Application of over-expressed BbCDR2 gene in improving spore production, insecticidal and stress resistance of beauveria bassiana and method of over-expressed BbCDR2 gene in improving spore production, insecticidal and stress resistance of beauveria bassiana

Abstract

The invention discloses application and a method of over-expressed BbCDR2 gene in improving spore production, insect killing and stress resistance of beauveria bassiana. The nucleotide sequence of the BbCDR2 gene is shown as SEQ ID NO.5, and the amino acid sequence is shown as SEQ ID NO.6. The gene BbCDR2 is over-expressed in the beauveria bassiana, so that the spore production, insect killing and stress resistance of the beauveria bassiana are improved, and the yield of the beauveria bassiana is improved. The sporulation quantity and infection virulence of the beauveria bassiana can be improved, the spore wall damage and hypertonic stress resistance of the beauveria bassiana can be enhanced, and the method has fundamental significance in improving the performance and practical application of the beauveria bassiana strain.

Description

Technical Field

[0001] The present invention relates to the field of insect control and fungal genetic engineering technology, and specifically to the application of overexpressing the BbCDR2 gene of Beauveria bassiana in improving the spore production, insecticidal and stress resistance capabilities of Beauveria bassiana, and also to a method for overexpressing the BbCDR2 gene of Beauveria bassiana to improve the spore production, insecticidal and stress resistance capabilities of Beauveria bassiana. Background Art

[0002] As a traditional agricultural country, my country's intensive ecological agricultural production mode is a major trend of future development and transformation. Intensive agricultural production methods also face many challenges such as insect pests, diseases, and chemical drug pollution. Over the past century, chemical pesticides have provided great guarantees for agricultural development with their advantages of good insecticide effects, quick results, and simple use. However, at the same time, the abuse of chemical pesticides has led to many hazards such as environmental pollution, pesticide residues, and food poisoning, posing a huge challenge to ecological agriculture. Therefore, the demand for pollution-free and eco-friendly pesticides in agricultural production is increasing, among which biological pesticides are one of the most effective alternatives. Beauveria bassiana is a broad-spectrum insect pathogenic fungus. Due to its easy cultivation and excellent insecticide effects, it has been widely used in intensive agricultural and forestry production worldwide (Fan et al., 2012; Wang et al., 2014).

[0003] Unlike bacteria and viruses, which infect insect pathogens through the digestive tract, insect pathogenic fungi can directly penetrate the body wall to infect insects, which has a unique advantage in controlling piercing-sucking mouthparts pests such as aphids and planthoppers that insert their stylets directly into the plant phloem to suck sap. Conidia are the carriers of Beauveria bassiana to infect hosts. During the fungal infection process, conidia germinate on the insect epidermis to form infection structures-appressoria, which penetrate the insect body wall under the synergistic action of mechanical pressure and a series of hydrolases such as esterase, chitinase, and protease produced by secretion, and then proliferate in the insect blood cavity, consuming host nutrients or producing toxic substances to kill the host (Fan et al., 2017). After the host dies, the fungus grows on the insect corpse and produces conidia on the surface of the corpse, which can infect other hosts under suitable conditions (Wang et al., 2024). Conidia always accompany infection and represent the initiation and completion of differentiation, which is crucial to the reproduction and biological control of Beauveria bassiana.

[0004] The proliferation ability and spore production ability of Beauveria bassiana are closely related to the production of fungal preparations and are important reference indicators for the production of fungal biocontrol preparations. At present, the method of increasing spore production in production is mostly to promote growth and spore production by optimizing culture conditions. With the report of a series of signal pathway-related proteins and genes in Beauveria bassiana, improving the spore production and proliferation ability of Beauveria bassiana by genetic engineering is both efficient and feasible, and an effective means to improve the insecticidal ability of biocontrol strains. In addition, Beauveria bassiana is also facing diverse, complex, and dynamic ecological changes. In agricultural production, it needs to directly participate in the response to temperature, humidity, various inorganic stress factors and other microorganisms, and its control effect is very susceptible to environmental factors. Therefore, discovering genes related to proliferation and stress tolerance of Beauveria bassiana and using them as targets for strain improvement, thereby improving the stress resistance and biocontrol ability of strains, is of great significance to the wide application of biocontrol strains and the steady and efficient development of intensive ecological agriculture in my country. Summary of the invention

[0005] In view of this, one of the objects of the present invention is to provide an application of overexpressing the BbCDR2 gene in improving the spore production, insecticidal and stress resistance of Beauveria bassiana. A second object is to provide a method for overexpressing the BbCDR2 gene to improve the spore production, insecticidal and stress resistance of Beauveria bassiana. A third object of the present invention is to provide a Beauveria bassiana strain overexpressing the BbCDR2 gene prepared by the method. A fourth object of the present invention is to provide a fungal insecticide containing the Beauveria bassiana strain overexpressing the BbCDR2 gene.

[0006] To achieve the above object, the present invention provides the following technical solutions: The application of overexpression of BbCDR2 gene in improving the spore production, insecticidal and stress resistance of Beauveria bassiana. The genetically modified strain obtained by overexpressing the BbCDR2 gene in Beauveria bassiana can improve the spore production, insecticidal and stress resistance of Beauveria bassiana.

[0007] In some embodiments of the present invention, the nucleotide sequence of the BbCDR2 gene is shown as SEQ ID NO.5, and the amino acid sequence is shown as SEQ ID NO.6.

[0008] In some embodiments of the present invention, the insecticidal ability is the ability to kill greater wax moth.

[0009] In some embodiments of the present invention, the stress resistance is to increase the resistance to abiotic stresses such as Congo red, sodium dodecyl sulfate, sodium chloride and sorbitol.

[0010] The invention discloses a method for improving the spore production, insecticidal and stress resistance abilities of Beauveria bassiana by overexpressing the BbCDR2 gene. The BbCDR2 gene is overexpressed in Beauveria bassiana to obtain Beauveria bassiana with improved spore production, insecticidal and stress resistance abilities.

[0011] In some embodiments of the present invention, the specific steps for overexpressing the BbCDR2 gene in Beauveria bassiana are as follows: 1) Using the cDNA genome of Beauveria bassiana as a template and the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 as primers, PCR was performed to amplify the cDNA fragment of the BbCDR2 gene; 2) The cDNA fragment of the BbCDR2 gene was connected to the constitutive promoter PgpdA of the vector pK2-bar by homologous recombination to obtain the overexpression vector pb3-BbCDR2-pk2-bar; 3) The overexpression vector was transferred into the wild-type strain of Beauveria bassiana by Agrobacterium-mediated method, and the transformants were detected by PCR and RT-qPCR methods. BbCDR2 was obtained after screening. OE strains.

[0012] In some embodiments of the present invention, the cDNA fragment of the BbCDR2 gene in step 1) is shown as SEQ ID NO.5.

[0013] The Beauveria bassiana strain over-expressing the BbCDR2 gene is prepared by the method.

[0014] A fungal insecticide contains the Beauveria bassiana strain overexpressing the BbCDR2 gene.

[0015] The present invention discloses the following technical effects: The present invention provides an application of overexpressing the BbCDR2 gene in improving the spore production, insecticidal and stress resistance of Beauveria bassiana. Overexpressing the gene BbCDR2 in Beauveria bassiana can improve the spore production and infection toxicity of Beauveria bassiana and enhance its ability to resist spore wall damage and hyperosmotic stress. Specifically, a conidia suspension of Beauveria bassiana overexpressing the BbCDR2 gene is inoculated on a CZM culture medium, and the conidia production per unit area of ​​the culture medium is counted at 5 d, 10 d and 15 d. It is found that at different periods, the conidia production of the overexpressing strain is increased by 14.7-54.5% compared with the wild-type strain, and the difference is significant (P<0.05); the conidia suspension of Beauveria bassiana overexpressing the BbCDR2 gene is used to infect the pest greater wax moth by soaking the body wall, and the death rate of the test insects infected by the overexpressing strain is higher than that of the test insects treated with the wild-type strain. This indicates that overexpression of the gene BbCDR2 in Beauveria bassiana can enhance the insecticidal ability of Beauveria bassiana. In addition, the conidia suspension of the overexpressed strain and the wild type were inoculated into CZM medium and CZM medium supplemented with Congo red (CR), sodium dodecyl sulfate (SDS), sodium chloride (NaCl) and sorbitol (SOR), and cultured at 26°C for 7 days to count the colony diameters. The relative inhibition rates of the overexpressed strain and the wild type strain under stress were compared with those of the strain on the medium without stress treatment. The resistance of the overexpressed strain to the above four stresses was significantly stronger than that of the wild type strain (P<0.05). This indicates that overexpression of the BbCDR2 gene in Beauveria bassiana can enhance the ability of spore production and insecticidal killing and significantly improve its ability to resist spore wall damage and hyperosmotic stress.

[0016] As a broad-spectrum biocontrol fungus, Beauveria bassiana has the main function of infecting pests in agricultural and forestry production with conidia for biological control, so insecticidal ability is the fundamental factor in evaluating the quality of Beauveria bassiana strains. Beauveria bassiana produces conidia through asexual reproduction, and the ability to produce spores is an important aspect that affects its biological control ability. Enhancing the ability to produce spores and kill insects is of fundamental significance for improving the performance and practical application of Beauveria bassiana strains. Conidia are the main carriers for the proliferation and participation of Beauveria bassiana in biological control, and are also the main units for Beauveria bassiana to resist adversity when applied in agricultural and forestry biological control. Enhancing the ability of conidia to resist spore wall damage and hyperosmotic stress in the environment is also an important aspect of improving the application value of Beauveria bassiana preparations. Therefore, the improved strain of Beauveria bassiana that overexpresses the BbCDR2 gene obtained by the present invention has a wide range of practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 Schematic diagram for the construction of pb3-BbCDR2-pk2-bar vector; Figure 2 Verification of transformed strains; A: Beauveria bassiana BbCDR2 OE PCR verification of transformants, using pb3-up / OE-BbCDR2-R as primers, Marker represents standard DNA molecules, WT represents wild-type strain of Beauveria bassiana, T1, T2, and T3 represent different transformed strains; B: BbCDR2 of Beauveria bassiana OE Detection of the transcription level of the transformant gene BbCDR2, WT represents the wild-type strain of Beauveria bassiana, and T1, T2, and T3 represent different transformed strains.

[0018] Figure 3 BbCDR2 OE Statistics of spore production of strains cultured on CZM medium for 5 days, 10 days, and 15 days. *: significant difference (P<0.05), **: extremely significant difference (P<0.01); Figure 4 Galleria mellonella OE Survival curve of the strain after body wall infection; Figure 5 BbCDR2 OE Relative inhibition rate of bacterial colony growth under various stresses. *: significant difference (P<0.05), **: extremely significant difference (P<0.01). DETAILED DESCRIPTION

[0019] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0020] Example 1: Construction of a Beauveria bassiana strain that overexpresses the BbCDR2 gene.

[0021] (1) PCR amplification of BbCDR2 gene cDNA.

[0022] The specific method is as follows: using the cDNA genome of Beauveria bassiana as a template, using the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 as primers, and using Phanta Super-Fidelity DNA Polymerase (Vazyme) for PCR. The PCR reaction system is: 10 μL 2× reaction buffer, 1 μL primer each, 2 μL Beauveria bassiana cDNA template, 1 μL dNTP, and ddH2O is supplemented to 20 μL. The reaction program is: 95℃ / 5 min; 95℃ / 5 s, 56℃ / 5 s, 72℃ / 2 min, 35 cycles; 72℃ / 5 min. The cDNA fragment of the BbCDR2 gene (SEQ ID No.5~6) was amplified, and the product was recovered after gel electrophoresis verification.

[0023] SEQ ID No.1: TAATCAATAACAGAATTCATGTCGACCCGTGTTGTCCGCG; SEQ ID No. 2: tgtcgacactagtGAATTCTCATGCATCAGGGCTCTTGC.

[0024] (2) Construction of BbCDR2 gene overexpression vector.

[0025] The cDNA fragment of the BbCDR2 gene amplified in (1) was cloned into the EcoR I site under the constitutive promoter PgpdA of the pk2-bar vector (the map and sequence of the pk2-bar vector can be found in the literature "Agrobacterium-mediated genetic transformation of budding Aureobasidium and efficient screening of polymalic acid high-yielding strains" published by Tu Guangwei et al. and the Chinese patent application number 202110871353.9 "Application of aspartic protease genes in improving Beauveria bassiana varieties") using the homologous recombinase ClonExpress of Vazyme Company to obtain the pb3-BbCDR2-pk2-bar overexpression vector. The vector construction schematic diagram is shown in the figure below. Figure 1 As shown. The specific reaction system was carried out according to the system recommended in the instruction manual of Clon Express MultiS One Step Cloning Kit (Nanjing Novogene Biotech Co., Ltd.): 2 μL 5× reaction buffer, 1 μL pk2-bar vector recovered after EcoR I digestion, 3 μL BbCDR2 cDNA fragment, 1 μL ligase, supplemented with ddH2O to 10 μL, connected in a PCR instrument at 37℃ / 30 min, transformed Escherichia coli, and extracted plasmid.

[0026] (3) Agrobacterium transformation.

[0027] The overexpression vector pb3-BbCDR2-pk2-bar was transformed into Agrobacterium AGL-1 by electroporation at 220V for 4-5 ms. The cells were screened on YEB medium supplemented with kanamycin (working concentration of 50 μg / mL) and carbenicillium (working concentration of 50 μg / mL), and verified by PCR single colonies to obtain Agrobacterium containing the overexpression vector.

[0028] Homologous recombination transformation of Beauveria bassiana.

[0029] Wild-type Beauveria bassiana was used as the transformation recipient and the transformation was carried out using the Agrobacterium tumefaciens-mediated genetic transformation method according to the method of Fang et al. (Fang et al., 2004). The culture medium and specific transformation method used are as follows: The culture medium used in the transformation process: IM solid medium: 7.8 g MES, 5 mL 1M glucose, 0.3 g NaCl, 0.3 g K2HPO4, 0.3 g MgSO4·7H2O, 5 mL glycerol, 15 g agar, 1 mL 200 mM acetosyringone, add ddH2O to 1000 mL, pH = 5.3. Note that glucose and AS need to be filtered and added after the culture medium is cooled to 55°C; IM liquid medium: 7.8 g MES, 10 mL 1M glucose, 0.3 g NaCl, 0.3 g K2HPO4, 0.3 g MgSO4·7H2O, 5 mL glycerol, 1 mL 200 mM AS acetosyringone, add ddH2O to 1 L, adjust pH = 5.3. Note that glucose and AS need to be filtered and added after the culture medium has cooled to 55°C; CZM culture medium: 30 g sucrose, 2 g NaNO3, 0.5 g MgSO4•7H2O, 1 g K2HPO4, 0.01 g FeSO4, 0.5 g KCl to adjust the pH to 7.0, 15 g agar powder, and sterilize at 121°C for 15 min.

[0030] Specific transformation method: a single colony of Agrobacterium tumefaciens carrying the plasmid vector was inoculated into a YEB liquid medium containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin, and cultured overnight (16-20 h) at 28°C and 200 rpm in a shaking incubator; 3 mL of the bacterial solution was centrifuged at 6000 rpm for 10 min, the supernatant was discarded, and the bacteria were resuspended in an equal amount of IM liquid medium (containing 200 μM acetosyringone and 10 mM glucose), and the concentration was adjusted to OD 660The concentration of the culture medium was 0.15, and then the medium was cultured at 28°C and 200 rpm for 6 h. During this period, the microporous filter membrane was spread on the IM solid culture medium, and Tween-80 (0.5% v / v) was used to prepare a 1×10 5 conidia / mL spore suspension; after mixing the above spore suspension and the pre-cultured Agrobacterium bacterial solution in equal volumes, 100 µl of the bacterial solution was spread on the microporous filter membrane on the IM solid culture medium plate, and co-cultured at 26°C for 48 h; the microporous filter membrane after co-culture was transferred to a screening culture medium CZM+60 µg / ml herbicide PPT for further screening, and cultured at 26°C for about 5 days until resistant colonies appeared.

[0031] (5) Screening of positive transformants Use a toothpick to pick a single colony and inoculate it on a 48-well plate with the same resistance for screening. Use a sterile toothpick to pick the mycelium of the colony growing in the 48-well plate again, immerse it in 8 μL of 0.3 mol / L NaOH solution, heat it at 98℃ for 3 minutes in a PCR instrument to lyse the mycelium, then add 170 μL of neutralizing solution and mix evenly. The mixed solution is the crude DNA extract. (Neutralizing solution formula: 5 mL 1 M Tris HCl (pH=8.0), 20 mL 0.3 M HCl, dilute to 400 mL with ddH2O.) Using the crude mycelium DNA extract as a template, use the primers pb3-up / OE-BbCDR2-R on the vector for PCR amplification to verify potential positive transformants (BbCDR2 OE The PCR verification results of positive transformants are as follows Figure 2 , as shown in A. The positive transformants were transferred and amplified and used as the experimental materials for the next step.

[0032] (6) Screening of BbCDR2-overexpressing strains using quantitative PCR OE Expression Real-time quantitative PCR was performed using the iCycler iQ multi-color real-time PCR detection system with SYBR Green (Bio-Rad). 5 μL of reaction mixture, 0.5 μL of upstream and downstream primers (SEQ ID NO.3 and SEQ ID NO.4, concentration of 10 μmol / L), 4 μL of 10-fold diluted cDNA template, total volume of 10 μL, briefly centrifuged to mix evenly, the reaction program was 95℃ / 5min, 95℃ / 15 s, 60℃ / 15 s, 72℃ / 30 s program for 39 cycles of amplification. The relative expression of the gene was determined with reference to the expression of the actin gene. The results are shown in Figure 2 , as shown in B.

[0033] SEQ ID No.3:TTAATCTCTTCCGCGTCCTT; SEQ ID No. 4: CAAGCGCTGCTCGCTGATG.

[0034] Example 2: Experiment on sporulation of Beauveria bassiana.

[0035] Culture medium required for the experiment: CZM culture medium preparation method is as described above. Experimental method: BbCDR2 OE The strain and the wild-type strain were cultured on CZM solid medium for 14 days, and the conidia suspension was prepared and the conidia concentration was controlled at 1×10 7 conidia / mL. Prepare CZM medium, sterilize and pour 15 mL into a 90 mm culture dish. After the plate is dried, take 100 μL of the above bacterial suspension and spread it evenly on the plate. Culture at 26 ℃ for 5-15 days. At 5, 10, and 15 days, use 1 cm 2 Use a cork puncher to take 3 bacterial blocks from each culture dish and place them in 3 mL of 0.05% Tween 80 solution. Vortex thoroughly and filter with sterile double-layer lens paper to remove hyphae and debris to obtain conidia suspension of each strain. Use a hemocytometer to count the spore concentration under a microscope, and calculate the conidia yield per unit area of ​​each strain according to the actual bacterial block area and spore concentration.

[0036] Results of the above experiments BbCDR2 OE The spore production of the strain on CZM medium for 5 days, 10 days, and 15 days is shown in the following table. Figure 3 BbCDR2 OE The conidia production of BbCDR2 was significantly higher than that of the wild-type strain, especially in the first 5 days of conidia production. OE The conidia production of ΔBbCDR2 was 1.55 times that of WT (P<0.01). As the spores matured, the conidia production of each strain continued to increase. At 10 days and 15 days, the conidia production of ΔBbCDR2 on each culture medium was still more than 1.2 times that of WT (P<0.05). *: significant difference (P<0.05), **: extremely significant difference (P<0.01).

[0037] Example 3: Virulence test of Beauveria bassiana.

[0038] The toxicity test was conducted using the body wall infection method with G. mellonella as the test insect. OE The strain and the wild-type strain were cultured on CZM solid medium for 14 days, and the conidia suspension was prepared and the conidia concentration was controlled at 1×10 7conidia / mL. Take 20 mL of the above spore suspension in a clean wide-mouth bottle, then place 33 wax moths in the wide-mouth bottle containing the spore suspension, shake gently for 15 seconds and pour it out, filter the spore suspension and absorb excess water, then spread the wax moths evenly and place them in a sterile 150 mm culture dish, add soaked cotton balls to maintain humidity. Three biological replicates were set for each treatment, and the same volume of sterile 0.05% Tween 80 solution was used as a control. The wax moths were placed in a 26 ℃ incubator under dark conditions. The number of dead test insects was recorded every 24 hours starting from the 72nd hour, and the survival curve of the test insects was prepared using Graphpad Prism 8 software.

[0039] The results of the above experiments showed that the test insect G. mellonella was infected with BbCDR2 OE The survival curve of the strain after body wall infection is as follows Figure 4 The study found that compared with WT, BbCDR2 OE The survival rate of the test insects infected with the wild-type strain decreased significantly at 96-144 h, indicating that BbCDR2 OE The strain's infectivity is stronger than that of the wild-type strain.

[0040] Example 4: Colony growth experiment of Beauveria bassiana.

[0041] BbCDR2 OE The strain and the wild-type strain were cultured in CZM medium for 14 days, and the concentration of fungal spores inoculated was 1×10 7 conidia / mL. In a 90 mm culture dish, add CZM medium supplemented with Congo red (CR, 30 μM), sodium dodecyl sulfate (SDS, 0.35 μM), sodium chloride (NaCl, 0.8 M) and sorbitol (SOR, 1 M), and use CZM medium without any stress factors as a control. After cooling and drying, add 2 μL of the above spore suspension to the two strains at an interval of 2 cm, and set up 3 replicates. After the spore suspension is dried, transfer the culture dish to a 26℃ incubator for 5-7 days. Observe and record the growth status of each strain, and calculate the relative inhibition.

[0042] Results of the above experiments BbCDR2 OE The relative inhibition rate of bacterial colony growth under various stresses is as follows: Figure 5 BbCDR2 OE The strain was less inhibited by Congo red (CR), sodium dodecyl sulfate (SDS), sodium chloride (NaCl) and sorbitol (SOR) than the wild-type strain, with relative inhibition rates decreased by 16.2%, 13.5%, 5% and 3.9%, respectively, with significant differences (P<0.05).

[0043] The embodiments described above are only descriptions of the preferred embodiments of the present invention. Those skilled in the art should understand that modifications or equivalent substitutions of the technical solutions of the present invention without departing from the purpose and scope of the technical solutions should be included in the scope of the claims of the present invention.

Claims

1. Application of overexpression of BbCDR2 gene in improving the spore production, insecticidal and stress resistance of Beauveria bassiana, characterized in that: The genetically modified strain obtained by overexpressing the BbCDR2 gene in Beauveria bassiana can improve the spore production, insecticidal and stress resistance capabilities of Beauveria bassiana.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the BbCDR2 gene is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.

6.

3. The use according to claim 1, characterized in that: The insecticidal ability is the ability to kill greater wax moth.

4. The use according to claim 1, characterized in that: The stress resistance is to increase the resistance to abiotic stresses such as Congo red, sodium dodecyl sulfate, sodium chloride and sorbitol.

5. A method for overexpressing the BbCDR2 gene to enhance the spore production, insecticidal and stress resistance of Beauveria bassiana, characterized in that: The BbCDR2 gene was overexpressed in Beauveria bassiana to obtain Beauveria bassiana with enhanced spore production, insecticidal and stress resistance abilities.

6. The method according to claim 5, characterized in that: The specific steps for overexpressing the BbCDR2 gene in Beauveria bassiana are as follows: 1) Using the cDNA genome of Beauveria bassiana as a template and the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 as primers, PCR was performed to amplify the cDNA fragment of the BbCDR2 gene; 2) By homologous recombination, the cDNA fragment of the BbCDR2 gene was connected to the constitutive promoter PgpdA of the vector pK2-bar to obtain the overexpression vector pb3-BbCDR2-pk2-bar; 3) The overexpression vector was transferred into the wild-type strain of Beauveria bassiana by Agrobacterium-mediated method, and the transformants were detected by PCR and RT-qPCR methods. BbCDR2 was obtained after screening. OE strains.

7. The method according to claim 6, characterized in that: The cDNA fragment of the BbCDR2 gene in step 1) is shown as SEQ ID NO.

5.

8. A Beauveria bassiana strain overexpressing the BbCDR2 gene prepared by the method according to any one of claims 5 to 7.

9. A fungal insecticide comprising the Beauveria bassiana strain overexpressing the BbCDR2 gene according to claim 8.

Images