A glycosyltransferase UGT76G4 mutant and its application

Abstract

The present invention discloses a glycosyltransferase UGT76G4 mutant and its application, belonging to the field of genetic engineering technology. The amino acid sequence of the glycosyltransferase UGT76G4 mutant has at least 90% identity with the sequence shown in SEQ ID NO:1, and compared with SEQ ID NO:1, the amino acid at position 90, or at positions 90 and 88 is mutated. The enzyme activity of the glycosyltransferase UGT76G4 mutant provided by the present invention is significantly improved, which is 1.5 to 2 times that of the glycosyltransferase UGT76G4.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a glycosyltransferase UGT76G4 mutant and an application thereof. Background Art

[0002] Steviol glycosides are a class of natural products extracted from stevia, with high sweetness and low calories. They are known as the "third sugar source in the world" after sucrose and beet sugar, and also have a wide range of biological activities, including anti-inflammatory, antibacterial and hypoglycemic. Since steviol glycosides and their derivatives are relatively cheap and easy to extract and prepare in large quantities, they have been widely used in food and beverage, medicine and organic chemistry. Among them, rebaudioside A and rebaudioside D are about 200-300 times sweeter than sucrose and have a better taste, but their content in stevia is relatively low, and the separation and extraction cost is high, which cannot meet market demand.

[0003] Glycosyltransferase UGT76G1 can transfer the glucose group to the C-13 position of steviol glycoside to form a β-1,3 glycosidic bond, thereby generating high-sweetness, low-calorie steviol glycosides, but the wild-type glycosyltransferase UGT76G1 has low enzyme activity. Patent CN 115094074 B discloses a mutant of glycosyltransferase UGT76G1: glycosyltransferase UGT76G4, but its catalytic activity on the C-13 position of steviol glycoside is low. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a glycosyltransferase UGT76G4 mutant and its application, so as to overcome the problem of low catalytic activity at the C13 position of the glycosyltransferase UGT76G4 in the prior art.

[0005] In the first aspect, the present invention provides a glycosyltransferase UGT76G4 mutant, the amino acid sequence of the mutant having at least 90% identity with the sequence shown in SEQ ID NO:1, and the amino acid at position 90, or at positions 90 and 88 is mutated compared with SEQ ID NO:1.

[0006] The above mutations are: the 90th amino acid mutates from I to G, and the 88th amino acid mutates from M to R or G.

[0007] The mutant has an amino acid sequence as shown in any one of SEQ ID NO: 2 to SEQ ID NO: 4.

[0008] Compared with the glycosyltransferase UGT76G4 (SEQ ID NO: 1) in the prior art, the enzyme activity of the glycosyltransferase UGT76G4 mutant provided by the present invention is significantly improved, which is 1.5 to 2 times that of the glycosyltransferase UGT76G4.

[0009] In a second aspect, the present invention provides a nucleic acid encoding the above mutant.

[0010] The nucleotide sequence of the nucleic acid in the above technical solution is shown in SEQ ID NO:6 to SEQ ID NO:8.

[0011] In a third aspect, the present invention provides a recombinant expression vector or a recombinant strain containing the above nucleic acid.

[0012] In a fourth aspect, the present invention provides an application of a glycosyltransferase UGT76G4 mutant, which catalyzes the formation of a β-1,3 glycosidic bond at the C13 position of steviol glycoside.

[0013] Compared with the glycosyltransferase UGT76G4 in the prior art, the glycosyltransferase UGT76G4 mutant in the present invention has a preference for the C13 position, has the function of catalyzing a variety of steviol glycosides to form β-1,3 glycosidic bonds at the C13 position, and can be used to prepare a variety of steviol glycosides.

[0014] Furthermore, the steviol glycoside is STV, and the glycosyltransferase UGT76G4 mutant catalyzes the production of rebaudioside A and UDP using STV and UDPG as substrates.

[0015] Furthermore, the steviol glycoside is rebaudioside E, and the glycosyltransferase UGT76G4 mutant catalyzes the production of rebaudioside D and UDP using rebaudioside E and UDPG as substrates.

[0016] Furthermore, the above-mentioned glycosyltransferase UGT76G4 mutant was used in combination with sucrose synthase to carry out a catalytic reaction with STV, UDPG and sucrose as substrates to prepare rebaudioside A.

[0017] The above technical scheme combines the glycosyltransferase UGT76G4 mutant with sucrose synthase. The transferase UGT76G4 mutant catalyzes the production of rebaudioside A and by-product UDP using STV and UDPG as substrates. The sucrose synthase can resynthesize UDPG using by-product UDP and sucrose as substrates, thereby establishing a UDPG recycling system, avoiding the additional addition of UDPG, and saving production costs.

[0018] Furthermore, the final concentration of each component in the reaction system of the catalytic reaction is: glycosyltransferase UGT76G4 mutant enzyme solution 10~20OD, sucrose synthase enzyme solution 10~30OD, sucrose 300~500mM, UDPG1~1.5mM, STV30~50mM; and / or, the reaction conditions of the catalytic reaction are: pH 7~7.5, temperature 35~40°C.

[0019] The above technical solution optimizes the final concentration and reaction conditions of each component in the reaction system of the catalytic reaction, and further increases the conversion amount of the reaction product rebaudioside A.

[0020] Furthermore, the above-mentioned glycosyltransferase UGT76G4 mutant was used in combination with sucrose synthase to carry out a catalytic reaction with rebaudioside E, UDPG and sucrose as substrates to prepare rebaudioside D.

[0021] The above technical scheme combines the glycosyltransferase UGT76G4 mutant with sucrose synthase. The transferase UGT76G4 mutant catalyzes the production of rebaudioside D and byproduct UDP using rebaudioside E and UDPG as substrates. The sucrose synthase can resynthesize UDPG using byproduct UDP and sucrose as substrates, thereby establishing a UDPG recycling system, avoiding the additional addition of UDPG, and saving production costs.

[0022] Furthermore, the final concentration of each component in the reaction system of the catalytic reaction is: glycosyltransferase UGT76G4 mutant enzyme solution 10~20OD, sucrose synthase enzyme solution 10~30OD, sucrose 300~500mM, UDPG 1~1.5mM, rebaudioside E 30~50mM; and / or, the reaction conditions of the catalytic reaction are: pH 7~7.5, temperature 35~40°C.

[0023] The above technical solution optimizes the final concentration and reaction conditions of each component in the reaction system of the catalytic reaction, and further increases the conversion amount of the reaction product rebaudioside D. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the enzyme activity determination diagram in Example 3.

[0025] Figure 2 This is a diagram of the reaction products of the glycosyltransferase UGT76G4 mutant L3 at different pH values ​​in Example 4.

[0026] Figure 3 This is a diagram of the reaction products of the glycosyltransferase UGT76G4 mutant L3 in Example 4 at different temperatures.

[0027] Figure 4 This is a diagram of the reaction product of the glycosyltransferase UGT76G4 mutant L3 coupled with sucrose synthase in Example 5.

[0028] Figure 5 This is a graph showing the effect of the amount of glycosyltransferase UGT76G4 mutant enzyme on the conversion reaction products in Example 6.

[0029] Figure 6 This is a graph showing the effect of the amount of UDPG added on the conversion reaction products in Example 7.

[0030] Figure 7 This is a graph showing the effect of sucrose concentration on the conversion reaction products in Example 8. DETAILED DESCRIPTION

[0031] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0032] It should be understood that the raw materials used in the following examples are all commercially available raw materials unless otherwise specified. Example 1

[0033] Construction of a recombinant strain containing the glycosyltransferase UGT76G4 mutant gene

[0034] Using the cDNA of the gene encoding the glycosyltransferase UGT76G4 derived from stevioside (SEQ ID NO: 5) as a template, ugt76G4-F and ugt76G4-R as primers, and high-fidelity DNA polymerase (Wuhan Abotek Biotechnology Co., Ltd.) was used for PCR amplification to obtain the correct UGT76G4 gene fragment. The amino acid sequence of the glycosyltransferase UGT76G4 is shown in SEQ ID NO: 1, which is disclosed in patent CN 115094074 A.

[0035] The UGT76G4 gene fragment was connected to the pET21a(+) vector after double digestion with NdeI and XhoI using the Gibson Assembly method to obtain a recombinant plasmid containing the UGT76G4 gene. 5 μL of the recombinant plasmid containing the UGT76G4 gene was transformed into E. coli TOP10 competent cells to obtain the recombinant strain UGT76G4.

[0036] The above-mentioned recombinant strain UGT76G4 was spread on a solid Luria-Bertani medium containing 100 μg / mL ampicillin and cultured at 37°C for 14 h. The monoclonal colonies on the medium were picked and verified by PCR. The monoclonal colonies with the correct amplification product length were inoculated into a liquid Luria-Bertani medium containing 100 μg / mL ampicillin and cultured to extract the recombinant plasmid containing the UGT76G4 gene.

[0037] ugt76G4-F (SEQ ID NO:9):

[0038] GAGATATACATATGGCTAGCATGGAAAATAAAACGGAGACCACC.

[0039] ugt76G4-R (SEQ ID NO:10):

[0040] GTGGTGGTGGTGCTCGAGTTACAACGATGAAATGTAAGAAA.

[0041] The above recombinant plasmid containing the UGT76G4 gene was used as a template, and F3 and F4 were used as primers to perform a PCR amplification reaction. The PCR amplification reaction product was digested with DpnI to obtain a recombinant plasmid containing a gene encoding a glycosyltransferase UGT76G4 mutant, the mutation site of which was I90G and was named L1. The recombinant plasmid was transformed into E. coli TOP10 competent cells to obtain a recombinant strain J1.

[0042] The amino acid sequence of glycosyltransferase UGT76G4 mutant L1 is shown in SEQ ID NO:2, and the nucleotide sequence of the gene encoding glycosyltransferase UGT76G4 mutant L1 is shown in SEQ ID NO:6.

[0043] F3: TCGCTGGTATGCGGGGACCGATTATCAACGA (SEQ ID NO: 11).

[0044] F4: TCGTTGATAATCGGTCCCCGCATACCAGCGA (SEQ ID NO: 12).

[0045] The above-mentioned recombinant plasmid containing the glycosyltransferase UGT76G4 mutant L1 encoding gene was used as a template, and F5 and F6 were used as primers for PCR amplification. The PCR amplification product was digested with DpnI to obtain a recombinant plasmid containing the glycosyltransferase UGT76G4 mutant encoding gene. The mutant also has mutation sites M88G and I90G, named L2. The recombinant plasmid was transformed into E. coli TOP10 competent cells to obtain the recombinant strain J2.

[0046] The amino acid sequence of glycosyltransferase UGT76G4 mutant L2 is shown in SEQ ID NO:3, and the nucleotide sequence of the gene encoding glycosyltransferase UGT76G4 mutant L2 is shown in SEQ ID NO:7.

[0047] F5: GGTCCGCTCGCTGGTGGTCGGGGTCCGATTATCAA (SEQ ID NO: 13).

[0048] F6: TTGATAATCGGACCCGACCACCAGCGAGCGGACC (SEQ ID NO: 14).

[0049] The above-mentioned recombinant plasmid containing the glycosyltransferase UGT76G4 mutant L1 encoding gene was used as a template, and F7 and F8 were used as primers for PCR amplification. The PCR amplification product was digested with DpnI to obtain a recombinant plasmid containing the glycosyltransferase UGT76G4 mutant encoding gene, which also had mutation sites M88R and I90G and was named L3. The recombinant plasmid was transformed into E. coli TOP10 competent cells to obtain the recombinant strain J3.

[0050] The amino acid sequence of glycosyltransferase UGT76G4 mutant L3 is shown in SEQ ID NO:4, and the nucleotide sequence of the gene encoding glycosyltransferase UGT76G4 mutant L3 is shown in SEQ ID NO:8.

[0051] F7: GGTCCGCTCGCTGGTCGTCGGGGTCCGATTATCAA (SEQ ID NO: 15).

[0052] F8: TTGATAATCGGACCCCGACGACCAGCGAGCGGACC (SEQ ID NO: 16). Example 2

[0053] Preparation of crude enzyme solution

[0054] The single colonies of the recombinant strain J1, the recombinant strain J2, and the recombinant strain J3 constructed in Example 1 were inoculated into LB solid culture medium for culture. After culturing at 35° C. for 16 h, colonies with uniform color, raised colonies, rounded and smooth surfaces, and colony diameters of 2 to 3 mm were selected, and then inoculated into 5 mL of LB liquid culture medium, respectively. The LB culture medium contained 50 mg / L of ampicillin, and was placed in a shaker and cultured at 37° C. and 220 rpm for 7 h to obtain the primary seed solution of the recombinant strain J1, the primary seed solution of the recombinant strain J2, and the primary seed solution of the recombinant strain J3, respectively.

[0055] The above-mentioned various seed liquids were inoculated into another 50 ml LB medium at a volume ratio of 1%, and placed in a shaker for 6 hours at 37°C and 220 rpm to obtain the secondary seed liquid of the recombinant strain J1, the secondary seed liquid of the recombinant strain J2, and the secondary seed liquid of the recombinant strain J3, respectively.

[0056] The above-mentioned secondary seed liquids were added to LB fermentation medium and cultured at 37°C for 3 hours, and then IPTG with a final concentration of 0.5 mM was added for induction culture. The fermentation tank speed was controlled to be ≤1000Rpm, the ventilation ratio was 1V / V / min, the temperature was 30°C, the pH value was 7.0, and the culture was continued for 36 hours. When the fermentation was completed, the fermentation broth of the recombinant strain J1, the fermentation broth of the recombinant strain J2, and the fermentation broth of the recombinant strain J3 were obtained, respectively.

[0057] LB medium: peptone 10 g / L, yeast powder 5 g / L, NaCl 10 g / L.

[0058] After the induction culture was completed, the fermentation broths were centrifuged at 5000 × g for 10 min, the cells were collected, and the cells were resuspended in 100 mM sodium phosphate buffer with a pH value of 7.0. The OD of the resuspended broth was measured. 600 The temperature was 150, and the bacterial cells were ultrasonically disrupted to release the intracellular enzymes. The ultrasonic power was 400 W and the time was 30 min. After the ultrasonication, the cells were centrifuged at 4 °C and 8000 × g for 10 min in a refrigerated centrifuge, and the supernatants were collected to obtain glycosyltransferase UGT76G4 mutant L1 enzyme solution, glycosyltransferase UGT76G4 mutant L2 enzyme solution and glycosyltransferase UGT76G4 mutant L3 enzyme solution, respectively. Example 3

[0059] Using the glycosyltransferase UGT76G4 enzyme solution as a control, the three glycosyltransferase UGT76G4 mutant enzyme solutions obtained in Example 2 above, namely, the glycosyltransferase UGT76G4 mutant L1 enzyme solution, the glycosyltransferase UGT76G4 mutant L2 enzyme solution and the glycosyltransferase UGT76G4 mutant L3 enzyme solution, were respectively prepared to determine the enzyme activities of the following four reaction systems (1 mL):

[0060] (1) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM STV, and 5 OD glycosyltransferase UGT76G4 enzyme solution.

[0061] (2) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM STV, and 5 OD glycosyltransferase UGT76G4 mutant L1 enzyme solution.

[0062] (3) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM STV, and 5 OD glycosyltransferase UGT76G4 mutant L2 enzyme solution.

[0063] (4) 100 mM phosphate buffer (pH 7.0), 2 mM UDPG, 2 mM STV, and 5 OD glycosyltransferase UGT76G4 mutant L3 enzyme solution.

[0064] The above reaction systems were reacted at 40°C and 200 rpm for 30 min. After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction. 4 volumes of ethanol were added and centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm filter membrane and the obtained filtrate was detected by high performance liquid chromatography to calculate the enzyme activity.

[0065] The results are as follows Figure 1 As shown: Compared with glycosyltransferase UGT76G4, the enzyme activities of glycosyltransferase UGT76G4 mutant L1, glycosyltransferase UGT76G4 mutant L2 and glycosyltransferase UGT76G4 mutant L3 were significantly improved. Among them, the mutant with the highest activity was glycosyltransferase UGT76G4 mutant L3 carrying two mutations at the same time, which was twice that of glycosyltransferase UGT76G4.

[0066] The HPLC detection conditions are as follows:

[0067] Chromatographic column: 5μm, 250×4.6mm; column temperature: 45°C. Chromatographic conditions: UV 210nm, mobile phase: (A) acetonitrile, (B) 10mmol sodium dihydrogen phosphate (pH adjusted to 2.6 with phosphoric acid), flow rate: 0.8 mL / min, elution program: 0-15min, 26% volume of (A), 74% volume of (B); 16-42min, 33% volume of (A), 67% volume of (B). Example 4

[0068] Stability testing

[0069] 1. The glycosyltransferase UGT76G4 mutant L3 enzyme solution obtained in Example 2 was used to prepare the following 5 reaction systems (1 mL) with different pH values:

[0070] 100mM phosphate buffer, 10mM UDPG, 5mM rebaudioside E (RE), 5OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution.

[0071] The pH values ​​of the above five reaction systems were 6.0, 6.5, 7.0, 7.5, and 8.0, respectively, and each reaction system was reacted at 35°C and 200 rpm for 0.5 h. After the reaction was completed, samples were taken and heated at 95°C for 5 min to terminate the reaction, and centrifuged at 12000 rpm for 5 min. After the supernatant was filtered through a 0.22 μm filter membrane, the filtrate was detected by liquid chromatography, and the content of the reaction product rebaudioside D (RD) was calculated.

[0072] The results of the test are as follows Figure 2 As shown: the glycosyltransferase UGT76G4 mutant L3 can catalyze rebaudioside E to produce rebaudioside D, indicating that the mutant L3 has significant C13 position specificity and can catalyze rebaudioside E to produce rebaudioside D by C13 glycosylation. It should be emphasized that when the pH value of the reaction system is 7-7.5, the yield of the reaction product rebaudioside D is the highest, indicating that the mutant L3 has the highest stability at this pH value.

[0073] 2. The following 4 reaction systems (1 mL) were prepared using the glycosyltransferase UGT76G4 mutant L3 enzyme solution obtained in Example 2:

[0074] 100 mM phosphate buffer (pH 7.0), 10 mM UDPG, 5 mM STV, and 5 OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution.

[0075] The above four reaction systems were reacted at 30°C, 35°C, 40°C or 45°C and 200 rpm for 0.5 h. After the reaction, samples were taken and heated at 95°C for 5 min to terminate the reaction, centrifuged at 12000 rpm for 5 min, and the supernatant was filtered through a 0.22 μm filter membrane. The filtrate was detected by liquid chromatography, and the content of the reaction product rebaudioside A (RA) was calculated.

[0076] The results of the test are as follows Figure 3 As shown: the glycosyltransferase UGT76G4 mutant L3 can catalyze STV to produce rebaudioside A, indicating that the mutant L3 has significant C13 position specificity and can catalyze STV to produce rebaudioside A by glycosylation at C13 position. It should be emphasized that when the reaction temperature is 35℃~40℃, especially at 35℃, the yield of the reaction product rebaudioside A is the highest, indicating that the mutant L3 has the highest stability at this temperature. Example 5

[0077] Coupled sucrose synthase

[0078] 1. Using rebaudioside E as substrate, rebaudioside D was biosynthesized by glycosyltransferase UGT76G4 mutant L3 coupled with sucrose synthase. The specific steps are as follows:

[0079] The following reaction system was amplified in vitro by shake flask transformation. The concentrations of the materials in the reaction system were as follows:

[0080] 20OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution, 20OD of sucrose synthase enzyme solution, 500mM sucrose, 1.5mM UDPG, 30mM rebaudioside E, made up to 10ml with 100mM phosphate buffer, and adjusted with 1mM NaOH to maintain the pH value of the conversion system at 7.5.

[0081] The reaction was terminated after shaking at 35°C for 24 hours, and samples were taken at 4h, 8h, 16h, and 24h during the conversion process to detect the reaction progress. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid. Liquid chromatography was used to qualitatively and quantitatively detect the composition of the reaction products.

[0082] The results are as follows Figure 4 As shown: The coupling of glycosyltransferase UGT76G4 mutant L3 and sucrose synthase can significantly reduce the amount of UDPG added to the reaction system while catalyzing rebaudioside E to produce rebaudioside D.

[0083] 2. Using STV as substrate, rebaudioside A was biosynthesized by glycosyltransferase UGT76G4 mutant L3 coupled with sucrose synthase. The specific steps are as follows:

[0084] The following reaction system was amplified in vitro by shake flask transformation. The concentrations of the materials in the reaction system were as follows:

[0085] 20OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution, 20OD of sucrose synthase enzyme solution, 500mM sucrose, 1.5mM UDPG, 30mM STV, made up to 10ml with 100mM phosphate buffer, and adjusted with 1mM NaOH to maintain the pH value of the conversion system at 7.5.

[0086] The reaction was terminated after shaking at 35°C for 24 hours, and samples were taken at 4h, 8h, 16h, and 24h during the conversion process to detect the reaction progress. The samples were diluted to clarify and then filtered through a 0.22μm organic filter membrane to obtain a filtered clear liquid, and the composition of the reaction products was qualitatively and quantitatively detected by liquid chromatography.

[0087] The results are as follows Figure 4 As shown: The coupling of glycosyltransferase UGT76G4 mutant L3 and sucrose synthase can significantly reduce the amount of UDPG added to the reaction system while catalyzing STV to produce rebaudioside A. Example 6

[0088] The effect of the amount of glycosyltransferase UGT76G4 mutant L3 enzyme on the conversion reaction was detected. The detection process is as follows:

[0089] 1. Using rebaudioside E as substrate, the following reaction systems (10 ml) with different amounts of glycosyltransferase UGT76G4 mutant L3 were prepared to catalyze RE to prepare RD:

[0090] Glycosyltransferase UGT76G4 mutant L3 enzyme solution (5OD, 10OD, 15OD, 20OD respectively), 100mM sodium phosphate buffer (pH 7.5), 1.5mM UDPG, 30mM rebaudioside E, 500mM sucrose, sucrose synthase enzyme solution 20OD, and 1mM NaOH was used to adjust and maintain the pH of the conversion system to 7.5.

[0091] After the above reaction systems were reacted at 35°C for 24 hours, they were heated to 95°C to inactivate and terminate the reaction, and the systems were vortexed and mixed. The systems were filtered through a 0.22 μm organic filter membrane, and the amounts of the reaction products were qualitatively and quantitatively detected by high performance liquid chromatography.

[0092] The results are as follows Figure 5 As shown: when the enzyme solution of glycosyltransferase UGT76G4 mutant L3 is 10~20OD, the RD content of the reaction product is the highest.

[0093] 2. Using STV as substrate, the following reaction systems (10 ml) with different amounts of glycosyltransferase UGT76G4 mutant L3 were prepared to catalyze STV to produce RA:

[0094] Glycosyltransferase UGT76G4 mutant L3 enzyme solution (5OD, 10OD, 15OD, 20OD respectively), 100mM sodium phosphate buffer (pH 7.5), 1.5mM UDPG, 30mM STV, 500mM sucrose, sucrose synthase enzyme solution 20OD, and 1mM NaOH was used to adjust and maintain the pH value of the conversion system to 7.5.

[0095] After the above reaction systems were reacted at 35°C for 24 hours, they were heated to 95°C to inactivate and terminate the reaction, and the systems were vortexed and mixed. The systems were filtered through a 0.22 μm organic filter membrane, and the amounts of the reaction products were qualitatively and quantitatively detected by high performance liquid chromatography.

[0096] The results are as follows Figure 5 As shown: when the enzyme solution of glycosyltransferase UGT76G4 mutant L3 is 10~20OD, the content of reaction product RA is the highest. Example 7

[0097] The effect of the amount of UDPG added on the conversion reaction was detected. The detection process is as follows:

[0098] 1. Using rebaudioside E as substrate, the following reaction systems (10 ml) with different UDPG addition amounts were prepared respectively, and glycosyltransferase UGT76G4 mutant L3 enzyme solution was used to catalyze RE to prepare RD:

[0099] 100mM sodium phosphate buffer (pH 7.5), 10OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution, UDPG (concentrations were 0.5mM, 1mM, and 1.5mM, respectively), 30mM rebaudioside E, 500mM sucrose, 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH of the conversion system at 7.5.

[0100] After the above reaction systems were reacted at 35°C for 24 hours, they were heated to 95°C to inactivate and terminate the reaction, and the systems were vortexed and mixed. The systems were filtered through a 0.22 μm organic filter membrane, and the amounts of the reaction products were qualitatively and quantitatively detected by high performance liquid chromatography.

[0101] The results are as follows Figure 6 As shown: when the concentration of UDPG in the reaction system is 1~1.5mM, the RD content of the reaction product is the highest.

[0102] 2. Using STV as substrate, the following reaction systems (10 ml) with different UDPG addition amounts were prepared respectively, and glycosyltransferase UGT76G4 mutant L3 enzyme solution was used to catalyze STV to prepare RA:

[0103] 100mM sodium phosphate buffer (pH 7.5), 10OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution, UDPG (concentrations were 0.5mM, 1mM, and 1.5mM, respectively), 30mM STV, 500mM sucrose, 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH of the conversion system at 7.5.

[0104] After the above reaction systems were reacted at 35°C for 24 hours, they were heated to 95°C to inactivate and terminate the reaction, and the systems were vortexed and mixed. The systems were filtered through a 0.22 μm organic filter membrane, and the amounts of the reaction products were qualitatively and quantitatively detected by high performance liquid chromatography.

[0105] The results are as follows Figure 6 As shown: when the concentration of UDPG in the reaction system is 1~1.5mM, the RA content of the reaction product is the highest. Example 8

[0106] The effect of sucrose concentration on the conversion reaction was tested. The testing process is as follows:

[0107] 1. Using rebaudioside E as substrate, prepare the following reaction systems (10 ml) with different sucrose concentrations, and use the glycosyltransferase UGT76G4 mutant L3 enzyme solution to catalyze RE to prepare RD:

[0108] 100mM sodium phosphate buffer (pH 7.5), 10OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution, 1mM UDPG, 30mM rebaudioside E, sucrose (concentrations of 200mM, 300mM, 400mM, and 500mM respectively), 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH of the conversion system at 7.5.

[0109] The above reaction systems were reacted at 35°C for 24 hours, and then heated to 95°C to inactivate and terminate the reaction. The mixture was shaken and filtered through a 0.22 μm organic filter membrane. The filtrates were used for qualitative and quantitative detection of the reaction products by high performance liquid chromatography.

[0110] The results are as follows Figure 7 As shown: when the sucrose concentration in the reaction system is 300~500mM, the RD content of the reaction product is higher.

[0111] 2. Using STV as substrate, prepare the following reaction systems (10 ml) with different sucrose concentrations, and use the glycosyltransferase UGT76G4 mutant L3 enzyme solution to catalyze STV to prepare RA;

[0112] 100mM sodium phosphate buffer (pH 7.5), 10OD of glycosyltransferase UGT76G4 mutant L3 enzyme solution, 1mM UDPG, 30mM STV, sucrose (concentrations of 200mM, 300mM, 400mM, and 500mM respectively), 20OD of sucrose synthase enzyme solution, and 1mM NaOH was used to adjust and maintain the pH of the conversion system at 7.5.

[0113] The above reaction systems were reacted at 35°C for 24 hours, and then heated to 95°C to inactivate and terminate the reaction. The mixture was shaken and filtered through a 0.22 μm organic filter membrane. The filtrates were used for qualitative and quantitative detection of the reaction products by high performance liquid chromatography.

[0114] The results are as follows Figure 7 As shown: when the sucrose concentration in the reaction system is 300~500mM, the RA content of the reaction product is higher.

[0115] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT76G4 mutant, characterized in that: The amino acid sequence of the mutant has at least 90% identity with the sequence shown in SEQ ID NO: 1, and the amino acids at positions 90 and 88 are mutated compared with SEQ ID NO: 1; The mutations are: the 90th amino acid mutates from I to G, and the 88th amino acid mutates from M to R; The mutant is the amino acid sequence shown in SEQ ID NO:4; The glycosyltransferase UGT76G4 mutant catalyzes the formation of a β-1,3 glycosidic bond at the C13 position of steviol glycoside.

2. The glycosyltransferase UGT76G4 mutant according to claim 1, characterized in that The steviol glycoside is STV, and the glycosyltransferase UGT76G4 mutant catalyzes the production of rebaudioside A and UDP using STV and UDPG as substrates.

3. The glycosyltransferase UGT76G4 mutant according to claim 1, characterized in that The steviol glycoside is rebaudioside E, and the glycosyltransferase UGT76G4 mutant catalyzes the production of rebaudioside D and UDP using rebaudioside E and UDPG as substrates.

4. The glycosyltransferase UGT76G4 mutant according to claim 2, characterized in that The glycosyltransferase UGT76G4 mutant described in claim 1 is used in combination with sucrose synthase to carry out a catalytic reaction with STV, UDPG and sucrose as substrates to prepare rebaudioside A.

5. The glycosyltransferase UGT76G4 mutant according to claim 4, characterized in that The concentrations of the components in the reaction system of the catalytic reaction are: 10-20 OD of glycosyltransferase UGT76G4 mutant enzyme solution, 10-30 OD of sucrose synthase enzyme solution, 300-500 mM sucrose, 1-1.5 mM UDPG, and 30-50 mM STV; and / or, The reaction conditions of the catalytic reaction are: pH value is 7-7.5 and temperature is 35-40°C.

6. The glycosyltransferase UGT76G4 mutant according to claim 3, characterized in that The glycosyltransferase UGT76G4 mutant described in claim 1 is used in combination with sucrose synthase to carry out a catalytic reaction with rebaudioside E, UDPG and sucrose as substrates to prepare rebaudioside D.

7. The glycosyltransferase UGT76G4 mutant according to claim 6, characterized in that The final concentrations of the components in the reaction system of the catalytic reaction are: 10-20OD of glycosyltransferase UGT76G4 mutant enzyme solution, 10-30OD of sucrose synthase enzyme solution, 300-500mM of sucrose, 1-1.5mM of UDPG, and 30-50mM of rebaudioside E; and / or, The reaction conditions of the catalytic reaction are: pH value is 7-7.5 and temperature is 35-40°C.

Images