Tricarboxylate compound (4) (6.90 g / 11.30 mmol) was dissolved in dichloromethane with EDCI (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide), DIEA and HOAT (1-hydroxy-7-azabenzotriazole). (20.00 g / 38.30 mmol) [5-acetylamino-3,4-diacetoxy-6-[2-[2-[2-(2-aminoethoxy)ethoxy]ethoxy]ethoxy]oxan-2-yl]methyl acetate (5) (the preparation of compound (5) is shown below - compound (9) in reaction scheme 2) was added to the DCM mixture and stirred at 25°C for 16 hours. The yield of compound (6) was determined by LCMS to be 70% / purity 97.2%.

[0758]

[0759] Compound (6) was dissolved in THF under hydrogen (15 psi) in the presence of Pd / C catalyst for 20 hours to remove the benzyl protecting group, and the crude material (7) was purified by preparative HPLC to give compound (7).

[0760]

[0761] Compound (7) (0.5 g / 0.25 mmol) was dissolved in DCM with DIEA and HBTU. Compound (8) (150.0 mg / 0.30 mmol) (Wuxi AppTec, Shanghai, China) (Dunetz et al., Org. Process Res. Dev. 2016, 20, 2, 140–177) was added to the mixture. The reaction mixture was stirred at 25° C. for 16 hours. After purification by preparative HPLC, compound (9) was obtained with a purity of 96.3% and a yield of 41%.

[0762]

[0763] Compound (10) was prepared by dissolving compound (9) (380 mg / 0.26 mmol) in DCM, adding DMAP and excess succinic anhydride and allowing the reaction to complete.

[0764]

[0765] Compound (10) was coupled to two amino-modified polystyrene beads using HBTU, DMAP and DIEA in THF. The second step of the reaction capped any unreacted positions using acetic anhydride and pyridine. The resulting loading was ~150 μmol / g. In an optional step, compound (10) was attached to CPG as a solid support.

[0766] Alternatives in Reaction Scheme 1:

[0767] The above reaction can give similar results with only slight modifications.

[0768] Specifically, for example, compound (8) may contain MMT(r) instead of DMT(r) as a hydroxyl protecting group. Very efficient coupling of nucleotides with MMT as a hydroxyl protecting group can be achieved.

[0769] In addition, other dicarboxylic anhydrides can also be used to prepare spacers for attachment to solid supports. Examples of very useful dicarboxylic anhydrides, such as succinic anhydride, 2,2 dimethylsuccinic anhydride, glutaric anhydride, adipic anhydride, 1,2 cyclohexane dicarboxylic anhydride, acetic anhydride ether, acetic anhydride thioether and methyliminodiacetic anhydride, and their reactions with MMT-containing compound (9) are shown below. The obtained variants of compound 10 (compounds 10a to 10h) are further reacted in a similar manner to the above to form modified compound 11 (not shown).

[0770]

[0771]

[0772] Reaction Scheme 2

[0773] Step 1: Synthesis of active trivalent ester (5):

[0774]

[0775] 10-Benzyloxy-10-oxodecanoic acid (CAS No.: 67852-88-4, compound (1)) reacts with tri[[2-(tert-butyloxycarbonyl)ethoxy]methyl]methylamine (CAS No.: 175724-30-8, compound (2)) to obtain compound (3). Compound (3) is reacted to obtain compound (4), and then compound (4) reacts with pentafluorophenyl trifluoroacetate (CAS No.: 14533-84-7) to obtain active trivalent ester (5).

[0776] Step 2: Synthesis of amine GalNAc arm (9):

[0777]

[0778] 1-Azido-3,6,9-trioxaundecan-11-ol (CAS No.: 86770-67-4, compound (6)) is reacted with (2S,3R,4R,5R,6R)-3-acetylamino-6-(acetoxymethyl)tetrahydro-2H-pyran-2,4,5-triyl triacetate (CAS No.: 3006-60-8, compound (7)) to obtain compound (8), and then obtain compound (9).

[0779] Step 3: Coupling (5) and (9) followed by reduction of the benzyl group yields the tri-GalNAc carboxylic acid moiety:

[0780]

[0781] The compounds obtained in steps 1 and 2 are reacted in a ratio of compound (5) to compound (9) of 3:1 to obtain compound (10), which is then treated as described above to obtain compound (11).

[0782] Step 4: Synthesis of linker support for conjugation with (11):

[0783]

[0784] Compound (12) (Wuxi AppTec, Shanghai, China) was reacted with succinic anhydride to obtain compound (13) containing a succinic acid spacer. Compound (13) was then attached to a solid support, which can be any solid support known in the art for coupling reactions, such as CPG (optionally including an LCAA spacer) and polystyrene solid supports.

[0785] Step 5: Coupling reaction between trivalent GalNAc (11) and linker-modified support (14)

[0786]

[0787] The compounds obtained in steps 3 and 4 are reacted in a ratio of compound (11) to compound (14) of 1:1 to obtain compound (15).

[0788] Alternatives in Reaction Scheme 2:

[0789] The above reaction can give similar results with only slight modifications.

[0790] Specifically, for example, compound (12) may contain MMT(r) instead of DMT(r) as a hydroxyl protecting group, which can achieve very efficient coupling of nucleotides with MMT as a hydroxyl protecting group.

[0791] In addition, other dicarboxylic anhydrides can also be used to prepare spacers for attachment to solid supports. Examples of very useful dicarboxylic anhydrides include succinic anhydride, 2,2 dimethylsuccinic anhydride, glutaric anhydride, adipic anhydride, 1,2 cyclohexanedicarboxylic anhydride, acetic anhydride ether, acetic anhydride thioether and methyliminodiacetic anhydride, and their reaction with MMT-containing compounds (12) will respectively produce modified compounds (15) containing spacers derived from these acids.

[0792] Example 2: Preparation of GalNAc compound conjugate

[0793] Synthesis of oligomeric compounds on ARNATAR GalNAc support

[0794] The oligonucleotide is attached to the ARNATAR GalNAc compound having structure (11) obtained as described in Reaction Scheme 1 - having Solid Support.

[0795] As a comparative example, the GalNAc compound described by Sharma et al. (2018, Bioconjugate Chem, 29: 2478-2488, compound 8 in Scheme 1 (obtained from Gene Link, Elmsford, NY, USA or Primetech, ALC., Minsk, Belarus, named "GalNAc TEG CPG" ) conjugated to the same oligonucleotide.

[0796] Solid phase synthesis of oligonucleotides at MerMade TM The 48x synthesizer (BioAutomation, LGC, Biosearch Technologies, Hoddesdon, UK) was used to prepare up to 48 oligonucleotides at 1 μMole or 5 μMole scale per run using standard phosphoramidite chemistry. The solid support was a controlled pore glass ( Wuxi App Tec, Shanghai, China), loaded with 3'-GalNAc conjugate; or universal solid support (AM Chemicals, Vista, CA, USA). Ancillary synthesis reagents and standard 2'-cyanoethyl phosphoramidite monomers (2'-fluoro, 2'-O-methyl, RNA, DNA) were obtained from different sources (Hongene Biotech, Shanghai, China; Sigma-Aldrich, St. Louis, MO, USA; Glen Research, Sterling, VA, USA; Thermo Fisher Scientific, Waltham, MA, USA; LGC Biosearch Technologies, Hoddesdon, UK).

[0797] Phosphoramidite mixtures were prepared in anhydrous acetonitrile or 30% DMF:acetonitrile and coupled using 0.25 M 4,5-dicyanoimidazole (DCI) (Sigma-Aldrich, St. Louis, MO, USA) with coupling times ranging from 120-360 seconds. Standard phosphodiester bonds were achieved using a 0.02 M mixture of iodine in tetrahydrofuran (THF), pyridine, and water.

[0798] Phosphorothioate bonds were generated using 0.05 M sulfurization reagent II (3-((dimethylamino-methylene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT) (40:60, pyridine / acetonitrile) (LGC Biosearch Technologies, Hoddesdon, UK) with an oxidation time of 6 min. All sequences were synthesized with the dimethoxytrityl (DMT) protecting group removed.

[0799] After solid phase synthesis, the oligonucleotides were cleaved from the solid support and deprotected from base labile groups by incubation in ammonium hydroxide at 55°C for 6 hours. The ammonium hydroxide was removed using a centrifugal vacuum concentrator and dried at room temperature. For sequences containing native ribonucleotides (2'-OH) protected with tert-butyldimethylsilyl (TBDMS), a second deprotection was performed using triethylamine; trihydrofluoric acid (TEA:3HF). 100 μL of DMSO and 125 μL of TEA:3HF were added to each TBDMS protected oligonucleotide and incubated at 65°C for 2.5 hours. After incubation, 25 μL of 3M sodium acetate was added to the solution, followed by precipitation in butanol at -20°C for 30 minutes. The turbid solution was centrifuged to form a cake while the supernatant was carefully decanted with a pipette. A standard precipitation process was then completed using 75% ethanol:water and then 100% ethanol as the supernatant. The oligonucleotide cake was placed in a centrifugal vacuum concentrator to dry for 30 minutes.

[0800] After desalting with 3M sodium acetate precipitation, no HPLC purification was performed and then G25 Oligonucleotides were purified by anion exchange chromatography on a Gilson GX271 preparative HPLC system (Middleton, WI, USA) using BioWorks Q40 resin (Uppsala, Sweden). All oligonucleotides were analyzed for purity by ion-pairing reversed-phase HPLC using an Agilent 1200 analytical HPLC (Santa Clara, CA, USA), intact mass analysis by negative ion mass spectrometry using an Agilent 6130 single quadrupole mass spectrometer (Santa Clara, CA, USA), and purified by Tecan A260 quantification was performed by UV / Vis using an M Plex microplate reader (Zurich, Switzerland).

[0801] GalNAc-conjugated oligonucleotides can be used alone as single-stranded compounds (e.g., antisense oligonucleotides (ASOs), ssRNAs or miRNAs; e.g., Example 3) or in double-stranded form to form double-stranded compounds (e.g., siRNAs and / or shRNAs). In some examples (e.g., Examples 4 and 5), GalNAc is conjugated to the sense strand of the double-stranded compound.

[0802] Double-stranded oligomerization

[0803] Typically, for double-stranded oligomeric compounds (e.g., siRNA compounds), the sense and antisense oligonucleotides are annealed together to form a duplex. 50-300 mM duplex formation can be achieved by heating the sample in 1× phosphate buffered saline in a block heater at 94° C. for 4 minutes, then removing the heating block containing the sample from the block heater and allowing it to gradually cool to room temperature over 1 hour.

[0804] Example 3: Stability of ARNATAR GalNAc Conjugates

[0805] ARNATAR GalNAc compound and Sharma GalNAc compound conjugates were prepared as described in Example 2 and contained the oligonucleotides shown in Table 1. Their stability and persistence were evaluated.

[0806] A total of 4 oligonucleotides were synthesized at a scale of 1 μmol. Two 24-base poly-T oligonucleotides were synthesized using standard phosphodiester using Sharma GalNAc or ARNATAR GalNAc supports. Two 24-base poly-T oligonucleotides were synthesized using phosphorothioate (PS) internucleoside chemistry (internucleosides are indicated by *) using Sharma GalNAc or ARNATAR GalNAc supports. All 4 oligonucleotides were synthesized using standard synthesis methods and ion exchange purification, and analytical HPLC showed that the purity of the 4 oligonucleotides after purification and desalting was greater than 90%.

[0807] Table 1: GalNAc-conjugated oligonucleotide constructs

[0808]

[0809] Samples (~500uM) of each GalNAc-conjugated oligonucleotide construct were placed in water and combined with AMA (ammonium hydroxide / 40% methylamine aqueous solution 1:1 v / v) or 300mM NaAc (sodium acetate) buffer pH 4.5. Table 2 shows the stability comparison of the two GalNAc oligonucleotide conjugates. Among them, the 2nd and 3rd rows describe the stability measurements of the connection between the corresponding GalNAc compound and the oligonucleotide, while the 4th and 5th rows describe the stability measurements within the oligonucleotide.

[0810] Table 2: GalNAc stability

[0811]

[0812] The reaction was analyzed by mass spectrometry to determine if there were cleavage products. In all cases where degradation was observed, cleavage of phosphodiester and phosphorothioate bonds was the main truncated product. The analysis showed that there were some slightly degraded N-1 and N-2 products. Analysis of the degradation results showed that most of the full-length products were reduced to monomers. Under acidic and alkaline conditions, the oligonucleotide phosphate bonds began to degrade before any GalNAc degradation products were observed. It was found that ARNATAR GalNAc was stable under stress conditions.

[0813] Example 4: Evaluation of ARNATAR GalNAc in primary human hepatocytes

[0814] ARNATAR GalNAc compound and Sharma GalNAc compound conjugates were prepared as described in Example 2, wherein the GalNAc compound was conjugated to the same siRNA compound (ATsi103) targeting laminin (LMNA) on the sense strand of the duplex, as shown in Table 3.

[0815] Table 3: LMNA siRNA

[0816]

[0817]

[0818] (5p) = 5'-phosphate

[0819] d (or no sign before the nucleotide) = deoxyribonucleotide substituted for ribonucleotide

[0820] f=2'-F

[0821] m=2'-OMe

[0822] * = phosphorothioate (PS) bond

[0823] GalNAc-AN=ARNATAR GalNAc

[0824] GalNAc-GL=Sharma GalNAc

[0825] GalNAc-conjugated LMNA siRNA was incubated with human primary hepatocytes to allow free uptake (i.e., entry into cells without transfection) of the GalNAc-siRNA compound into the cells. Knockdown of LMNA expression was used as a marker to assess the ability of each GalNAc type to deliver LMNA-targeting siRNA to hepatocytes.

[0826] Different doses of LMNA siRNA (final concentration of 0 μM, 0.008 μM, 0.04 μM, 0.2 μM, 1 μM or 5 μM) were added to human primary hepatocytes (HPH) (Xenotech, Kansas City, KS, USA) and incubated at 37°C and 5% CO2 for 16 hours, 31 hours or 51 hours. siRNA activity was determined by measuring target mRNA levels by qRT-PCR using the LMNA primer probe set listed in Table 4. qRT-PCR was performed using AgPath-ID TM One-step RT-PCR was performed in a QS3 real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). The target RNA levels in the qRT-PCR assay were normalized to those in the Ribogreen TM Total RNA levels were measured by RT-PCR (ThermoFisher Scientific, Waltham, MA, USA) or GAPDH mRNA levels were detected in RNA sample aliquots using qRT-PCR.

[0827] Figure 1 The percentage of LMNA mRNA free uptake by HPH 51 h after GalNAc-conjugated siRNA is shown. Figure 2 The time course of changes in LMNA mRNA levels is shown. Blank PBS treatment was used as a control.

[0828] Table 4: Human LMNA primer-probe sets

[0829] Primer name Primer sequence (5' to 3') SEQ ID NO: hsLMNA-S CGGGTGGATGCTGAGAAC 3 hsLMNA-A TGCTTCCCATTGTCAATCTCC 4 hsLMNA-P AGTGAGGAGCTGCGTGAGACCAA 5

[0830] Table 5: Activity of GalNAc-conjugated siRNA targeting LMNA in human primary hepatocytes.

[0831]

[0832] ARNATAR GalNAc compounds are novel GalNAc compounds that are more potent than previously disclosed GalNAc compounds from Sharma. This study demonstrated that ARNATAR GalNAc conjugates outperformed Sharma GalNAc in primary human hepatocytes at all doses and times evaluated. Surprisingly, the ARNATARGalNAc conjugates performed much better than the Sharma GalNAc conjugates despite subtle differences in structure.

[0833] Example 5: Evaluation of ARNATAR GalNAc conjugates in mouse hepatocytes

[0834] The GalNAc-conjugated LMNA siRNA disclosed in Example 4 targets both human and mouse LMNA mRNA, so studies were performed to confirm the ability of ARNATAR GalNAc to deliver siRNA into mouse hepatocytes.

[0835] In this study, GalNAc-conjugated LMNA siRNA was incubated with mouse hepatocytes to allow the GalNAc-siRNA compound to be freely taken up (i.e., enter the cells without transfection) into the cells. As in Example 4, knockdown of LMNA expression was used as a marker to assess the ability of each GalNAc to transport LMNA-targeted siRNA into hepatocytes.

[0836] Different doses of LMNA siRNA (final concentration of 0 μM, 0.008 μM, 0.04 μM, 0.2 μM, 1 μM or 5 μM) were added to mouse hepatocytes (mHP) (Xenotech, Kansas City, KS, USA) and incubated for 60 hours at 37°C and 5% CO2. siRNA activity was determined by measuring target mRNA levels by qRT-PCR using the LMNA primer probe set listed in Table 6. qRT-PCR was performed using AgPath-ID TM One-step RT-PCR was performed in a QS3 real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The target RNA levels in the qRT-PCR assay were normalized to those in the Ribogreen TM Total RNA levels were measured by RT-PCR (ThermoFisher Scientific, Waltham, MA, USA) or GAPDH mRNA levels were detected in RNA sample aliquots using qRT-PCR.

[0837] Figure 3The percentage of LMN A mRNA 60 h after free uptake of GalNAc-conjugated siRNA by HPH is shown.

[0838] Table 6: Mouse LMNA primer-probe sets

[0839]

[0840] *56-FAM, ZEN and / 3IABkFQ are dyes used in oligos

[0841] Example 6: ARNATAR GalNAc in vitro evaluation

[0842] ARNATAR GalNAc compound and Sharma GalNAc compound conjugates were prepared as described in Example 2, wherein the GalNAc compound was conjugated to the same siRNA compound targeting proprotein convertase subtilisin / kexin type 9 (PCSK9) on the sense strand of the duplex, as shown in Table 7.

[0843] Table 7: PCSK9 siRNA

[0844]

[0845]

[0846] (5p) = 5'-phosphate

[0847] d (or no sign before the nucleotide) = deoxyribonucleotide substituted for ribonucleotide

[0848] f=2'-F

[0849] m=2'-OMe

[0850] * = phosphorothioate (PS) bond

[0851] GalNAc-AN=ARNATAR GalNAc

[0852] GalNAc-GL=Sharma GalNAc

[0853] Table 8: Human PCSK9 Primer-Probe Set

[0854] Primer name Primer sequence (5' to 3') SEQ ID NO: PCSK9 forward primer TCACCAAGATCCTGCATGTC 13 PCSK9 reverse primer GTTCCACGGGATGCTCTG 14 PCSK9 probe 56-FAM / CAGGTCGCC / ZEN / ACTCATCTTCACCA / 3IABkFQ* 15

[0855] *56-FAM, ZEN and / 3IABkFQ are dyes used in oligos

[0856] In vitro evaluation of primary human hepatocytes

[0857] GalNAc-conjugated PCSK9 siRNA was incubated with human primary hepatocytes to allow free uptake of the GalNAc-siRNA conjugate (i.e., entry into the cells without transfection). Knockdown of PCSK9 expression was used as a marker to assess the ability of each GalNAc type to deliver siRNA targeting PCSK9 to hepatocytes.

[0858] Different doses of PCSK9 siRNA (final concentrations of 0 μM, 0.001 μM, 0.01 μM, 0.1 μM, 1 μM, or 10 μM) were added to human primary hepatocytes (HPH) (Xenotech, Kansas City, KS, USA) and cultured at 37°C and 5% CO. 2 Incubate at 4 °C for 4 days. siRNA activity was determined by measuring target mRNA levels by qRT-PCR using the PCSK9 primer probe set listed in Table 8. qRT-PCR was performed using AgPath-ID TM One-step RT-PCR was performed in a QS3 real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The target RNA levels in the qRT-PCR assay were normalized to those in the Ribogreen TM Total RNA levels were measured by RT-PCR (ThermoFisher Scientific, Waltham, MA, USA) or GAPDH mRNA levels were detected in RNA sample aliquots using qRT-PCR.

[0859] Figure 4 The percentage of PCSK9 mRNA 4 days after free uptake of GalNAc-conjugated siRNA by HPH is shown. Blank PBS treatment was used as a control.

[0860] in conclusion

[0861] ARNATAR GalNAc compounds are novel GalNAc compounds that are more potent than the GalNAc compounds previously published by Sharma et al. This study demonstrates that ARNATAR GalNAc conjugates outperform Sharma GalNAc conjugates in primary human hepatocytes at all doses and times evaluated. Surprisingly, despite subtle differences in structure, ARNATAR GalNAc conjugates perform much better than Sharma GalNAc conjugates.

[0862] Table 9: Sequence Listing

[0863]

[0864]

Claims

1. A compound having a structure of formula (0a): in X is a hydroxyl protecting group or an H atom, Y is a hydroxyl protecting group, an H atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and R 1 are independently selected from hydroxyl protecting groups and H atoms.

2. The compound according to claim 1, wherein Y is a cargo, wherein the cargo comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment or a compound having pharmaceutical activity.

3. The compound according to claim 1 or 2, wherein X and R 1 Each represents a H atom.

4. A compound according to any one of the preceding claims, having the structure of formula (Ia): in Oligo refers to modified and / or unmodified oligonucleotides.

5. The compound according to claim 4, wherein the modified and / or unmodified oligonucleotide is a single-stranded or double-stranded modified and / or unmodified oligonucleotide.

6. The compound according to any one of claims 4 to 5, wherein the modified and / or unmodified oligonucleotide is attached via the 3' end of the sense strand.

7. A compound according to any one of claims 4 to 6, wherein the modified and / or unmodified oligonucleotide binds to a target nucleotide sequence and modifies the expression of a gene encoded by the target nucleotide sequence.

8. The compound according to claim 1, which has the structure of formula (IIa): in R 1 independently selected from hydroxyl protecting groups and H atoms, preferably acetyl groups, R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, and R 7 The part of formula (VI): in R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom, Z represents NH or O, and R 8 represents a straight or branched alkylene group having 1 to 8 carbon atoms, optionally one or more of which is substituted by O, S, NH and / or N-(C1-C3 alkyl); and / or a cycloalkylene group having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene or 1,2-cyclohexylene.

9. A compound having a structure of formula (III): in k is 3, R 2 represents a fluorenylmethoxycarbonyl group (Fmoc) or an H atom, R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

10. The compound according to claim 9, wherein the compound has the structure of formula (IIIa): in R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

11. The compound according to claim 9, wherein the compound has a structure of any one of Formula (IIIb1) to Formula (IIIb5): in R represents a solid support, optionally linked via a spacer, an amino protecting group or an H atom, and R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT.

12. A method for preparing a compound having a structure of formula (0a): in X is a hydroxyl protecting group or an H atom, Y is a hydroxyl protecting group, an H atom, a load or a solid support, wherein the load or the solid support is optionally linked via a spacer, and R 1 are independently selected from hydroxyl protecting groups and H atoms, The method comprises the step of reacting a compound having a structure of formula (III) with a compound having a structure of formula (V): in k is 3, R 2 represents an amino protecting group or a H atom, and R 3 represents a solid support, optionally linked via a spacer, a hydroxyl protecting group or an H atom, and R 6 represents a hydroxyl protecting group, preferably DMT or MMT, more preferably MMT, The compound having the structure of formula (V) is: in m is 7, n is 3, R 1 Independently selected from hydroxyl protecting groups, preferably acetyl groups, preferably, wherein the compound of formula (0a) has the structure of formula (Ia): in Oligo indicates modified and / or unmodified oligonucleotide; or The compound of formula (0a) has the structure of formula (IIa): in R 1 independently selected from hydroxyl protecting groups and H atoms, preferably acetyl groups, R 6 represents a hydroxyl protecting group, preferably MMT, and R 7 The part of formula (VI): in R represents a solid support, optionally linked via a spacer, an amino protecting group, a hydroxyl protecting group or an H atom, Z represents NH or O, and R 8 represents a straight or branched alkylene group having 1 to 8 carbon atoms, optionally one or more of which is substituted by O, S, NH and / or N-(C1-C3 alkyl); and / or a cycloalkylene group having 5 to 8 carbon atoms, preferably ethylene, 1,1-dimethylethylene, propylene, n-butylene or 1,2-cyclohexylene.

13. A pharmaceutical composition comprising a compound having a structure of formula (0a): in X is a H atom, Y is a load optionally linked via a spacer, and R 1 is a H atom, and pharmaceutically acceptable carriers, excipients and / or diluents.

14. The pharmaceutical composition according to claim 13, wherein the cargo comprises an oligomeric compound, such as an oligonucleotide, a peptide, an antibody, an antibody fragment or a pharmaceutically active compound.

15. The pharmaceutical composition according to claim 13 or 14, wherein the compound has the structure of formula (Ia): in Oligo refers to modified and / or unmodified oligonucleotides.

Images