A monoclonal antibody for tyrosine iodinated EGFR protein, preparation method and application thereof

By preparing monoclonal antibodies to tyrosine-iodized modified EGFR protein, phage display technology was used to screen out antibodies M018 and M025 with high affinity and specificity, which solved the problem of insufficient rapidity, specificity and sensitivity in the existing detection methods, and achieved efficient detection of tyrosine-iodized modified EGFR protein, supporting tumor diagnosis and drug development.

CN119264258BActive Publication Date: 2025-08-12PEKING UNIV

Patent Information

Application Number
CN202411474023.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-22
Publication Date
2025-08-12
Estimated Expiration
2044-10-22

AI Technical Summary

Technical Problem

Existing methods for detecting tyrosine-iodized modified EGFR proteins lack rapid, highly specific and sensitive, making it difficult to meet the needs of detection and monitoring.

Method used

By preparing monoclonal antibodies that modify EGFR protein with tyrosine iodized, phage display technology was used to screen out antibodies M018 and M025 with high affinity and strong specificity, and combined with immunohistochemistry, Western Blot and other technologies for detection.

Benefits of technology

It has achieved rapid, highly specific and sensitive detection of tyrosine-iodized modified EGFR protein, which is suitable for tumor diagnosis and anti-tumor drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119264258B_ABST
    Figure CN119264258B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology. Specifically, the present invention provides a monoclonal antibody, preparation method, and application of tyrosine iodinated EGFR protein. The present invention prepares tyrosine iodinated EGFR protein antigen peptides, immunizes mice to prepare monoclonal antibodies, and utilizes phage display technology to select and express relevant antibodies using expression vectors. ELISA screening and immunohistochemistry and cell fluorescence detection yield two highly sensitive and specific monoclonal antibodies, M018 and M025. The monoclonal antibodies obtained by screening can be used for the detection and monitoring of tyrosine iodinated modification at position 845 of the EGFR protein, providing support for tumor diagnosis and the development of anti-tumor drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a monoclonal antibody for tyrosine iodinated EGFR protein, a preparation method and an application thereof. Background Art

[0002] Protein phosphorylation is a crucial modification in living organisms. Protein phosphorylation in eukaryotic cells primarily occurs at tyrosine, serine, and threonine. Tyrosine kinases, the largest known protein superfamily, catalyze the transfer of a γ-phosphate group from ATP to tyrosine residues on numerous substrates, causing phosphorylation. This activates various substrate enzymes and downstream signaling pathways, impacting cell proliferation, differentiation, adhesion, migration, invasion, and apoptosis.

[0003] Epidermal Growth Factor Receptor (EGFR) is a type of cell membrane surface receptor with tyrosine kinase activity. EGFR is an important target for promoting mitosis and transformation of tumor cells. The signal transduction mediated by EGFR is closely related to the growth, proliferation, metastasis and other processes of tumor cells.

[0004] CN202310055904.3 discloses that when the iodine sodium transporter (NIS) of the cell is expressed at a high level, sodium iodide can significantly inhibit EGFR protein phosphorylation; when the NIS expression of the cell is low, the iodine uptake function of the cell NIS can be improved by the adjuvant KT5823, so that sodium iodide can normally enter the cell and significantly inhibit EGFR protein phosphorylation, and sodium iodide can significantly inhibit the phosphorylation of EGFR protein, and its phosphorylation sites 845 and 1068 can be significantly inhibited by sodium iodide, and sodium iodide can be used as an inhibitor of EGFR. However, for the purpose of monitoring the situation of iodine modification, in addition to traditional liquid chromatography and mass spectrometry, more detection methods need to be developed for the detection method of iodine modification of tyrosine. Summary of the Invention

[0005] The purpose of the present invention is to provide a monoclonal antibody that can be rapidly, highly specifically, and sensitively iodinated with EGFR protein to meet the needs of detection and monitoring. Through extensive research and screening, the present invention has achieved this goal. The solutions provided by the present invention are as follows:

[0006] A monoclonal antibody against tyrosine-iodinated EGFR protein, the amino acid sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.9.

[0007] A monoclonal antibody against tyrosine-iodinated EGFR protein, the nucleotide sequence of which is shown in SEQ ID NO.2 or SEQ ID NO.10.

[0008] A nucleic acid vector containing a nucleic acid sequence of a monoclonal antibody against tyrosine iodinated EGFR protein, wherein the nucleic acid sequence is shown in SEQ ID NO.13, SEQ ID NO.15, SEQ ID NO.17 or SEQ ID NO.19.

[0009] A method for preparing an iodinated monoclonal antibody to an EGFR protein, the method comprising recombinantly expressing a vector containing heavy and light chain sequences of a monoclonal antibody to the EGFR protein; preferably, the sequence of the light chain of the monoclonal antibody to the EGFR protein is shown in SEQ ID NO.13 or SEQ ID NO.15; and the sequence of the heavy chain of the monoclonal antibody to the EGFR protein is shown in SEQ ID NO.17 or SEQ ID NO.19.

[0010] The invention discloses an application of an iodinated EGFR protein monoclonal antibody, which comprises combining the monoclonal antibody with the EGFR protein in a sample to detect whether the tyrosine at position 845 of the EGFR protein is iodinated.

[0011] The present invention relates to the use of an iodinated monoclonal antibody against EGFR protein in an immunoassay, wherein the immunoassay comprises one or more of immunohistochemistry, Western Blot, immunocytometry, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, and fluorescence resonance energy transfer (FRET). As is well known to those skilled in the art, in an immunoassay, a monoclonal antibody against iodinated EGFR protein can be combined with a target sample to determine the presence of EGFR protein iodinated at position tyrosine 845 in the sample, or to determine the amount of iodinated protein present. In certain embodiments, a secondary antibody is also present to combine with the monoclonal antibody of the present invention. Labeling molecules can also be modified on the antibody of the present invention for direct detection. In certain embodiments, the binding of the antigen and antibody can be detected by detecting changes in the interface caused by antigen-antibody binding, and the binding of the antigen and antibody can be reflected by detecting changes in the interface information, such as changes in the current signal at the interface, changes in the optical information at the interface, or changes in the structural information at the interface. The sample can be obtained from blood, plasma, serum, cells, tissue, feces, urine, or saliva. The sample can be obtained from a human or mammal.

[0012] In one aspect, the present invention discloses a reagent or kit for detecting iodinated EGFR protein, wherein the reagent comprises a monoclonal antibody that specifically binds to iodinated tyrosine at position 845 of the EGFR protein. The amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, or SEQ ID NO.11; preferably, the amino acid sequence of the monoclonal antibody is shown in SEQ ID NO.1 or SEQ ID NO.9.

[0013] In one embodiment, the reagent or kit is suitable for immunohistochemistry, Western Blot, immune cell imaging, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, or fluorescence resonance energy transfer (FRET).

[0014] In one embodiment, immune cell imaging was performed in multiple tumor cell models, including thyroid cancer cells, human placental choriocarcinoma cells, human esophageal cancer cells, and human gastric cancer cells.

[0015] Beneficial effects

[0016] This study, for the first time, screened EGFR protein antibodies (M018 and M025) with high affinity and specificity for iodination of tyrosine 845 using phage display technology. The provided antibodies can be used as functionally modified protein antibodies in non-disease diagnostic and therapeutic research and development, and can also be used as diagnostic antibodies for the detection of iodinated EGFR 845. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The results of human thyroid cancer transplanted tumors detected by immunohistochemistry provided in the embodiment of the present invention;

[0018] Figure 2 The results of human thyroid cancer tissue and human thyroid normal tissue detected by the immunohistochemistry method provided in the embodiment of the present invention;

[0019] Figure 3 The specificity results of the M018 and M025 antibodies for detecting human thyroid cancer B-Cpap cells using the high-content live cell imaging method provided in the embodiments of the present invention;

[0020] Figure 4 The antibody recognition specificity results of human thyroid cancer B-Cpap cells detected by high-content live cell imaging provided in the embodiment of the present invention;

[0021] Figure 5The antibody recognition specificity results of immortalized human thyroid Nthy-Ori-3-1 cells detected by high-content live cell imaging provided in the embodiments of the present invention;

[0022] Figure 6 The antibody recognition specificity results of human placental choriocarcinoma BeWo cells detected by high-content live cell imaging provided in the embodiments of the present invention;

[0023] Figure 7 The antibody recognition specificity results of human esophageal cancer TE-1 cells detected by high-content live cell imaging provided in the embodiment of the present invention;

[0024] Figure 8 This is the antibody recognition specificity result of human gastric cancer MKN-45 cells detected by high-content live cell imaging method provided in the embodiment of the present invention. DETAILED DESCRIPTION

[0025] The present invention will be further described below with reference to specific embodiments.

[0026] Example 1:

[0027] Preparation of a monoclonal antibody targeting EGFR 845 site tyrosine iodination modification, the preparation method comprising:

[0028] (1) Synthesis of EGFR peptide antigen modified with iodine at position 845: Synthesize the iodinated peptide EGFR(I): EKEY(I)HAEGGKVPC; at the same time, synthesize the EGFR peptide antigen EGFR(no I): EKEYHAEGGKVPC with non-iodine modification at position 845.

[0029] (2) The synthesized iodinated modified peptide EGFR (I) and non-iodinated modified peptide EGFR (no I) were coupled to BSA as immune antigens.

[0030] (3) The above-mentioned immune antigens were mixed and emulsified with Freund's complete adjuvant, and experimental animals (Balb / c mice) were immunized subcutaneously at multiple points (more than 8 points) with an immunization dose of 0.5 mg / mouse. A second immunization was performed two weeks later, with an area measurement of 0.5 mg / mouse. From the third immunization onwards, no adjuvant was added. After three immunizations, tail blood was collected and serum titers were determined by gradient dilution using the ELISA method. Based on the ELISA titer of 24W, if the titer requirement was not met, immunization was continued. If the titer requirement was met, all blood samples from the mice were collected based on the titer results, and the serum was centrifuged to separate and spleen tissue was collected.

[0031] (4) Establish an antibody light chain and heavy chain ScFv phage display library through reverse transcription, in vitro gene amplification, and phagemid construction to prepare for the next step of panning.

[0032] (5) Target phage panning: Add the phage solution to a high-affinity ELISA plate coated with EGFR(I) antigen for panning, collect the eluted phages, rescue and amplify them, and obtain a phage primary screening library;

[0033] (6) Antibody DNA sequencing: After phage screening, the sequence of the candidate monoclonal antibody is obtained by antibody DNA sequencing.

[0034] (7) Construct an expression vector to express and purify the candidate antibody.

[0035] (8) Use ELISA to screen antibodies with stable and high affinity for antigen proteins.

[0036] Results: 1.1 The specific sequences of several monoclonal clones screened in step (6) are shown in Table 1.

[0037] Table 1 Sequence information of candidate antibodies

[0038]

[0039]

[0040]

[0041] 1.2 The construction of related antibody gene vectors is demonstrated using M018 and M025 as examples:

[0042] 1) The VL nucleotide sequence of the M018 antibody obtained by sequencing and analysis is:

[0043] GATGTTTTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCCTCTTATATAGTGATGGCAAGACATATTTGAATTGGTTCTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTC TAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTATTGCTCTCAAAGTACACGTTTTCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA(SEQ ID NO.13)

[0044] The VL sequence information of the M018 antibody expression vector for construction is as follows:

[0045] atgggctggtcctgtatcatcctgttcctggtggctacagccacaggagtgcatagtGATGTTTTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCCTCTTATATAGTGATGGCAAGACATATTTGAATTGGTTCTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTCTAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTATTGCTCTCAAAGTACACGTTTTCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAcgggctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggcagtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagcacctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacaggaatgagtgttaa(SEQ ID NO.14);

[0046] Among them, atgggctggtcctgtatcatcctgttcctggtggctacagccacaggagtgcatagt is the signal peptide sequence;

[0047] cgggctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggcagtgaacgacaaaatggcgtcctgaacagt tggactgatcaggacagcaaagacagcacctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacaggaatgagtgttaa is the constant region sequence.

[0048] 2) The VL nucleotide sequence of the M025 antibody obtained by sequencing and analysis is:

[0049] GATGTTGTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCTCTTAGATAGTGATGGAAAGACATATTTGAATTGGTTGTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTC TAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTATTGCTGGCAAGGTACACATTTTCCTCGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA(SEQ ID NO.15)

[0050] The VL sequence information used to construct the M025 antibody expression vector is:

[0051] atgggctggtcctgtatcatcctgttcctggtggctacagccacaggagtgcatagtGATGTTGTGATGACCCAGACTCCACTCACTTTGTCGGTTACCATTGGACAACCAGCCTCCATCTCTTGCAAGTCAAGTCAGAGCCTCTTAGATAGTGATGGAAAGACATATTTGAATTGGTTGTTACAGAGGCCAGGCCAGTCTCCAAAGCGCCTAATCTATCTGGTGTCTAAACTGGACTCTGGAGTCCCTGACAGGTTCACTGGCAGTGGATCAGGGACAGATTTCACACTGAAAATCAGCAGAGTGGAGGCTGAGGATTTGGGAGTTTATTATTGCTGGCAAGGTACACATTTTCCTCGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAAcgggctgatgctgcaccaactgtatccatcttcccaccatccagtgagcagttaacatctggaggtgcctcagtcgtgtgcttcttgaacaacttctaccccaaagacatcaatgtcaagtggaagattgatggcagtgaacgacaaaatggcgtcctgaacagttggactgatcaggacagcaaagacagcacctacagcatgagcagcaccctcacgttgaccaaggacgagtatgaacgacataacagctatacctgtgaggccactcacaagacatcaacttcacccattgtcaagagcttcaacaggaatgagtgttaa(SEQ ID NO.16).

[0052] 3) The VH nucleotide sequence of the M018 antibody obtained by sequencing and analysis is as follows:

[0053] GAGGTTCAGCTGCAGCAGTCTGCAGATGAACTGGCAAGACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACAGTTTTACTGGTTACACGATACACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCCAGCAGTGGATATACTGAGTACAATCAGAAGTTCAAGGACAAGACCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGGCATCTGAGGACTCTGCGGTCTATTATTGTTCAAGATATAAAGGGGGCTATTGGGGCCAAGGCTCCACTCTCACAGTCTCCTCA(SEQ ID NO.17)

[0054] The VH sequence information for constructing the M018 antibody expression vector is as follows:

[0055]

[0056] Among them, atgggctggtccctgattctgctgttcctggtggctgtggctaccagggtgctgagt is a signal peptide,

[0057] gccaaaacaacagccccatcggtctatccactggcccctgtgtgtggagatacaactggctcctcggtgactctaggatgcctggtcaagggttatttccctgagccagtgaccttgacctggaactctggatccctgtccagtggtgtgcacaccttcccagctgtcctgcagtctgacctctacaccctcagcagctcagtgactgtaacctcgagcacctggcccagccagtccatcacctgcaatgtggcccacccggcaagcagcaccaaggtggacaagaaaattgagcccagagggcccacaatcaagccctgtcctccatgcaaatgcccagcacctaacctcttgggtggaccatccgtcttcatcttccctccaaagatcaaggatgtactcatgatctccctgagccccatagtcacatgtgtggtggtggatgtgagcgaggatgacccagatgtccagatcagctggtttgtgaacaacgtggaagtacacacagctcagacacaaacccatagagaggattacaacagtactctccgggtggtcagtgccctccccatccagcaccaggactggatgagtggcaaggagttcaaatgcaaggtcaacaacaaagacctgccagcgcccatcgagagaaccatctcaaaacccaaagggtcagtaagagctccacaggtatatgtcttgcctccaccagaagaagagatgactaagaaacaggtcactctgacctgcatggtcacagacttcatgcctgaagacatttacgtggagtggaccaacaacgggaaaacagagctaaactacaagaacactgaaccagtcctggactctgatggttcttacttcatgtacagcaagctgagagtggaaaagaagaactgggtggaaagaaatagctactcctgttcagtggtccacgagggtctgcacaatcaccacacgactaagagcttctcccggactccgggtaaatga is the constant region sequence.

[0058] 4) The VH nucleotide sequence of the M025 antibody obtained by sequencing and analysis is:

[0059] CAGGTGCAACTTCAGCAGTCTGGGACTGTGTTGGCAAGGCCTGGGGATTCCGTGAAGATGTCCTGCAAGACTTCTGGCTACAGGTTTACCAGACAGTGGATGCACTGGGTAAAACAGAGGCCTGGGCAGGGTCTAGAATGGATTGGTACTATTTATCCTGGAGATGGTGAT ACTAGATACAACCAGAAGTTCAAGGACAAGGCCAAACTGTCTGCAGTCACATCCGCCAGCACTGCCTACATGGAACTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTTCAACTACGATAGTCCACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA(SEQ ID NO.19)

[0060] The VH sequence information used to construct the M025 antibody expression vector is:

[0061]

[0062] 5) PCR system reaction conditions:

[0063] component volume 2×KOD PCR Master mix 25 μL Forward primer (10 μM) 1 μL Reward primer (10μM) 1 μL template (10pg-200ng) ~1μL <![CDATA[ddH2O]]> ~22 μL

[0064] The primer sequences are as follows:

[0065] Primer name sequence Primer sequence number EGFR(I)-M018-VL-F cacaggagtgcatagtGATGTTTTGATGACCCC SEQ ID NO.21 EGFR(I)-M018-VL-R ttggtgcagcatcagcccgTTTTATTTCCAGCTTGGT SEQ ID NO.22 EGFR(I)-M018-VH-F taccagggtgctgagtGAGGTTCAGCTGCAGC SEQ ID NO.23 EGFR(I)-M018-VH-R gggctgttgttttggcTGAGGAGACTGTGAGAGT SEQ ID NO.24 EGFR(I)-M025-VL-F cacaggagtgcatagtGATGTTGTGATGACCCC SEQ ID NO.25 EGFR(I)-M025-VL-R ttggtgcagcatcagcccgTTTGATTTCCAGCTTGG SEQ ID NO.26 EGFR(I)-M025-VH-F taccagggtgctgagtCAGGTGCAACTTCAGC SEQ ID NO.27 EGFR(I)-M025-VH-R gggctgttgttttggcTGAGGAGACTGTGAGAGT SEQ ID NO.28

[0066] Before the first cycle, the template was pre-denatured at 94°C for 2 minutes;

[0067] Denaturation: 98°C for 10 seconds;

[0068] Annealing at 58°C for 10 seconds;

[0069] Extension 68°C, 1 s;

[0070] The reaction was repeated for 30 cycles. After the final cycle, the sample was extended at 68°C for 5 minutes to fill the ends. The PCR products were detected by electrophoresis on a 1% agarose gel, and the target fragments were recovered at the corresponding lengths.

[0071] 6) Vector Ligation: Ligate the PCR products to the pABm vector by adding 7 μL of the PCR product to 1 μL of the pABm vector, 1 μL of 10× ligation buffer, and 1 μL of T4 DNA ligase. Ligate overnight at 16°C. The ligated vectors were named: pABm-EGFR(I)-M018-mKappa-VL, pABm-EGFR(I)-M018-mIgG2a-VH, pABm-EGFR(I)-M025-mKappa-VL, and pABm-EGFR(I)-M025-mIgG2a-VH.

[0072] 7) Transformation: Transform DH5α competent cells using the ligation system as follows: Remove one tube of competent cells from a -80°C freezer and immediately place on ice; add the ligation system (no more than 10 μL), mix gently, and place on ice for 30 minutes; heat shock the tube in a 42°C water bath for 90 seconds, then quickly cool on ice for 3-5 minutes; add 1 mL of LB liquid medium (without antibiotics) to the tube, mix thoroughly, and incubate at 37°C at 200 rpm on a shaker for 1 hour to allow the bacteria to resume normal growth; centrifuge the above bacterial solution, remove 800 μL of the supernatant, pipette and mix the remaining medium, then spread it on a screening plate containing the corresponding antibiotic (including antibiotic-ampicillin); invert the culture plate and incubate at 37°C for 16-24 hours; pick the transformed plate and incubate in LB liquid medium (containing antibiotic-ampicillin) at 37°C with shaking overnight.

[0073] 8) Identification of positive clones: Take an appropriate amount of the bacteria cultured overnight at 37°C with shaking for sequencing.

[0074] 9) Extraction of recombinant plasmids: The bacteria with successfully constructed plasmids were inoculated into LB liquid culture medium and cultured at 37°C with shaking for 12-24 hours. Plasmid DNA was extracted from the bacterial liquid using an endotoxin-free plasmid extraction kit.

[0075] 10) Transient transfection of recombinant plasmid into HEK293E cells: The recombinant plasmid DNA was transiently transfected into HEK293E cells using the PEI transfection method; within 12-24 hours before transfection, HEK293E cells were subcultured in 10% DMEM medium containing fetal bovine serum at a subculture density of 4×10 5 mL; prepare a plasmid DNA-PEI mixture with a PEI to DNA ratio of 3:1. The formulas of the two antibodies are shown in Table 1 below:

[0076]

[0077] HEK293E cells to be transfected were transferred to serum-free DMEM medium, and the DNA-PEI mixture was then added dropwise. Three hours after cell transfection, an equal volume of DMEM medium containing 10% fetal bovine serum was used. After culturing in a 37°C, 5% CO2 incubator for 36-48 hours, the harvested cell supernatant was isolated and purified.

[0078] 11) Antibody Isolation and Purification: ① Centrifuge the cultured cells in a refrigerated centrifuge (5000 rpm, 30 min, 4°C) and retain the supernatant. ② Filter the supernatant through a 0.45 μm filter. ③ Add 5 mL of Protein G filler to the filtered bacterial solution and incubate at 4°C for 2 h. Purify the protein using a chromatography column. The following steps are as follows: Pass the incubated bacterial solution through the chromatography column at a rate of 1 mL / min. Equilibrate the column with Buffer A (PBS, pH 8.0). Elute the column with 0.1 M glycine (pH 2.7, adjusted to neutral with 2 M Tris, pH 9.0). Analyze the eluted samples by SDS-PAGE for the presence of the target protein. ④ Collect the eluted protein and dialyze it into PBS (pH 8.0) overnight at 4°C. Verify the purity of the target protein using SDS-PAGE.

[0079] 1.3 The process and results of ELISA detection of candidate antibodies are shown in Tables 2 and 3

[0080] Table 2 EGFR antibody sample detection

[0081]

[0082] Table 3 EGFR antibody competition assay

[0083]

[0084] Example 2 Immunohistochemical verification of antibody binding ability

[0085] In this example, the immunohistochemical results of antibodies M018 and M025 obtained in Example 1 of the present invention were compared. In this example, the immunohistochemical process, except for the primary antibody, all other reagents and experimental conditions were the same, and the concentration of the primary antibody was also the same. The specific immunohistochemical operation steps are as follows:

[0086] 1. Dewax the paraffin sections and wash them in distilled water for 5 minutes.

[0087] 2. Place the slices in the repair solution, heat and wait for the water to boil, remove the repair box, and allow the slices to cool naturally to room temperature.

[0088] 3. Add 3% hydrogen peroxide, incubate at room temperature, and wash with PBS buffer.

[0089] 4. Add blocking solution and block at 37℃ for 30 minutes.

[0090] 5. Add M018 and M025 antibodies respectively and incubate overnight at 4°C.

[0091] 6. Wash the sections with PBS buffer, add secondary antibody, and block at 37°C for 30 minutes.

[0092] 7. DAB color development: Wash the tissue with PBS buffer, add DAB color development solution, and color development at room temperature.

[0093] 8. Hematoxylin counterstaining: Wash the surface of the slice with tap water, soak the slice in a hematoxylin staining jar, remove the slice and then wash it with tap water. Place it in 1% hydrochloric acid alcohol for differentiation, then remove it immediately and rinse the slice with tap water.

[0094] 9. Soak the slices in 90% ethanol and anhydrous ethanol in turn, use a hair dryer to dry the alcohol remaining on the surface of the tissue, and use resin to seal the slices.

[0095] Dyeing effect as attached Figure 1 As shown, from Figure 1 It can be seen that the antibody M018 of the present invention is localized in the cell nucleus, and the antibody M025 of the present invention is localized in the cytoplasm. Figure 2 The results showed that the M025 antibody was accurately positioned during the immunohistochemistry process, with clear staining, no nonspecific staining, and a clean background.

[0096] Example 3: Validation of M018 and M025 Antibodies by High-Content Live Cell Imaging

[0097] In this example, the antibody M018 obtained in Example 1 was validated by live cell imaging. The specific steps are as follows:

[0098] 1. Instruments and reagents:

[0099] High-content cell imaging analysis system (Molecular Devices); fixative: (4% paraformaldehyde) FIXATION BUFFER (Biolegent, cat. no. 420801); permeabilization solution: PBS containing 0.25% Triton X-100; blocking solution / antibody diluent: QuickBlock immunostaining blocking solution (Biyuntian, P0260); antibodies M018 and M025; secondary antibody Anti-mouse IgG (H+L), F(ab')2 Fragment (Alexa Fluor 647 Conjugate) (#4410S).

[0100] 2. B-CPAP cell culture and analysis of iodination modification of EGFR protein 845 site

[0101] (1) B-CPAP cell recovery and passage: Thaw the cryovial containing 1 mL of cell suspension by rapid shaking in a 37°C water bath. Add 5 mL of culture medium (RPMI-1640 + 10% FBS + 1% Penicillin-Streptomycin Solution) and mix thoroughly. Centrifuge at 500 RPM for 5 minutes, discard the supernatant, add 4-6 mL of complete culture medium, and then blow thoroughly. Then, add all the cell suspension to a culture flask and culture overnight (or add the cell suspension to a 6 cm dish) and culture overnight. Change the medium the next day and check the cell density.

[0102] When the cell density reaches 80%-90%, subculture can be performed. Preheat 0.25% trypsin-0.53mM EDTA digestion solution at 37°C, pour out the culture medium in the culture flask, add 3-5mL PBS to the culture flask, shake gently to wash, and discard. Add 1-2ml of preheated trypsin to the flask and incubate at 37°C for digestion. After digestion, add 3mL of complete culture medium to terminate digestion. Use a pipette to gently blow the cells on the flask wall to completely detach them, then collect the cell suspension, centrifuge at 1200rpm for 3min, discard the supernatant, add complete culture medium to resuspend the cells, and then subculture.

[0103] (2) When the cells have grown to a sufficient amount, collect the cells and determine the cell density. Then, plate the cells into a 96-well plate with 2×10 cells per well. 4 The cells were cultured overnight in a 37°C, 5% carbon dioxide cell culture incubator.

[0104] (3) Cell fixation: Wash the cultured cells 2-3 times with phosphate buffered saline (PBS); add an appropriate amount of fixative and fix at room temperature for 15 minutes.

[0105] (5) Cell washing: Wash with permeabilization solution, 200uL per well, and shake and wash twice.

[0106] (6) Permeabilization: 200 μL of permeabilization solution per well, permeabilization for 15 minutes.

[0107] (7) Blocking: QuickBlock immunostaining blocking solution, 100 μL per well, room temperature for 15 minutes.

[0108] (8) Primary antibody incubation: Pour off the blocking solution and incubate with 50 μL of primary antibody per well at 4°C overnight.

[0109] (9) Cleaning: Clean 3 times with permeabilization solution.

[0110] (10) Secondary antibody incubation: antibody diluent + secondary antibody (1:1000) + Hoechst (1:100), 50uL per well, room temperature for 1h.

[0111] (11) Cleaning: Clean 3 times with permeabilization solution.

[0112] (12) High-content detection: Discard the washing solution and add 200 μL of Flurbrite DMEM. Protect from light and immediately perform detection using a high-content cell imaging analysis system. The high-content cell imaging analysis system selects two channels for detection: DAPI and Cy5. The exposure time for the DAPI channel is 5 ms, and the exposure time for the Cy5 channel is 100 ms. A 20x lens is used, and 9 fields of view per well are collected. EGFR expression levels are analyzed using the system's own analysis software.

[0113] Dyeing effect as attached Figure 3 As shown in the figure, it can be seen that the staining effect of antibodies M018 and M025 is good. The results show that antibodies M018 and M025 are accurately localized in living cells, with clear staining, no nonspecific staining, and a clean background. Therefore, both antibodies M018 and M025 can be used for live cell imaging detection.

[0114] Example 4: High-content B-CPAP live cell imaging verification:

[0115] 1. Instruments and reagents:

[0116] High-content cell imaging analysis system (Molecular Devices); fixative: (4% paraformaldehyde) FIXATION BUFFER (Biolegent, cat. no. 420801); permeabilization buffer: PBS containing 0.25% Triton X-100; blocking buffer / antibody diluent: QuickBlock immunostaining blocking buffer (Biolegent, P0260); antibody M018 or M025; secondary antibody anti-mouse IgG (H+L), F(ab')2 Fragment (Alexa Fluor 647 Conjugate) (#4410S).

[0117] 2. B-CPAP cell culture and analysis of iodination modification of EGFR protein 845 site

[0118] (1) B-CPAP cell recovery and passage: Thaw the cryotube containing 1 mL of cell suspension by rapid shaking in a 37°C water bath. Add 5 mL of culture medium (RPMI-1640 + 10% FBS + 1% Penicillin-Streptomycin Solution) and mix thoroughly. Centrifuge at 500 rpm for 5 minutes, discard the supernatant, add 4-6 mL of complete culture medium, and then blow thoroughly. Then, add all the cell suspension to a culture flask and culture overnight (or add the cell suspension to a 6 cm dish) and culture overnight. Change the medium the next day and check the cell density.

[0119] When the cell density reaches 80%-90%, subculture can be performed. Preheat 0.25% trypsin-0.53mM EDTA digestion solution at 37°C, discard the culture medium in the culture flask, add 3-5mL PBS to the culture flask, shake gently to wash, and discard. Add 1-2mL of preheated trypsin to the flask and incubate at 37°C for digestion. After digestion, add 3mL of complete culture medium to terminate digestion. Use a pipette to gently blow the cells on the flask wall to completely detach them, then collect the cell suspension, centrifuge at 1200rpm for 3 minutes, discard the supernatant, add complete culture medium to resuspend the cells, and then subculture.

[0120] (2) When the cells have grown to a sufficient amount, collect the cells and determine the cell density. Then, plate the cells into a 96-well plate with 2×10 cells per well. 4 The cells were cultured overnight in a 37°C, 5% carbon dioxide cell culture incubator.

[0121] (3) Iodide Modifier Treatment: Prepare EGFR iodide-modified medium by adding an appropriate amount of 200 mM sodium iodide stock solution to each cell culture medium to prepare a cell culture medium with a sodium iodide concentration of 100 μM. After overnight incubation of cells, carefully aspirate the cell culture medium and add EGFR iodide-modified medium. Continue incubating at 37°C, 5% CO2 in a cell culture incubator for 24 hours.

[0122] (4) Cell fixation: Wash the cells cultured in EGFR iodine-modified medium with phosphate buffered saline (PBS) 2-3 times; add an appropriate amount of fixative and fix at room temperature for 15 minutes.

[0123] (5) Cell washing: Wash with permeabilization solution, 200uL per well, and shake and wash twice.

[0124] (6) Permeabilization: 200 μL of permeabilization solution per well, permeabilization for 15 minutes.

[0125] (7) Blocking: QuickBlock immunostaining blocking solution, 100 μL per well, room temperature for 15 minutes.

[0126] (8) Primary antibody incubation: Pour off the blocking solution and incubate with 50 μL of primary antibody per well at 4°C overnight.

[0127] (9) Cleaning: Clean 3 times with permeabilization solution.

[0128] (10) Secondary antibody incubation: antibody diluent + secondary antibody (1:1000) + Hoechst (1:100), 50uL per well, room temperature for 1h.

[0129] (11) Cleaning: Clean 3 times with permeabilization solution.

[0130] (12) High-content detection: Discard the washing solution and add 200 μL of FluoroBrite DMEM containing Hoechst nuclear stain. Protect from light and immediately perform high-content cell imaging analysis system detection. The high-content cell imaging analysis system selects two channels for detection: DAPI and Cy5. The exposure time of the DAPI channel is 5 ms, and the exposure time of the Cy5 channel is 100 ms. A 20X lens is used, and 9 fields of view per well are collected. The EGFR expression level is analyzed using the analysis software provided by the system.

[0131] The same method was also used to analyze the casein iodination modification of EGFR protein 845 site in immortalized thyroid cells Nthy-Ori-3-1 cells, human placental chorionic villus carcinoma cells BeWo, human esophageal cancer cells TE-1, and human gastric cancer cells MKN-45.

[0132] Results: See Figure 4-Figure 8, it can be seen that after sodium iodide treatment, iodination modification at site 845 of the EGFR protein was significantly increased in B-CPAP, Nthy-Ori-3-1, BeWo, TE-1, and MKN-45 cells. Therefore, the iodinated antibodies at site 845 of the EGFR protein of the present invention and their applications can provide a basis for the development of cancer drugs.

[0133] The above content is a further detailed description of the present invention in conjunction with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, they can make several simple deductions or substitutions without departing from the concept of the present invention, which should be regarded as falling within the scope of protection determined by the claims submitted for the present invention.

Claims

1. A monoclonal antibody against tyrosine-iodinated EGFR protein, characterized in that: The nucleotide sequence of the monoclonal antibody is shown in SEQ ID NO.1 or SEQ ID NO.

9.

2. A monoclonal antibody against tyrosine-iodinated EGFR protein, characterized in that: The amino acid sequence of the monoclonal antibody is shown as SEQ ID NO.2 or SEQ ID NO.

10.

3. Use of a monoclonal antibody against iodinated EGFR protein in the preparation of a kit, characterized in that: The kit is used to combine the monoclonal antibody according to claim 1 or claim 2 with the EGFR protein in a sample to detect whether iodination modification exists at the tyrosine at position 845 of the EGFR protein.

4. Use of the monoclonal antibody against iodinated EGFR protein according to claim 1 or claim 2 in the preparation of an immunoassay kit, characterized in that: The immunoassay includes one or more of immunohistochemistry, immunocytometry, immunochemiluminescence, immunofluorescence, ELISA, immunolateral flow, immunoelectrochemistry, and fluorescence resonance energy transfer (FRET).

5. The use according to claim 4, characterized in that The samples for immunoassay are one or more of blood, plasma, serum, cells, tissue, feces, urine, and saliva.

6. The use according to claim 5, characterized in that The immunoassay is used for cell imaging of tumor cell models, including thyroid cancer cells, human placental choriocarcinoma cells, human esophageal cancer cells, and human gastric cancer cells.

7. A reagent for detecting iodinated EGFR protein, characterized in that: The reagent includes a monoclonal antibody that specifically binds to the iodinated tyrosine at position 845 of the EGFR protein. The nucleotide sequence of the monoclonal antibody is shown in SEQ ID NO.1 or SEQ ID NO.

9.

8. A kit for detecting iodinated EGFR protein, characterized in that: The kit comprises a monoclonal antibody that specifically binds to iodinated tyrosine at position 845 of the EGFR protein. The nucleotide sequence of the monoclonal antibody is shown in SEQ ID NO.1 or SEQ ID NO.9.

Citation Information

Patent Citations

  • EGFR (epidermal growth factor receptor) protein phosphorylation inhibition reagent, inhibition method and application

    CN116407555A

  • Monoclonal antibody for resisting human thyroglobulin and application thereof

    CN117487011A

Cited By

  • Monoclonal antibody of tyrosine iodination modified PP2A protein, preparation method and application

    CN122255284A