A cas12f nuclease mutant, application and kit thereof
By modifying the amino acid residues and tags of the Cas12f nuclease, its binding ability with sgRNA/dsDNA was optimized, solving the delivery limitation problem of the Cas9 nuclease and achieving efficient gene editing of the Cas12f nuclease mutant.
Patent Information
- Application Number
- CN202411682954.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2044-11-22
AI Technical Summary
The existing Cas9 nucleases are difficult to deliver efficiently via adeno-associated virus vectors due to their large molecular size, which limits their application in gene therapy and other fields. Meanwhile, the performance of the compact Cas12f nuclease has not yet been fully explored.
By mutating amino acid residues at specific sites of the Cas12f nuclease, its binding ability with sgRNA/dsDNA is optimized, and the cleavage efficiency is improved. This includes charge modification of the amino acid sequence and tag addition to facilitate separation and tracking, thus developing a Cas12f nuclease mutant with higher in vitro cleavage activity.
The cleavage efficiency of the Cas12f nuclease mutant was increased by 1.3-2.2 times, making it suitable for gene editing and improving editing efficiency.
Smart Images

Figure CN119265163B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to a Cas12f nuclease mutant, application and kit, and belongs to the technical field of biotechnology. BACKGROUND
[0002] CRISPR is short for Clustered Regularly Interspaced Short Palindromic Repeats, that is, many identical small segments are uniformly inserted into a piece of DNA arranged in disorder. The sequences are called repeats, and the DNA arranged in disorder is called spacers. Cas is short for CRISPR associated, which, together with the CRISPR sequence, constitutes the CRISPR / Cas system. The CRISPR / Cas system has wide applications in the fields of biological and medical diseases, anti-cancer drug research, stem cell therapy, etc.
[0003] In the CRISPR / Cas system, the most studied and used Cas effector protein is Cas9, but it is difficult to be efficiently delivered by an adeno-associated virus (AAV) vector due to its large molecular size (more than 1000 amino acids), thereby limiting its application in the field of gene therapy. For example, the maximum carrying capacity of the adeno-associated virus delivery system is 4700 nucleotides, which is not much longer than the gene (4200 nucleotides) encoding Streptococcus pyogenes Cas9, resulting in no space to assemble other regulatory elements.
[0004] Therefore, researchers actively seek Cas effector proteins that are relatively small in size but still have the function of a "scissors". One of the most compact CRISPR effector nucleases, Cas12f (400-700 amino acids), has attracted attention due to its relatively small molecular weight. Cas12f is a crRNA and tracrRNA co-mediated (or sgRNA alone after fusion) DNA endonuclease that can specifically cleave target dsDNA in a PAM-dependent manner, causing DNA double-strand breaks and generating sticky ends. At present, there is relatively little research on the nuclease Cas12f, and the present application mutates it in order to further improve its performance. SUMMARY
[0005] The purpose of the present application is to provide a Cas12f nuclease mutant with higher in vitro cleavage activity.
[0006] The technical scheme adopted by the present application is:
[0007] A Cas12f nuclease mutant, which is a protein as described in any one of a1-a3 enzyme mutations:
[0008] a1: one or more mutations in any of the following sites: 115, 119, 364, 401, 447, are made on the basis of the Cas12f nuclease with the amino acid sequence shown in SEQ ID No. 2; these sites are all the binding sites of Cas12f nuclease and sgRNA / dsDNA, and the charge of the amino acid residues in these sites is optimized, i.e., from neutral or acidic to basic or neutral, to improve the binding capacity of the two.
[0009] a2: a protein with substantially the same cleavage efficiency obtained by substitution and / or deletion and / or addition of one or more amino acid residues other than the aforementioned mutations to the amino acid sequence shown in a1;
[0010] a3: a protein having 90% or more sequence identity with the protein of a1, or at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.8% sequence identity, and the cleavage efficiency is substantially equivalent to that of the protein of a1.
[0011] Preferably, the mutations are selected from one or more combinations of Q115L, E119L, I364K, T386K, E393A, E401A, or E447K. These sites are all the binding sites of Cas12f nuclease and sgRNA / dsDNA, and the charge of the amino acid residues in these sites is optimized, i.e., from neutral or acidic to basic or neutral, to improve the binding capacity of the two.
[0012] Preferably, it further comprises a tag for separating, purifying and / or tracking the functional domain, peptide or protein of the Cas12f nuclease. More preferably, the tag is a histidine (His) tag, a V5 tag, a FLAG tag, an influenza hemagglutinin (HA) tag, a Myc tag, a VSV-G tag, a thioredoxin (Trx) tag, a fluorescent protein such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), HcRED and DsRed, a glutathione-S-transferase (GST), a horseradish peroxidase (HRP), or a luciferase reporter protein.
[0013] The description of the mutation in the present application is the description of the mutation recognized by those skilled in the art. Taking the mutation of Q115L as an example, the glutamine (Q) at position 115 of the amino acid sequence shown in SEQ ID No. 2 is mutated to leucine (L), i.e., the glutamine (Q) at position 115 is replaced by leucine (L).
[0014] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The percentage sequence identity can be calculated by any method known in the art, for example using a BLOSUM62 matrix, referring to the method described in Henikoff et al., PNAS, 89(22): 10915-10919 (1992).
[0015] A gene encoding the Cas12f nuclease mutant described above.
[0016] An expression vector or a host bacterium of the Cas12f nuclease mutant described above.
[0017] Application of the Cas12f nuclease mutant described above in in vitro gene editing.
[0018] The application also discloses a composition or kit containing the Cas12f nuclease mutant described above.
[0019] The application also discloses a gene editing kit containing the Cas12f nuclease mutant described above.
[0020] The application also discloses a method for cleaving a target nucleic acid, which comprises contacting the target nucleic acid with the Cas12f nuclease mutant, the composition or the kit described above.
[0021] The application mutates the wild-type Cas12f nuclease, and the mutant obtained has a significantly improved cleavage efficiency, which is 1.3-2.2 times higher than that of the wild type, and is more suitable for gene editing and improves the editing efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 Figure 4 is a schematic diagram of the cleavage results of the wild-type Cas12f nuclease and various mutants on the p11-LacY-wtx1 fragment.
[0023] Figure 2 Figure 5 is a schematic diagram of the cleavage results of the wild-type Cas12f nuclease and various mutants on the EMX1 gene fragment.
[0024] Figure 3 Figure 6 is a schematic diagram of the cleavage results of the wild-type Cas12f nuclease and various mutants on the KEX2 gene fragment. DETAILED DESCRIPTION
[0025] The specific embodiments of the application are further described below with reference to the accompanying drawings, but the description of the embodiments does not impose any limitation on the scope of protection of the application.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description herein is for describing particular embodiments only and is not intended to be limiting of the application.
[0027] The substances or instruments used in the following examples can be obtained from conventional commercial channels, unless otherwise specified.
[0028] Example 1 Construction of Cas12f Mutant Plasmid
[0029] The pET-21b plasmid containing wild-type Cas12f (the sequence is shown as SEQ ID NO. 1) was used as a template to amplify different Cas12f mutant fragments using point mutation primers. The wild-type Cas12f protein sequence is shown as Seq ID NO. 2. The corresponding amino acid mutation sites of the mutants are shown in the following table.
[0030]
[0031]
[0032] The amplification system using TOYOBO KOD DNA polymerase is shown in the following table. By amplifying each mutant, the gene amplification fragments of each mutant were obtained.
[0033]
[0034] The Cas12f mutant fragments obtained were ligated into the pET-21b plasmid using the In-Fusion HD Cloning Kit, and the recombinant plasmid was obtained. Subsequently, the mutant recombinant plasmid was transformed into BL21(DE3) cells by chemical transformation, and single colonies were selected for expansion and culture to extract plasmids, which were then sequenced and verified.
[0035] Example 2: Purification of Cas12f Mutant Protein
[0036] 1. Cas12f Mutant Protein Expression: Each mutant bacterial solution was inoculated into 800 mL of fresh 2xYT liquid medium at a ratio of 1%, and cultured at 37°C, 220 rpm until the OD 600 value was about 0.8, 0.1 mM IPTG was added, and the culture was incubated at 16°C, 220 rpm for about 18 h to induce expression of the exogenous protein. The mutant bacterial solution was collected.
[0037] 2. Cell disruption: Discard the supernatant after centrifugation at 4°C, 5500 rpm for 15 min; dissolve the cells in the cell disruption buffer A according to the cell weight, add 4.5 g of cells to 45 mL of cell disruption buffer A, 4°C, magnetic stirring for 30 min, use a stirrer to stir until the cells are evenly dispersed in the cell disruption solution, and no blocky cells are observed. Add PMSF to 2 mM before cell disruption for ultrasonic disruption, and the disruption conditions are as follows: 60%, 3' stop 5', 15 min / time*2, ice bath. After the end, centrifuge at 12000 g for 30 min, and take the supernatant.
[0038] 3. Nickel column purification
[0039] The purification procedure and the purification buffer are shown in the following table:
[0040]
[0041] Buffer A: 20 mM Tris; 800 mM NaCl; 10% Glycerol; pH 7.6
[0042] Buffer B: 20 mM Tris; 500 mM NaCl; 0.5 M imidazole; 10% Glycerol; pH 7.6 Buffer C: 20 mM Tris; 1.5 M NaCl; 10% Glycerol; pH 7.6
[0043] 4. HE purification
[0044] The purification procedure and the purification buffer are shown in the following table:
[0045]
[0046] Buffer D: 20 mM Tris; 100 mM NaCl; 1 mM DTT; 0.1 mM EDTA; 10% Glycerol; pH 7.6 Buffer E: 20 mM Tris; 2 M NaCl; 1 mM DTT; 0.1 mM EDTA; 10% Glycerol; pH 7.6
[0047] Before loading, the sample needs to be diluted with Buffer D to a conductivity of about 18 mS / cm, and if there is a precipitate after dilution, it needs to be filtered with a filter membrane.
[0048] 5. Preparation of protein stock solution
[0049] Dialyze the target protein sample in Buffer G at a ratio of 1:100, add 50% volume of glycerol after dialysis, mix thoroughly, and then filter through a 0.22 μm filter membrane. Detect the purity of each mutant by electrophoresis and estimate the protein concentration.
[0050] Buffer G: 40 mM Tris; 1 M NaCl; 2 mM DTT; 0.2 mM EDTA; 10% Glycerol; pH 8.0
[0051] 1. Preparation of Cas12f mutant in vitro cleavage DNA substrate
[0052] To better evaluate the universality of Cas12f mutants to cleave substrates and the stable cleavage efficiency, we selected different cleavage target substrates, respectively from plasmid sequences, human gene sequences and yeast gene sequences.
[0053] ① The p11-LacY-wtx1 plasmid was used as a template to amplify the plasmid cleavage sequence containing the cleavage target, and the sequence is shown as SEQ ID NO: 3. The amplification primer sequence is:
[0054] p11-LacY-wtx1-F: ACAAAGCGGGACCAAAGCCA (SEQ ID NO: 22)
[0055] p11-LacY-wtx1-R: GAGTTCGGCATGGGGTCAGG (SEQ ID NO: 23)
[0056] ② The 293 cell genome was used as a template to amplify the human EMX1 gene sequence containing the cleavage target, and the sequence is shown as SEQ ID NO: 4. The amplification primer sequence is:
[0057] EMX1-F: GTGTTGCGGAGGGGAGTGGACTTAGGG (SEQ ID NO: 24)
[0058] EMX1-R: GGCAGCAGCTAGGCTGAGGGTCGCTGA (SEQ ID NO: 25)
[0059] ③ The GS115 yeast genome was used as a template to amplify the yeast KEX2 gene sequence containing the cleavage target, and the sequence is shown as SEQ ID NO: 5. The amplification primer sequence is:
[0060] KEX2-F: GAGCTCCTGTTGTGATGGACAA (SEQ ID NO: 26)
[0061] KEX2-R: TGCCATAAATCCAGCTTTGTGG (SEQ ID NO: 27)
[0062] 2. Preparation of Cas12f mutant in vitro cleavage sgRNA
[0063] sgRNA was transcribed by N6 T7 High Yield RNA Synthesis Kit, and the transcription system is shown in the table below. The corresponding DNA template was chemically synthesized by Shenguo (italic represents the T7 promoter sequence, underlined font indicates the backbone sequence of sgRNA, and bold font represents the target sequence)
[0064] Component Amount 10x Transcription Buffer 2 μL CTP / GTP / ATP / UTP (100 mM each) 2 μL each Three template DNAs 2 ug T7 RNA Polymerase Mix 2 μL RNase free H2O Up to 20 μL
[0065] The transcription template sequence of p11-LacY-wtx1 substrate corresponding sgRNA: TAATACGACTCACTATAGGG ACCGCTT CACCGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCG AGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACA AAGAAAGGAATGCAAC CACCTATAAAAG AGAGAGCC TTTTATTTTTT (SEQ ID NO:28)
[0066] The transcription template sequence of EMX1 substrate corresponding sgRNA:
[0067] TAATACGACTCACTATAGGG ACCGCTTCACCGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCG
[0068] AGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAAGAAAGGAATGCAAC GAGCCTCTTCCTCGAGACTGCGT TTTTATTTTTT (SEQ ID NO:29)
[0069] The transcription template sequence of KEX2 substrate corresponding sgRNA:
[0070] TAATACGACTCACTATAGGG ACCGCTTCACCGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCG
[0071] AGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAAGAAAGGAATGCAAC ATATCAATTGCCCCAACTGTTAT TTTTATTTTTT (SEQ ID NO:30)
[0072] After in vitro transcription, 2 uL DNase I was added, and the DNA template was digested at 37°C for 15 min. Subsequently, phenol / chloroform purification was performed: 115 uL RNase-free H2O and 15 uL 3M sodium acetate (pH 5.2) were added to the 20 uL reaction mixture, and mixed evenly. An equal volume of phenol / chloroform (1:1) was extracted once, and an equal volume of chloroform was extracted twice. The supernatant was collected and transferred to a new RNase-free EP tube. 2 volumes of anhydrous ethanol were added to precipitate the RNA. After mixing evenly, it was placed at -20°C for at least 30 minutes, and centrifuged at 4°C at the maximum speed for 15 minutes to collect the precipitate. 500 uL of 70% chilled ethanol was added to wash the RNA precipitate. DEPC water was added to dissolve the RNA, and the RNA concentration was determined using a nanodrop.
[0073] 3. Cas12f mutant in vitro cleavage experiment
[0074] ① The Cas12f in vitro cleavage system was configured according to the following table:
[0075]
[0076] Then 4 uL 6xDNAloading was added and mixed evenly. 1.5% agarose gel electrophoresis was performed at 170V for 30 min. Imaging was performed under a gel imager. The cleavage effects of the three substrates are shown in Figures 1-3
[0077] ② The gray scale analysis of the substrate and cleavage product bands was performed using software such as ImageJ, and the cleavage efficiency was calculated. The cleavage efficiency % = (cutting substrate 1 gray value + cutting substrate 2 gray value) / (cutting substrate 1 gray value + cutting substrate 2 gray value + residual substrate gray value) x 100%, and the cleavage rate is shown in the following table. The mutant mutation sites are intended to optimize the binding of sgRNA and dsDNA. Among them, the MT1, MT2, MT3, MT6, MT7, and MT8 mutants significantly improve the cleavage activity, and the average cleavage activity is increased by more than 1.7 times compared with the wild type.
[0078]
[0079] The applicant declares that the detailed method of the present application is illustrated by the above examples, but the present application is not limited to the above detailed method, that is, it does not mean that the present application must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement of the present application, equivalent replacement of each raw material of the product of the present application, addition of auxiliary ingredients, selection of specific methods, etc. fall within the protection scope and disclosure scope of the present application.
Claims
1. A Cas12f nuclease mutant, characterized in that, The protein is as follows: The Cas12f nuclease, whose amino acid sequence is shown in SEQ ID No. 2, was mutated to E119L.
2. The Cas12f nuclease mutant according to claim 1, characterized in that, It also includes tags for isolating, purifying, and / or tracking the functional domains, peptides, or proteins of the Cas12f nuclease.
3. The Cas12f nuclease mutant according to claim 2, characterized in that, The tags are His tags, V5 tags, FLAG tags, HA tags, Myc tags, VSV-G tags, Trx tags, fluorescent proteins, GST, HRP, or luciferase.
4. The encoding gene of the Cas12f nuclease mutant according to any one of claims 1-3.
5. The expression vector or host bacterium of the Cas12f nuclease mutant according to any one of claims 1-3.
6. The application of the Cas12f nuclease mutant according to any one of claims 1-3 in in vitro gene editing.
7. A composition or kit, characterized in that... Contains the Cas12f nuclease mutant according to any one of claims 1-3.
8. A gene editing kit, characterized in that... It contains the Cas12f nuclease mutant of any one of claims 1-3 or the encoding gene of claim 4.
9. A method for in vitro cleavage of target nucleic acids, characterized in that... Contact the target nucleic acid with any of the Cas12f nuclease mutants of claims 1-3, the composition of claim 7, or the kit.
Citation Information
Patent Citations
A human immortalised neural precursor cell line
CN101189327A
An L-amino acid-producing bacterium and a method for producing an L-amino acid
EP2218729A1