Bacillus natto for inhibiting porcine rotavirus, construction method thereof and application

Abstract

The present invention discloses a Bacillus natto for inhibiting porcine rotavirus, its construction method and application, belonging to the technical fields of medicine and animal husbandry. In the present invention, a recombinant Bacillus natto is constructed. Taking porcine intestinal epithelial cells (IPEC-J2) as the research object, according to whether the IPEC-J2 cells are treated with PoRV or the fermentation broth of the original Bacillus natto and the fermentation broth of the constructed Bacillus natto (100 μL), a negative control group, a PoRV infection group and a fermentation broth + PoRV infection group are respectively set up. By detecting the replication and proliferation of PoRV in IPEC-J2 cells, it is found that the constructed Bacillus natto can effectively inhibit the replication of porcine rotavirus. The present invention has wide applications in the production of antiviral drugs and feed additives.

Description

Technical Field

[0001] The invention mainly relates to a Bacillus natto for inhibiting porcine rotavirus and a construction method and application thereof, and belongs to the technical fields of medicine and animal husbandry. Background Art

[0002] Porcine rotavirus disease, caused by porcine rotavirus (PoRV), is an infectious disease of acute gastroenteritis characterized by diarrhea, vomiting, anorexia, and dehydration. PoRV, a member of the genus Rotavirus in the family Reoviridae, is a non-enveloped, double-stranded RNA (dsRNA) virus containing 11 dsRNA genome segments encoding six structural proteins, VP1 to VP4, VP6, and VP7, and six nonstructural proteins, NSP1 to NSP6. NSP5 and VP6 are essential components for viral invasion and replication. Porcine rotavirus is one of the leading pathogens causing severe diarrhea in piglets worldwide, causing significant economic losses to the global swine industry. Porcine rotavirus infection is characterized by a short incubation period, strong infectivity, wide prevalence, and high morbidity. Co-infection with other bacteria and viruses often exacerbates the disease and leads to increased mortality in affected pigs.

[0003] Vaccines for preventing porcine rotavirus mainly include inactivated vaccines and attenuated vaccines. Inactivated vaccines offer good safety and are easy to transport and store, but their immune effectiveness is not guaranteed, and they require a large injection dose and are costly. Attenuated vaccines offer rapid immunity but carry the risk of reversion to virulence. However, there are currently no specific treatments for PoRV. Therefore, the present invention provides a method for effectively treating PoRV infection. The probiotics used reproduce rapidly, are highly resilient, and are safe and non-toxic. This invention provides a new research direction for the study of porcine rotavirus and a scientific basis for the production of antiviral drugs or feed additives. Summary of the Invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention provides a natto Bacillus subtilis that inhibits porcine rotavirus, as well as a construction method and application thereof, aiming to solve the technical problem in the prior art of lacking a Bacillus subtilis that can effectively act on rotavirus-infected porcine intestinal epithelial cells.

[0005] The first technical solution provided by the present invention is a recombinant Bacillus natto, which is based on the Bacillus natto with a deposit number of CCTCC CB 20081702 as a chassis strain, and overexpresses a mutant of the DegU regulatory protein (degU) on the chassis strain, wherein the mutant is a mutation of leucine at position 74 of the HTH region of the parent DegU regulatory protein.

[0006] In certain embodiments, the nucleotide sequence of the parental coding gene (degU gene) is shown in SEQ ID NO: 1, and the genebank ID of the degU gene is CP101933.1.

[0007] In certain embodiments, the mutant is a mutation of leucine at position 74 of the HTH region of the parent DegU regulatory protein to arginine.

[0008] Furthermore, the nucleotide sequence of the gene encoding the mutant is shown in SEQ ID NO: 2.

[0009] The second technical solution provided by the present invention is a method for constructing a recombinant Bacillus natto, wherein the method is to overexpress a mutant having a DegU regulatory protein (degU) on a chassis strain, wherein the chassis strain is Bacillus natto with a deposit number of CCTCCCB 20081702, and the mutant is a mutation of the leucine at position 74 in the HTH region of the DegU regulatory protein parent to arginine.

[0010] In certain embodiments, the nucleotide sequence of the parental coding gene (degU gene) is shown in SEQ ID NO: 1, and the genebank ID of the degU gene is CP101933.1.

[0011] In certain embodiments, the nucleotide sequence of the gene encoding the mutant is shown in SEQ ID NO: 2.

[0012] In certain embodiments, the method comprises the following steps: (1) using the total DNA of Bacillus natto as a template, amplifying the degU gene by PCR, and ligating the amplified degU gene with the vector pHY-P43 to obtain a recombinant plasmid pHY-P43-degU;

[0013] (2) using the Dpn I method and the recombinant plasmid pHY-P43-degU from step (1) as a template for point mutation of the degU gene to obtain the degU' gene;

[0014] (3) Using the p7c6 plasmid, BS00 genome, and the degU' gene from step (2) as templates, the lox71-Cm containing the chloramphenicol resistance gene was cloned into the lox71-Cm r -lox66 cassette and degU' gene fragment were connected together to obtain the fusion fragment Cm r -degU';

[0015] (4) The fusion fragment Cm in step (3) r-degU' was transformed into Bacillus natto competent cells, and then the chloramphenicol resistance gene in the strain was knocked out through the Cre / lox recombination system to obtain recombinant Bacillus natto.

[0016] The third technical solution provided by the present invention is a product containing the recombinant Bacillus sp. described in the first technical solution.

[0017] In certain embodiments, the products include microbial preparations, compositions, and feed additives.

[0018] In certain embodiments, the amount of the recombinant Bacillus natto added to the product is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

[0019] The fourth technical solution provided by the present invention is the use of the Bacillus natto described in the first technical solution, or the product described in the third technical solution, in the preparation of a drug for treating and / or alleviating porcine rotavirus infection.

[0020] The fifth technical solution provided by the present invention is a method for inhibiting rotavirus infection of porcine intestinal epithelial cells in vitro, wherein the method uses the Bacillus natto described in the first technical solution as a fermentation agent for fermentation, and the obtained fermentation product is contacted with rotavirus-infected porcine intestinal epithelial cells.

[0021] The sixth technical solution provided by the present invention is the use of the Bacillus natto described in the first technical solution in the preparation of a product for inhibiting rotavirus infection of porcine intestinal epithelial cells.

[0022] In certain embodiments, the inhibition comprises at least one of the following effects:

[0023] (1) Reduce NSP5 gene expression in rotavirus-infected porcine intestinal epithelial cells;

[0024] (2) reduce rotavirus titers;

[0025] (3) Reduce the expression of VP6 protein in rotavirus-infected pig intestinal epithelial cells.

[0026] The seventh technical solution provided by the present invention is a mutant of a DegU regulatory protein, wherein the leucine at position 74 of the HTH region of the parent DegU regulatory protein is mutated to arginine, and the nucleotide sequence of the parent is shown in SEQ ID NO: 1.

[0027] The beneficial effects of the present invention are as follows:

[0028] The present invention constructs a recombinant Bacillus natto strain and uses porcine intestinal epithelial cells (IPEC-J2) as the research object. Depending on whether the IPEC-J2 cells are treated with PoRV, original Bacillus natto fermentation broth, or constructed Bacillus natto fermentation broth (100 μL), a negative control group, a PoRV infection group, and a fermentation broth + PoRV infection group are set up. By testing the replication and proliferation of PoRV in IPEC-J2 cells, it was found that the constructed Bacillus natto can effectively inhibit the replication of porcine rotavirus. The present invention has a wide range of applications in the production of antiviral drugs and feed additives. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a graph showing the effects of BS00, BS01, BS02 and BS03 fermentation broth on IPEC-J2 cell viability.

[0030] Figure 2 This figure shows the effect of adding BS00, BS01, BS02 and BS03 fermentation broth at different stages on the RNA copy number of PoRV after PoRV infection of IPEC-J2 cells.

[0031] Figure 3 This figure shows the effect of adding BS00, BS01, BS02 and BS03 fermentation broth in the late and full stages on the viral titer after PoRV infection of IPEC-J2 cells.

[0032] Figure 4 This figure shows the effect of adding BS01, BS02 and BS03 fermentation broth in the late and full stages on the expression of VP6 protein after PoRV infection of IPEC-J2 cells. DETAILED DESCRIPTION

[0033] The following describes preferred embodiments of the present invention. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0034] The following embodiments relate to the method:

[0035] 1. Virus infection and propagation: IPEC-J2 cells were cultured for 24-48 hours until they grew to a confluent monolayer. An appropriate amount of PoRV was dissolved in DMEM / F12 and trypsin was added to a final concentration of 10 μg mL -1 , 37 ℃ metal bath for 30 minutes to activate PoRV. Rinse the cells twice with 1× PBS buffer, discard the residual liquid, add virus-trypsin mixture, and place at 37 ℃ and 5% CO2 for adsorption for 1 hour. During this period, shake the cell culture bottle every 20 minutes to ensure uniform adsorption of the virus. After the adsorption is completed, rinse the cells once with 1× PBS buffer, discard the residual liquid, and add 1μg·mL -1Trypsin-free DMEM / F12 was used as the cell maintenance medium and the cells were maintained at 37°C and 5% CO2 until 85% or greater cytopathic effect (CPE) was achieved. Vero cells were infected using the same method as IPEC-J2 cells. The infected Vero cells were frozen and thawed three times at -80°C and room temperature, and then rotated at 5000 rpm. -1 Centrifuge for 10 minutes, remove the cell pellet, and take the supernatant as the amplified virus.

[0036] 2. Viral genome copy number detection method: The viral genome copy number was detected using fluorescent quantitative PCR. Total cellular RNA was extracted according to the instructions of the total RNA extraction kit. The RNA concentration was measured and then the concentration was unified. 1 μg of total RNA was used as a template for reverse transcription into cDNA. The cDNA was diluted 5-fold by adding ddH2O and the qPCR system was prepared. The qPCR system is as follows:

[0037] 2×ChamQ SYBR qPCR Master Mix 5.0μL, 50×ROX Reference Dye I 0.2μL, upstream and downstream primers (10μmol·L -1 ) 0.2 μL each, cDNA 2.0 μL, ddH2O 2.4 μL, a total of 10 μL. qPCR reaction program is as follows: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 10 s, 60℃ annealing for 30 s, melting curve analysis after 40 cycles. GAPDH was used as the internal reference gene for normalization of samples, and each sample was repeated 3 times. -ΔΔct The relative expression of the target gene was calculated by the primer sequence used in this experiment as shown in Table 1.

[0038] Table 1 Gene primer sequences

[0039]

[0040] NSP5. Nonstructural protein 5; GAPDH. Glyceraldehyde-3-phosphate dehydrogenase

[0041] 3. Virus titer detection method: The virus titer was determined by the TCID50 method. The virus was dissolved in DMEM / F12 and diluted 10-fold in series, starting from 10 -1 Dilute to 10 -10. The diluted viruses were inoculated into Vero cells in a 96-well plate, with one column of 8 wells for each dilution, and 100 μL was inoculated into each well. Two columns of uninoculated normal cells were set up as negative controls. The cytopathic effect (CPE) was observed 24 hours after virus inoculation and the virus titer was calculated according to the Reed Muench method. The calculation method is as follows: virus titer (-1 g TCID50 / mL) = (pathological rate above 50% - 50%) / (pathological rate above 50% - pathological rate below 50%) × dilution logarithm difference + dilution logarithm of pathological rate above 50%.

[0042] 4. Detection of VP6 Protein Expression: Western blot was used to determine the target protein content. Denatured protein samples were concentrated and separated by SDS-PAGE gel electrophoresis. After electrophoresis, the proteins were transferred from the gel to a polyvinylidene fluoride (PVDF) membrane using a wet transfer method. After transfer, the PVDF membrane was blocked in a 5% skim milk solution at room temperature on a shaker for 2 hours. After blocking, the membrane was rinsed with Tween-20-containing washing buffer (TBST) and washed 3-5 times for 5 minutes each on a shaker. After rinsing, the primary antibody against the corresponding protein was added, and the membrane was incubated at 4°C on a shaker for 12 hours. After incubation, the primary antibody was removed, TBST was added, and the membrane was rinsed 3-5 times for 5 minutes each on a shaker. After rinsing, the corresponding secondary antibody was added, and the membrane was incubated at room temperature on a shaker for 90 minutes. After incubation, the secondary antibody was removed, TBST was added, and the membrane was rinsed 3-5 times for 5 minutes each on a shaker. After rinsing, enhanced chemiluminescence solution was added, and the PVDF membrane was developed and photographed using an ultrasensitive chemiluminescence gel imaging system. Using GAPDH as an internal reference antibody, the results were analyzed using ImageJ software for relative grayscale values ​​and statistical analysis. Antibody information is shown in Table 2.

[0043] Table 2 Antibody information

[0044]

[0045] VP6. PoRV structural protein 6; GAPDH. Glyceraldehyde-3-phosphate dehydrogenase

[0046] The raw materials used in the embodiment are:

[0047] 1. Bacillus subtilis natto BS00 was obtained from the China Center for Type Culture Collection, Wuhan University, with the number CCTCC CB20081702.

[0048] 2. The pHY-P43, p7c6, and pDG plasmids were obtained from the Center for Future Food Science, School of Bioengineering, Jiangnan University. For the construction process, please refer to the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562).

[0049] 3. Porcine intestinal epithelial cells IPEC-J2 were obtained from Shanghai Binsui Biotechnology Co., Ltd.

[0050] 4. LB liquid medium composition: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0.

[0051] 5. LB solid medium composition: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 10-15 g / L, pH 7.0.

[0052] 6. The liquid fermentation medium is composed of: glucose 10-30 g / L, peptone 10-30 g / L, yeast extract 10-30 g / L, sodium glutamate monohydrate 10-30 g / L, sodium chloride 5-15 g / L, potassium hydrogen phosphate trihydrate 0.5-1.5 g / L, magnesium sulfate heptahydrate 0.5-1.5 g / L, pH 7.0-7.2.

[0053] Example 1

[0054] 1. Construction of recombinant Bacillus natto

[0055] Using Bacillus subtilis natto BS00 as the original strain, follow the steps below:

[0056] (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR using primers P3-P4 as shown in SEQ ID No: 3-4.

[0057] P3: CGC GGATCC ATGACTAAAGTAAACATTGTTATTATCGAC(SEQ ID No:3)

[0058] P4: CC CCCGGG CTATTCATTTCTACCCAGCCATTTTTAATGG(SEQ ID No:4)

[0059] The underlined parts are the restriction sites of BamHI and XmaI respectively.

[0060] After the amplified product was purified, the PCR product and vector pHY-P43 were double-digested with BamHI and XmaI, and the recovered products of the two were ligated with T4 ligase at 22°C for 4 hours to obtain the recombinant plasmid pHY-P43-degU.

[0061] (2) The Dpn I method was used to point mutate the leucine at position 74 in the HTH region of the DegU coding gene to arginine. The DegU sequences before and after the point mutation were as shown in SEQ ID No: 1-2.

[0062] The point mutation primers are P5-P6 (SEQ ID No: 5-6)

[0063] P5: CAGCTTGTTGAG CGA TACCCTGAATCTAAGG (SEQ ID No: 5)

[0064] P6: CCTTAGATTCAGGGTA TCG CTCAACAAGCTG (SEQ ID No: 6)

[0065] The underlined portion represents the codon corresponding to the arginine mutation at position 74 in the mutant gene. The PCR amplification system was as follows: 0.5 μL of recombinant plasmid DNA, 5 μL of 5× Primer Star Buffer, 0.5 μL of each primer, 2 μL of dNTPs, 0.25 μL of Primer Star, and ddH2O to 25 μL. PCR amplification conditions were denaturation at 95°C for 1 min, 18 cycles (95°C for 40 s, 50°C for 15 s, 66°C for 390 s), and 72°C for 10 min.

[0066] The PCR product was treated with Dpn I enzyme at 37°C for 3 h to remove the template DNA and obtain the degU point mutation fragment (degU' gene).

[0067] (3) Using the p7c6 plasmid, BS00 genome, and degU' gene as templates, primers P7-P12 (SEQ ID No: 7-12) in Table 3 were used to clone the lox71-Cm containing the chloramphenicol resistance gene by a three-segment fusion PCR method. rThe -lox66 cassette and the two-component regulatory factor degU point mutation fragment were ligated together according to the method in the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the fusion fragment Cm r -degU'.

[0068] (4) The Sipizizen transformation method was used to transform the fusion fragment Cm r -degU' was transformed into Bacillus subtilis natto 00 competent cells, and then the chloramphenicol resistance gene sandwiched between lox71 and lox66 sites in the strain was knocked out by transferring the pDG plasmid (containing the Cre / lox recombination system) (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the recombinant strain Bacilus subtilis 00Cm r -degU' and name it BS01.

[0069] Table 3 Amplification primers for triple fusion

[0070]

[0071] 2. Effects of fermentation products on PoRV infection of IPEC-J2 cells

[0072] 1. Preparation of fermentation broth of BS00 and BS01

[0073] The strain was activated on an LB solid culture medium plate, and the activated strain was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of LB liquid culture medium, cultured at 37°C and 210 rpm for 9 h, and then inoculated into a liquid fermentation medium at a 3% inoculum size, cultured at 37°C and 210 rpm for 72 h to obtain an expansion culture solution.

[0074] The culture conditions in a 3-L fermenter were as follows: an initial glucose concentration of 20 g / L, 3% inoculum, and glucose supplementation at 24, 48, and 60 hours after inoculation to a maximum of 20 g / L. The culture was then incubated at 500 rpm and 40°C for 120 hours to obtain fermentation broths BS00 and BS01, respectively.

[0075] 2. Preparation of fermentation products of BS00 and BS01

[0076] The fermentation broth cultured in a 3L fermenter was centrifuged at 4,000 r / min for 20 min and then separated. The supernatant was taken and added with 4% activated carbon that had been dried and dehydrated at 105°C. The mixture was heated and stirred at 40°C for 20 min to adsorb impurities and remove odors. The carbon residue was then removed by coarse filtration with gauze and cooled to room temperature. The supernatant was taken after centrifugation at 4°C and 4,000 r / min for 20 min, and then the supernatant was taken after centrifugation at 4°C and 4,500 r / min for 20 min to remove the remaining carbon residue. The supernatant was stored at 4°C for sedimentation overnight and then sterilized by 0.22 μm filtration to obtain the fermentation products of BS00 and BS01.

[0077] 3. Effects of BS00 and BS01 fermentation products on IPEC-J2 cell viability

[0078] 1 × 10 4 IPEC-J2 cells were cultured at 37°C and 5% CO2 for 24 hours. 100 μL of sterile fermentation medium (control group), BS00 fermentation product, and BS01 fermentation product were added to a 96-well plate, with 3 replicates for each culture medium, and blank wells without treatment were set up. The 96-well plate was cultured for another 24 hours at 37°C and 5% CO2. Subsequently, 10 μL of CCK-8 reagent was added to each well, incubated at 37°C and 5% CO2 for 1 to 4 hours, and the absorbance at 450 nm was measured using a microplate reader. The results are shown in Figure 2. Figure 1 As shown, compared with the blank wells without treatment and the control group with only sterile fermentation medium added, the addition of 100 μL BS00 and BS01 fermentation products had no significant effect on cell viability (P>0.05).

[0079] 4. Effects of adding BS00 and BS01 fermentation products at different stages on PoRV infection of IPEC-J2 cells

[0080] IPEC-J2 cells were treated with BS00 and BS01 fermentation products at different time periods of PoRV (MOI = 0.1) infection. The grouping and treatment methods were as follows: 1) Negative control group (NC): BS00 and BS01 fermentation products were not added at any stage and PoRV was not infected; 2) Positive control group (PoRV): PoRV was inoculated only, and BS00 and BS01 fermentation products were not added at any stage; 3) BS00 fermentation product group: BS00 fermentation product was added at all stages; 4) BS01 fermentation product group: BS01 fermentation product was added at all stages; 5) Pre-infection stage (early stage): BS00 and BS01 fermentation products were added to pre-treat cells for 24 hours before PoRV infection, and then inoculated with PoRV after rinsing with 1× PBS buffer and maintained at 37°C and 5% CO2 for 24 hours; 6) Bacteria and virus co-treatment stage (mid-stage): BS00 and BS01 fermentation products were dissolved in virus culture medium and then infected with cells, adsorbed for 1 hour, rinsed with 1× PBS buffer and maintained at 37°C and 5% CO2. 7) Post-infection maintenance phase (late phase): After PoRV infection, cells were maintained at 37°C and 5% CO2 for 24 hours using a cell maintenance medium containing the fermentation products of BS00 and BS01. 7) Full phase (full phase): During the pre-infection, fermentation product and virus co-treatment, and post-infection phases, the virus, cell culture medium, and maintenance medium all contained the fermentation products of BS00 and BS01 and were maintained at 37°C and 5% CO2 for 24 hours. Three replicates were used for each group. Cytopathic effects were observed in each group, and cell RNA, protein samples, and viral supernatant were collected to measure viral genome copy number, viral titer, and VP6 protein expression.

[0081] The results are as follows Figure 2-4 As shown, compared with the positive control group, the expression of NSP5 gene decreased from 10.30±0.51 to 9.21±0.49 and 8.11±0.44 ( Figure 2 ), the virus titer decreased from 5.22±0.14 to 4.62±0.03 and 4.34±0.01 ( Figure 3 ), the relative expression of VP6 protein decreased from 1.01±0.03 to 0.25±0.02 and 0.20±0.01 ( Figure 4 ).

[0082] Comparative Example 1

[0083] 1. Construction of recombinant Bacillus natto

[0084] Using Bacillus subtilis natto BS00 as the original strain, follow the steps below:

[0085] (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR using primers P13-P14 as shown in SEQ ID No: 13-14.

[0086] P13: CGC GGATCC ATGACTAAAGTAAACATTGTTATTATCGAC(SEQ ID No:13)

[0087] P14: CC CCCGGG CTATTCATTTCTACCCAGCCATTTTTAATGG(SEQ ID No:14)

[0088] The underlined parts are the restriction sites of BamHI and XmaI respectively.

[0089] After the amplified product was purified, the PCR product and vector pHY-P43 were double-digested with BamHI and XmaI, and the recovered products of the two were ligated with T4 ligase at 22°C for 4 hours to obtain the recombinant plasmid pHY-P43-degU.

[0090] (3) Using p7c6 plasmid, pHY-P 43 -degU plasmid and BS00 gene were used as templates, and primers P15-P20 (SEQ ID No: 15-20) in Table 4 were used to clone the lox71-Cm containing chloramphenicol resistance gene by fusion PCR. r -lox66 box, P 43 The promoter and the two-component regulatory factor degU fragment were connected together according to the method in the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the fusion fragment P43-degU.

[0091] (4) The Sipizizen transformation method was used to transform the fusion fragment P 43-degU was transformed into Bacillus subtilis natto BS00 competent cells, and then the chloramphenicol resistance gene sandwiched between lox71 and lox66 sites in the strain was knocked out by transferring the pDG plasmid (containing the Cre / lox recombination system) (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox systemand PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the degU overexpression strain Bacilus subtilis 00P43-degU, which was named BS02.

[0092] Table 4 Amplification primers for triple fusion

[0093]

[0094] 2. Effects of fermentation products on PoRV infection of IPEC-J2 cells

[0095] 1. Preparation of fermentation broth of BS00 and BS02

[0096] The strain was activated on an LB solid culture medium plate, and the activated strain was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of LB liquid culture medium, cultured at 37°C and 210 rpm for 9 h, and then inoculated into a liquid fermentation medium at a 3% inoculum size, cultured at 37°C and 210 rpm for 72 h to obtain an expansion culture solution.

[0097] The culture conditions in a 3-L fermenter were as follows: an initial glucose concentration of 20 g / L, 3% inoculum, and glucose supplementation at 24, 48, and 60 hours after inoculation to a maximum of 20 g / L. The culture was then incubated at 500 rpm and 40°C for 120 hours to obtain fermentation broths BS00 and BS02, respectively.

[0098] 2. Preparation of fermentation products of BS00 and BS02

[0099] The fermentation broth cultured in a 3L fermenter was centrifuged at 4,000 r / min for 20 min and then separated. The supernatant was taken and added with 4% activated carbon that had been dried and dehydrated at 105°C. The mixture was heated and stirred at 40°C for 20 min to adsorb impurities and remove odors. The carbon residue was then removed by coarse filtration with gauze and cooled to room temperature. The supernatant was taken after centrifugation at 4°C and 4,000 r / min for 20 min, and then the supernatant was taken after centrifugation at 4°C and 4,500 r / min for 20 min to remove the remaining carbon residue. The supernatant was stored at 4°C for sedimentation overnight and then sterilized by 0.22 μm filtration to obtain the fermentation products of BS00 and BS02.

[0100] 3. Effects of BS00 and BS02 fermentation products on IPEC-J2 cell viability

[0101] 1 × 10 4 IPEC-J2 cells were cultured at 37°C and 5% CO2 for 24 hours. 100 μL of sterile fermentation medium (control group), BS00 fermentation product, and BS02 fermentation product were added to a 96-well plate, with 3 replicates for each culture medium, and blank wells without treatment were set up. The 96-well plate was cultured for 24 hours at 37°C and 5% CO2. Subsequently, 10 μL of CCK-8 reagent was added to each well, incubated at 37°C and 5% CO2 for 1 to 4 hours, and the absorbance at 450 nm was measured using a microplate reader. The results are shown in Figure 2. Figure 1 As shown, compared with the blank wells without treatment and the control group with only sterile fermentation medium added, the addition of 100 μL BS00 and BS02 fermentation products had no significant effect on cell viability (P>0.05).

[0102] 4. Effects of adding BS00 and BS02 fermentation products at different stages on PoRV infection of IPEC-J2 cells

[0103] IPEC-J2 cells were treated with BS00 and BS02 fermentation products at different time periods of PoRV (MOI = 0.1) infection. The grouping and treatment methods were as follows: 1) Negative control group (NC): No BS00 and BS02 fermentation products were added at any stage and PoRV was not infected; 2) Positive control group (PoRV): PoRV was inoculated only, and no BS00 and BS02 fermentation products were added at any stage; 3) BS00 fermentation product group: BS00 fermentation products were added at all stages; 4) BS02 fermentation product group: BS02 fermentation products were added at all stages; 5) Pre-infection stage (early stage): BS00 and BS02 fermentation products were added to pre-treat the cells for 24 hours before PoRV infection, and then inoculated with PoRV after rinsing with 1× PBS buffer and placed at 37°C and 5% The cells were maintained under CO2 for 24 hours. 6) Bacterial and virus co-treatment phase (mid-phase): BS00 and BS02 fermentation products were dissolved in virus culture medium and then infected with cells. Adsorption was allowed to proceed for 1 hour. After rinsing with 1× PBS buffer, the cells were maintained at 37°C and 5% CO2 for 24 hours. 7) Post-infection maintenance phase (late-phase): After PoRV infection, cells were maintained at 37°C and 5% CO2 using a cell maintenance medium containing BS00 and BS02 fermentation products. 7) Full phase (full phase): During the pre-infection, fermentation product and virus co-treatment, and post-infection phases, the virus, cell culture medium, and maintenance medium all contained BS00 and BS02 fermentation products and were maintained at 37°C and 5% CO2 for 24 hours. Three replicates were used for each group. Cytopathic effects were observed in each group, and cellular RNA, protein samples, and viral supernatant were collected to measure viral genome copy number, viral titer, and VP6 protein expression.

[0104] The results are as follows Figure 2-4 As shown, compared with the positive control group, the NSP5 gene expression was reduced from 10.30±0.51 to 9.21±0.49 and 8.11±0.44 ( Figure 2 ), the virus titer decreased from 5.22±0.14 to 4.76±0.03 and 4.69±0.08 ( Figure 3 ), the relative expression of VP6 protein decreased from 1.01±0.03 to 0.54±0.04 and 0.52±0.06 ( Figure 4 ).

[0105] Comparative Example 2

[0106] 1. Construction of recombinant Bacillus natto

[0107] Using Bacillus subtilis natto BS00 as the original strain, follow the steps below:

[0108] (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR using primers P21-P22 as shown in SEQ ID No: 21-22.

[0109] P21: CGC GGATCC ATGACTAAAGTAAACATTGTTATTATCGAC(SEQ ID No:21)

[0110] P22: CC CCCGGG CTATTCATTTCTACCCAGCCATTTTTAATGG(SEQ ID No:22)

[0111] The underlined parts are the restriction sites of BamHI and XmaI respectively.

[0112] After the amplified product was purified, the PCR product and the vector pHY-P were cleaved with BamHI and XmaI. 43 The two products were digested with double enzymes and ligated with T4 ligase at 22 °C for 4 h to obtain the recombinant plasmid pHY-P 43 -degU.

[0113] (2) The Dpn I method was used to point mutate the leucine at position 96 in the HTH region of the DegU coding gene to arginine. The DegU sequence after point mutation is shown in SEQ ID No: 23.

[0114] The point mutation primers are P24-P25 (SEQ ID No: 24-25)

[0115] P24:GTAACACATGCC CGA AAAACAGGTGCAAGA (SEQ ID No: 24)

[0116] P25:TCTTGCACCTGTTTT TCG GGCATGTGTTAC (SEQ ID No: 25)

[0117] The underlined portion represents the codon corresponding to the arginine mutation at position 96 in the mutant gene. The PCR amplification system was as follows: 0.5 μL of recombinant plasmid DNA, 5 μL of 5× Primer Star Buffer, 0.5 μL of each primer, 2 μL of dNTPs, 0.25 μL of Primer Star, and ddH2O to 25 μL. PCR amplification conditions were denaturation at 95°C for 1 min, 18 cycles (95°C for 40 s, 50°C for 15 s, 66°C for 390 s), and 72°C for 10 min.

[0118] The PCR product was treated with Dpn I enzyme at 37°C for 3 h to remove the template DNA and obtain the degU point mutation fragment (degU" gene).

[0119] (3) Using the p7c6 plasmid, BS00 genome, and degU gene as templates, primers P5-P10 (SEQ ID No: 7-12) in Table 5 were used to clone the lox71-Cm containing the chloramphenicol resistance gene by a three-segment fusion PCR method. r The -lox66 cassette and the two-component regulatory factor degU point mutation fragment were ligated together according to the method in the article (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the fusion fragment Cm r -degU".

[0120] (4) The Sipizizen transformation method was used to transform the fusion fragment Cm r -degU" was transformed into Bacillus subtilis natto 00 competent cells, and then the chloramphenicol resistance gene sandwiched between lox71 and lox66 sites in the strain was knocked out by transferring the pDG plasmid (containing the Cre / lox recombination system) (Yan, X., Yu, HJ, Hong, Q., Li, SP, 2008. Cre / lox system and PCR-based genome engineering in Bacilus subtilis. Appl Environ Microb. 74, 5556-5562) to obtain the recombinant strain Bacilus subtilis 00Cm r -degU", and named it BS03.

[0121] Table 5 Amplification primers for triple fusion

[0122]

[0123] 2. Effects of fermentation products on PoRV infection of IPEC-J2 cells

[0124] 1. Preparation of fermentation broth of BS00 and BS03

[0125] The strain was activated on an LB solid culture medium plate, and the activated strain was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of LB liquid culture medium, cultured at 37°C and 210 rpm for 9 h, and then inoculated into a liquid fermentation medium at a 3% inoculum size, cultured at 37°C and 210 rpm for 72 h to obtain an expansion culture solution.

[0126] The culture conditions in a 3-L fermenter were as follows: an initial glucose concentration of 20 g / L, 3% inoculum, and glucose supplementation at 24, 48, and 60 hours after inoculation to a maximum of 20 g / L. The culture was then incubated at 500 rpm and 40°C for 120 hours to obtain fermentation broths BS00 and BS03, respectively.

[0127] 2. Preparation of fermentation products of BS00 and BS03

[0128] The fermentation broth cultured in a 3L fermenter was centrifuged at 4,000 r / min for 20 min and then separated. The supernatant was taken and added with 4% activated carbon that had been dried and dehydrated at 105°C. The mixture was heated and stirred at 40°C for 20 min to adsorb impurities and remove odors. The carbon residue was then removed by coarse filtration with gauze and cooled to room temperature. The supernatant was taken after centrifugation at 4°C and 4,000 r / min for 20 min, and then the supernatant was taken after centrifugation at 4°C and 4,500 r / min for 20 min to remove the remaining carbon residue. The supernatant was stored at 4°C for sedimentation overnight and then sterilized by 0.22 μm filtration to obtain the fermentation products of BS00 and BS03.

[0129] 3. Effects of BS00 and BS03 fermentation products on IPEC-J2 cell viability

[0130] 1 × 10 4 IPEC-J2 cells were cultured at 37°C and 5% CO2 for 24 hours. 100 μL of sterile fermentation medium (control group), BS00 fermentation product, and BS03 fermentation product were added to a 96-well plate, with 3 replicates for each culture medium, and blank wells without treatment were set up. The 96-well plate was cultured for another 24 hours at 37°C and 5% CO2. Subsequently, 10 μL of CCK-8 reagent was added to each well, and the plates were incubated at 37°C and 5% CO2 for 1 to 4 hours. The absorbance at 450 nm was then measured using a microplate reader. The results are shown in Figure 2. Figure 1 As shown, compared with the blank wells without treatment and the control group with only sterile fermentation medium added, the addition of 100 μL BS00 and BS03 fermentation products had no significant effect on cell viability (P>0.05).

[0131] 4. Effects of adding BS00 and BS03 fermentation products at different stages on PoRV infection of IPEC-J2 cells

[0132] IPEC-J2 cells were treated with BS00 and BS03 fermentation products at different time periods of PoRV (MOI = 0.1) infection. The grouping and treatment methods were as follows: 1) Negative control group (NC): No BS00 and BS03 fermentation products were added at any stage and no PoRV infection was performed; 2) Positive control group (PoRV): PoRV was inoculated only, and no BS00 and BS03 fermentation products were added at any stage; 3) BS00 fermentation product group: BS00 fermentation products were added at all stages; 4) BS03 fermentation product group: BS03 fermentation products were added at all stages; 5) Pre-infection stage (early stage): BS00 and BS03 fermentation products were added to pre-treat the cells for 24 hours before PoRV infection, and then inoculated with PoRV after rinsing with 1× PBS buffer and placed at 37°C and 5% The cells were maintained under CO2 for 24 hours. 6) Bacterial and virus co-treatment phase (mid-phase): BS00 and BS03 fermentation products were dissolved in virus culture medium and then infected with cells. Adsorption was continued for 1 hour, followed by rinsing with 1× PBS buffer and incubation at 37°C and 5% CO2 for 24 hours. 7) Post-infection maintenance phase (late-phase): After PoRV infection, cells were maintained at 37°C and 5% CO2 using a cell maintenance medium containing BS00 and BS03 fermentation products. 7) Full phase (full phase): During the pre-infection, fermentation product and virus co-treatment, and post-infection phases, the virus, cell culture medium, and maintenance medium all contained BS00 and BS03 fermentation products and were incubated at 37°C and 5% CO2 for 24 hours. Three replicates were used for each group. Cytopathic effects were observed in each group, and cellular RNA, protein samples, and viral supernatant were collected to measure viral genome copy number, viral titer, and VP6 protein expression.

[0133] The results are as follows Figure 2-4 As shown, compared with the positive control group, the NSP5 gene expression was reduced from 10.30±0.51 to 9.94±0.49 and 9.79±0.49 ( Figure 2 ), the virus titer decreased from 5.22±0.14 to 4.61±0.06 and 4.52±0.1 ( Figure 3 ), the relative expression of VP6 protein decreased from 1.01±0.03 to 0.89±0.05 and 0.82±0.07 ( Figure 4 ).

[0134] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Bacillus natto, characterized in that: The recombinant Bacillus natto is based on Bacillus natto BS00 with a deposit number of CCTCCCB 20081702 as a chassis strain, and a mutant of a DegU regulatory protein is overexpressed on the chassis strain, wherein the mutant is a mutant in which the leucine at position 74 of the HTH region of the DegU regulatory protein parent is mutated to arginine, and the nucleotide sequence of the encoding gene of the parent is shown in SEQ ID NO:

1.

2. A method for constructing a recombinant Bacillus natto, characterized in that: The method is to overexpress a mutant having a DegU regulatory protein on a chassis strain, wherein the chassis strain is Bacillus natto BS00 with a preservation number of CCTCC CB 20081702, and the mutant is a mutation of the 74th leucine in the HTH region of the DegU regulatory protein parent to arginine, and the nucleotide sequence of the encoding gene of the parent is shown in SEQ ID NO:

1.

3. The method according to claim 2, characterized in that The steps include: (1) Using the total DNA of Bacillus natto as a template, the degU gene was amplified by PCR and ligated with the vector pHY-P43 to obtain the recombinant plasmid pHY-P 43 -degU; (2) Using the DpnI method, the recombinant plasmid pHY-P from step (1) was recombined into 43 -degU is used as a template for point mutation of degU gene to obtain degU' gene; (3) Using the p7c6 plasmid, the genome of Bacillus natto BS00, and the degU' gene from step (2) as templates, a three-segment fusion PCR method was used to clone the lox71-Cm r -lox66 box and degU' gene fragment were connected together to obtain the fusion fragment Cm r -degU'; (4) The fusion fragment Cm in step (3) r -degU' was transformed into the competent cells of Bacillus natto, the chloramphenicol resistance gene in the strain was knocked out, and the recombinant Bacillus natto was obtained.

4. A microbial preparation containing the recombinant Bacillus natto according to claim 1.

5. The microbial preparation according to claim 4, characterized in that The amount of the recombinant Bacillus natto added to the microbial preparation is not less than 1×10 6 CFU / mL or not less than 1×10 6 CFU / g.

6. A composition containing the recombinant Bacillus natto according to claim 1.

7. A feed additive containing the recombinant Bacillus natto according to claim 1.

8. Use of the Bacillus natto according to claim 1, or the microbial preparation according to claim 4 or 5, or the composition according to claim 6, or the feed additive according to claim 7 in the preparation of a medicament for treating and / or alleviating porcine rotavirus infection.

9. A method for inhibiting rotavirus infection of porcine intestinal epithelial cells in vitro, characterized in that: The method comprises the steps of using the Bacillus natto described in claim 1 as a fermentation agent for fermentation, and contacting the obtained fermentation product with porcine intestinal epithelial cells infected with rotavirus.

10. Use of the Bacillus natto according to claim 1 in the preparation of a microbial preparation for inhibiting rotavirus infection of porcine intestinal epithelial cells in vitro.

11. Use of the Bacillus natto according to claim 1 in preparing a composition for inhibiting rotavirus infection of porcine intestinal epithelial cells in vitro.

12. Use of the Bacillus natto according to claim 1 in the preparation of a feed additive for inhibiting rotavirus infection of porcine intestinal epithelial cells in vitro.

13. The use according to any one of claims 10 to 12, characterized in that: The inhibition includes at least one of the following effects: (1) Reduce the expression of NSP5 gene in rotavirus-infected porcine intestinal epithelial cells; (2) Reduce the titer of rotavirus; (3) Reduce the expression of VP6 protein in rotavirus-infected porcine intestinal epithelial cells.

14. A mutant of a DegU regulatory protein, characterized in that: The mutant is a mutation of the leucine at position 74 in the HTH region of the DegU regulatory protein parent to arginine, and the nucleotide sequence of the encoding gene of the parent is shown in SEQ ID NO: 1.

Images