Ganoderma boninense strain gt1 and application thereof
By using Juncao (a type of fungus) as a cultivation substrate for Ganoderma lucidum, and optimizing the substrate formula and cultivation techniques, the problems of negative environmental impact and long cultivation cycle in existing technologies have been solved, enabling efficient and high-quality industrial production of Ganoderma lucidum.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- FUJIAN AGRI & FORESTRY UNIV
- Filing Date
- 2026-05-09
- Publication Date
- 2026-06-26
Smart Images

Figure CN122278643A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of edible fungi technology, and in particular relates to a sessile Ganoderma lucidum strain GT1 and its applications. Background Technology
[0002] Ganoderma lucidum without stem ( Ganoderma sessile ) is a fungus belonging to the genus Ganoderma in the family Ganodermataceae, and the kingdom Fungi ( Fungi Basidiomycota ( Basidiomycota ), Agaricales ( Agaricomycotina ), Agaricales ( Agaricomycetes ), Polyporeles ( Polyporales Polyporaceae ( Polyporaceae ), Ganoderma ( Ganoderma Ganoderma lucidum (also known as Ganoderma lucidum var. sarcodactylis) is a fungus with important medicinal value, containing various bioactive components such as polysaccharides and sterols. In recent years, it has received widespread attention due to its rich active ingredients and potential health benefits. In traditional medicine, Ganoderma lucidum var. sarcodactylis is considered to have the effects of tonifying qi and calming the mind, relieving cough and asthma, and is often used as an adjunct treatment for symptoms such as restlessness, insomnia, and palpitations. It is similar to the more common Ganoderma lucidum (Ganoderma sinense). Ganoderma lucidum Unlike other Ganoderma lucidum species, sessile Ganoderma lucidum is morphologically sessile or nearly spherical, with a grayish-brown to dark brown lacquer-like sheen and distinct concentric rings. This sessile, flattened Ganoderma fungus primarily parasitizes dead standing trees of broad-leaved trees such as birch and willow, and has been found in many broad-leaved forest distribution areas in China. Collecting and domesticating wild Ganoderma lucidum strains is of significant practical importance for the development of Ganoderma lucidum breeding and industry. Currently, the cultivation substrate for Ganoderma lucidum is mainly logs and sawdust, but this has certain negative environmental effects. Summary of the Invention
[0003] To address the aforementioned technical challenges, this invention utilizes perennial, high-yield fungal grass to replace sawdust in the cultivation of edible and medicinal fungi. It also screens suitable fungal grass formulas for Ganoderma lucidum cultivation, achieving high yield and high quality, which is of significant importance for the sustainable development of the Ganoderma lucidum industry. Furthermore, this invention optimizes the growth environment and substrate selection to enable large-scale cultivation of edible and medicinal fungi, providing resources and technical support for in-depth research and application.
[0004] This invention provides a sessile Ganoderma lucidum strain GT1, which is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2026405.
[0005] This invention provides a sessile Ganoderma lucidum strain mycelium, which is the mycelium obtained by culturing the sessile Ganoderma lucidum strain GT1.
[0006] This invention provides a fruiting body of a sessile Ganoderma lucidum strain, which is the fruiting body obtained by cultivating the sessile Ganoderma lucidum strain GT1.
[0007] This invention provides a method for preparing a mother culture of the sessile Ganoderma lucidum strain GT1, comprising the following steps: Prepare PDA slant culture medium at pH 5.6. Sterilize the culture medium at 121℃ for 20 min. After cooling, inoculate with Ganoderma lucidum strain GT1 and incubate at 28℃ for 7 days. After the mycelium has fully grown on the plate, the mother culture of Ganoderma lucidum strain GT1 is obtained.
[0008] Furthermore, the composition of the PDA test tube slant culture medium is as follows: 4.0 g potato extract, 20.0 g glucose, 15.0 g agar powder, pH 5.6. Weigh 39 g of this product, add 1000 mL of distilled water, and boil for 1 minute until completely dissolved.
[0009] This invention provides a method for preparing the original strain of sessile Ganoderma lucidum strain GT1, comprising the following steps: The original culture medium formula is: 98% wheat grains, 2% gypsum, with a moisture content of 60%~65%. After bottling and autoclaving, the culture medium is cooled to room temperature and inoculated into test tubes with the sessile Ganoderma lucidum strain GT1 mother culture. Mycelial culture is carried out in a culture room at 22~26℃ to obtain the sessile Ganoderma lucidum strain GT1 original culture, which is used for the preparation of cultivation varieties.
[0010] Furthermore, the specific bottling operation is as follows: All components of the culture medium are thoroughly mixed, and the medium is manually filled to 2 / 3 full. It is then compacted, leveled, and inverted in a basin of water to clean the bottle mouth. The bottle is then plugged with a pre-made cotton stopper and sealed tightly. After all the medium has been filled, the cotton stopper is covered with two layers of newspaper to prevent water vapor from entering the culture medium under high pressure.
[0011] Furthermore, the specific parameters for the high-pressure sterilization are: GL85SR high-pressure sterilizer, 121℃, 180 min.
[0012] This invention provides a method for preparing a culture of sessile Ganoderma lucidum strain GT1, comprising the following steps: According to the mass percentage, mix 39% of Ganoderma lucidum, 39% of Oasis No. 1, 20% of wheat bran and 2% of gypsum to prepare the cultivation medium. Stir evenly, control the moisture content to 60-65%, then pack into bags, sterilize, cool to room temperature, punch holes, inoculate with the prepared original seed, and after mycelial culture management, Ganoderma lucidum growth management and harvesting, sessile Ganoderma lucidum GT1 is obtained.
[0013] This invention provides a method for cultivating the sessile Ganoderma lucidum strain GT1, comprising the following steps: Inoculate the sessile Ganoderma GT1 into the culture medium for mycelial culture. Maintain an indoor humidity of 55-65%. After 30-40 days, the bags will be fully colonized. Then, manage the fruiting bodies and arrange for harvesting before the spores are released.
[0014] Furthermore, the culture medium is 39% giant reed grass + 39% Oasis No. 1 + 20% wheat bran + 2% gypsum or 39% five-jointed miscanthus + 39% Oasis No. 1 + 20% wheat bran + 2% gypsum or 78% five-jointed miscanthus + 20% wheat bran + 2% gypsum; Furthermore, the dry material / water ratio in the culture medium is 1:1.2.
[0015] This invention provides an application of sessile Ganoderma GT1 in the cultivation and production of sessile Ganoderma.
[0016] Compared with the prior art, the present invention has the following beneficial effects: Using Juncao culture medium to cultivate stalkless Ganoderma GT1 results in rapid mycelial growth, quick emergence of Ganoderma lucidum, high spore production, and high bioconversion rate. Compared with existing Ganoderma lucidum cultivation techniques, the cultivation cycle is shortened, making it suitable for industrialized cultivation.
[0017] Biological Preservation Instructions: Preservation Institution: China Center for Type Culture Collection; Accession number: CCTCC NO: M 2026405; Deposit date: March 9, 2026; Location of collection: Wuhan University, Wuhan, China; Taxonomic nomenclature: Ganoderma lucidum without stalk ( Ganoderma sessile GT1. Attached Figure Description
[0018] Figure 1 This is the original image acquired by GT1 in Example 1.
[0019] Figure 2 The image shown is an electrophoresis detection image from Example 1, where M1: DNA Marker 5000, 1: GT1 amplification product, and +: positive control.
[0020] Figure 3 This is the GT1 evolutionary tree in Example 1.
[0021] Figure 4 The image shows the mycelial growth of Formula 2 in Example 2 after 7 days of inoculation. GT1 is on the left and Ganoderma lucidum 0801 is on the right.
[0022] Figure 5 The image shows mycelial growth 20 days after inoculation of Formula 2 in Example 2, where Ganoderma lucidum 0801 is on the left and GT1 is on the right.
[0023] Figure 6 The morphology and sporulation of the fruiting bodies of GT1 cultivated with Juncao in Formula 2 of Example 2 after maturity.
[0024] Figure 7 The morphology of the mature GT1 fruiting body in Example 2 is shown.
[0025] Figure 8 The fruiting body morphology of GT1 fruiting body in Formula 2 of Example 2 is shown.
[0026] Figure 9 The fruiting body morphology of Ganoderma lucidum 0801 cultivated with fungi and grass in Formula 2 of Example 2. Detailed Implementation
[0027] Example 1 Collection, isolation, domestication, and taxonomic identification of Ganoderma lucidum strain GT1 1. Collection: The fruiting bodies of this Ganoderma lucidum were collected on July 10, 2025, in a mountainous forest area (approximately 380 meters above sea level) in Junkou Town, Jianning County, Fujian Province. Figure 1 As shown, the fruiting body has a glossy, reddish-brown surface and a short stalk.
[0028] 2. Separation and domestication: (1) Strains were isolated to obtain pure mycelia. The collected samples obtained in step 1 were washed with sterile water, dried with clean paper towels, packed in self-sealing bags and stored in a refrigerator at 4°C. The mother culture was prepared within 48 hours (to ensure its viability). The mother culture was prepared by tissue isolation method. First, prepare sterile solid PDA agar plates (4.0 g potato extract, 20.0 g glucose, 15.0 g agar powder, pH 5.6) and test tube slant agar plates. Next, place the agar plates, knives, and other materials in a clean bench and sterilize with ultraviolet light for half an hour. Sterilize the surface of the Ganoderma lucidum fruiting bodies with 75% alcohol. Use a sterile knife to cut a small tissue piece (approximately 0.8 cm × 0.5 cm × 0.3 cm, length × width × height) from the growth ring at the edge of the cap of the Ganoderma lucidum fruiting body. Place this piece in the center of the PDA agar plate and then incubate in a 28℃ constant temperature incubator in the dark for 7-10 days. Observe the growth and contamination of each hyphae every day (hyphae of other colors appearing on the agar plate are considered contamination). Observe the growth of the hyphae and mark the plates with a marker to select strains with strong hyphal growth (hyphae tips extending outwards) and fast growth rate.
[0029] (2) Step-by-step screening: ① Transplantation of test-tube mother culture: After the mycelium on the PDA plate medium has fully grown, take a 0.5cm × 0.5cm mycelial block and transfer it to a fresh, sterile PDA test tube slant medium. Incubate in a 28℃ constant temperature incubator in the dark for 7 days to obtain the test-tube mother culture. Select uncontaminated strains with white mycelium and rapid mycelial growth as the original mother culture.
[0030] ② Preparation of the primary culture medium. Wheat grains were used to prepare the primary culture medium, with a formula of 98% wheat grains + 2% gypsum and a moisture content of 60%~65%. The medium was filled to 2 / 3 full (750mL wide-mouth glass bottle), compacted and leveled, the bottle was washed, tightly sealed with cotton balls, covered with two layers of newspaper, and autoclaved (121℃, 180min). After cooling to room temperature, it was transferred to an inoculation chamber along with the mother culture tubes and inoculation tools. The chamber was sterilized with aerosol (main component sodium dichloroisocyanurate) for half an hour before inoculation. A 1cm section of mycelium was cut from the mother culture tube and transferred to the primary culture medium. Six bottles of primary culture were inoculated from each mother culture tube and placed in a room temperature incubator (22~26℃, 55-65% humidity) for mycelial culture, and the mycelial growth was observed. Three bottles of primary culture with fully grown mycelium were selected and placed in a 28℃ constant temperature incubator (85% humidity) for a mushroom emergence test, and the emergence of mushrooms was observed. Observe and record the primordia emergence time and fruiting body maturation time daily. Select Ganoderma lucidum strains with rapid mycelial growth, large fruiting bodies, and nearly round shapes as the primary strains for cultivation.
[0031] ③ Preparation of Cultivation Spawn: A substrate was prepared using two main cultivation materials: 39% Giant Napier Grass + 39% Oasis No. 1 + 20% Wheat Bran + 2% Gypsum (dry substrate: water = 1:1.2); 39% Miscanthus sinensis + 39% Oasis No. 1 + 20% Wheat Bran + 2% Gypsum (dry substrate: water = 1:1.2); and 78% Miscanthus sinensis + 20% Wheat Bran + 2% Gypsum (dry substrate: water = 1:1.2). The substrate was filled using a bagging machine with polypropylene plastic bags (17cm diameter × 38cm length × 0.06cm thickness), approximately 1.1kg of fresh substrate per bag. The bags were autoclaved at 121℃ for 240 minutes, cooled to room temperature (28℃), and then transferred to an inoculation chamber along with the original spawn and inoculation tools for aerosol sterilization for half an hour before inoculation. The inoculation amount was approximately 7g per bag. After inoculation, the bags were transferred to a mycelium culture room for cultivation. Mycelial growth was observed, and fruiting trials were conducted after the mycelium had fully colonized the bags. Strains with no pollution, rapid mycelial growth, and high bioconversion rate were selected as superior strains. Finally, a strain with rapid mycelial growth and good fruiting body yield was selected and named *Ganoderma lucidum* GT1.
[0032] 3. Taxonomic identification (1) Morphological identification: The fruiting body is nearly round, with a reddish-brown cap surface and concentric grooves on the cap surface. The flesh is pale white, 0.3-0.8 cm thick, sessile or with a short stalk, and the cap size is 5-10 cm × 7-14 cm.
[0033] (2) Molecular biological identification: The strain was cultured on PDA solid medium, and the mycelium was collected after it had grown to full size. It was denatured in 50 uL Lysis Buffer (Code No. 9164) at 80 ℃ for 15 min and then placed at room temperature. The supernatant was centrifuged and used as a template for PCR amplification using ITS universal primers. The corresponding amplified band was obtained and sequenced, yielding a 656bp band.
[0034] (3) Physiological characteristics: saprophytic fungus, suitable for Juncao cultivation. The mycelium grows actively at 24-28 ℃ and the mycelium grows to fill the bag in about 31-38 days.
[0035] The specific molecular biological identification is as follows: Main reagents for the experiment ①Lysis Buffer for Microorganism to Direct PCR (TaKaRa Code No.9164); ② Reagent kit: Fungi Identification PCR Kit (TaKaRa Code No. RR178); Experimental Operation Culture fungi in petri dishes, pick an appropriate amount of bacterial cells, and denature them in 50 μL Lysis Buffer (Code No. 9164) (80 °C, 15 min; place at room temperature). Centrifuge and use the supernatant as a template.
[0036] ①PCR amplification, using the Fungi Identification PCR Kit PCR reaction system: The supernatant of the above denatured bacterial culture…………1 uL ITS Forward Primer (20μM)…………0.5 uL ITS Reverse Primer (20μM)…………0.5 uL PCR Premix…………25 uL dH2O…………23 uL Total…………50 uL.
[0037] Among them, the forward primer (ITS Forward Primer) SEQ ID No. 1: CGCCAGGGTTTTCCCAGTCACGACTCCGTAGGTGAACCTGCGG; Reverse primer (ITS Reverse Primer) SEQ ID No. 2: GAGCGGATAACAATTTCACACAGGTCCTCCGCTTATTGATATGC; PCR Premix ingredients (Brand: Takara, Product Code: 060A): Tks Gflex DNA Polymerase 2×Gflex PCR Buffer (Mg2+, dNTP plus) (Mg2+ concentration 2 mM, dNTP concentration 400 μM each); ②The PCR cycling conditions are shown in Table 1: Table 1 PCR Cycling Conditions
[0038] ③ Electrophoresis detection: 1% agarose gel, electrophoresis conditions: voltage 150V, electrophoresis time 15 minutes.
[0039] The results are as follows Figure 2 As shown: PCR bands are clear, with lane M1 representing DNA Marker 5000. Lane 1 represents the fungal PCR amplification product, with a band size of approximately 656 bp. Lane + represents the positive control.
[0040] ④ Sequencing: The target product was extracted and recovered from the gel using the sequencing primers provided in the kit. The target product was extracted and recovered using the SteadyPure DNA Gel Recovery Kit (brand: Icotry, catalog number AG21005).
[0041] The primer sequences used for sequencing are as follows: Seq Reverse Primer (SEQ ID No.3): 5′-GAGCGGATAACAATTTCACACAGG-3′; Seq Forward Primer (SEQ ID No.4): 5′-CGCCAGGGTTTTCCCAGTCACGAC-3′; Perform first-generation sequencing (Sanger sequencing) using the sequencing primers provided in the kit.
[0042] (4) Experimental Results The sequence obtained from sequencing was BLAST-aligned with the GenBank sequence database, and the result showed a similarity of 99.68% with the Ganodermasessile voucher 281LA.
[0043] The ITS sequence is as follows: SEQ ID No. 5: .
[0044] An phylogenetic tree of strain GT1 was constructed based on ITS sequences, as follows: Figure 3 As shown, strain GT1 was finally identified as Ganoderma lucidum without a stalk.
[0045] Example 2 Juncao Cultivation GT1 Process Optimization Ganoderma GT1 was cultivated using Juncao grass powder as the main raw material, and a cultivation material formula with fast mycelial growth and good fruiting body yield was selected. The Ganoderma 0801 variety, which is routinely cultivated by the National Juncao Engineering Technology Research Center, was used as a control.
[0046] ① Culture medium preparation: After drying the powders of giant reed grass, five-jointed miscanthus, and Oasis No. 1, the powders are processed and pulverized using a special grass pulverizer to obtain giant reed grass powder, five-jointed miscanthus powder, and Oasis No. 1 powder with a coarseness of 3-5mm. At the same time, prepare raw materials such as wheat bran, gypsum, and water, and formulate the cultivation medium according to the formula. Different formulas are set up for Ganoderma lucidum cultivation.
[0047] Formula 1: Giant Napier grass 39% + Oasis No. 1 39% + wheat bran 20% + gypsum 2% (dry feed: water = 1:1.2); Formula 2: 39% five-section mango + 39% Oasis No. 1 + 20% wheat bran + 2% gypsum (dry ingredients: water = 1:1.2); Formula 3: 78% five-section awns + 20% wheat bran + 2% gypsum (mass ratio of dry material to water = 1:1.2).
[0048] Weigh the raw materials according to the formula, mix them evenly, and control the moisture content of the culture medium to about 65% (mix the raw materials according to the ratio of dry material to water = 1:1.2, and the moisture content of the culture medium is about 65%). Use 17cm×38cm polypropylene bags to pack the materials, record the weight of wet material in each bag, attach a label to each bag to mark the serial number, and put on the loop and lid. ② Sterilization: High-pressure sterilization is carried out using a pressure cooker at 121℃ and 0.1MPa for 4 hours (based on existing experience, high-pressure sterilization for 4 hours can completely kill the miscellaneous bacteria in the culture medium). ③ Inoculation: After sterilizing the culture medium for Ganoderma GT1 and Ganoderma 0801 and cooling it to room temperature, transfer it into the inoculation box. At the same time, place the original strains of Ganoderma GT1 and Ganoderma 0801, along with the inoculation tools, into the inoculation box and sterilize them with aerosol for half an hour before starting manual inoculation. Inoculate approximately 10 g of original strain into each bag of culture medium, and inoculate 50 bags of strains into each bottle of original strain. ④ Mycelial Management: After inoculation, transfer the bags to a room temperature incubation room (22~26℃) for mycelial culture. Keep the room clean, well-ventilated and shaded. Use an axial flow fan for ventilation, ventilate twice a day for half an hour each time, and keep the indoor humidity at 55~65%. Observe the mycelial growth every day and remove contaminated bags in time. The mycelium will fully colonize the bags in 30~40 days. ⑤ Management of Fruiting: After the mycelium has fully matured, move the bags into a clean, air-conditioned room. Set the temperature to 28℃ and the humidity to 65%. Open the caps of the bags and place them on the ground. Open the windows for ventilation twice a day for half an hour each time. White primordia will appear in about 7 days. After the primordia appear, move the bags into a smart container (3 meters wide × 3 meters high × 10 meters long) for fruiting. Place each bag in a tiered wire mesh rack. Set the temperature to 28℃, humidity to 92%, carbon dioxide concentration to 0.08%, light intensity to 500 lux, and intelligent ventilation. After 20 days, the white part at the edge of the fruiting body will fade, and brownish-yellow spores will begin to be released. The appearance of spores on the cap of the fruiting body indicates that the fruiting body has matured and should be harvested promptly. ⑥ Harvesting: The cap is reddish-brown in color and its size is 5~10cm×7~14cm. The white edge of the cap disappears. The Ganoderma lucidum fruiting bodies are harvested manually, weighed in time, and the fresh weight of each bag is recorded. They are then placed in a drying oven at 85℃ for 10 days (the moisture content of the dried product is about 4%), processed, packaged, and stored in a dry place indoors.
[0049] ⑦ Spore harvesting: When the Ganoderma lucidum is about to mature (the white edge of the fruiting body turns lighter), cover the base of the stipe with a thin ethylene bag, insert a cardboard tube into the bag, and cover the tube opening with cardboard to form a sealed space to prevent spores from escaping and avoid dust contamination. After the Ganoderma lucidum naturally sprays spores for about a month, manually remove the sleeve and brush the spores off one by one.
[0050] The results are shown in Tables 2 and 3 and Appendix. Figure 4-9 As shown.
[0051] Table 2. Statistical data on mycelial growth and fruiting body growth of Ganoderma lucidum GT1 cultivated with different Juncao formulas.
[0052] It is evident that different Juncao (a type of fungus) formulations resulted in variations in mycelial growth and fruiting body development in Ganoderma GT1. Formulations 2 and 3 showed significantly higher rates of mycelial growth, fruiting body yield, spore production, and biological transformation efficiency compared to formulation 1. Formulation 2 exhibited the highest fruiting body yield and spore production. Overall, formulation 2 is considered the optimal formulation for Ganoderma GT1 cultivation.
[0053] Table 3 Comparison of traits and active ingredients of cultivated Ganoderma lucidum 0801 and GT1 in Formula 2
[0054] Conclusion: The Ganoderma lucidum strain in this invention Ganodermasessile GT1 is suitable for cultivation using Juncao (a type of fungus) as raw material. Among them, the formula of 39% Miscanthus sinensis, 39% Oasis No. 1, 20% wheat bran, and 2% gypsum (dry material: water = 1:1.2) has better cultivation effect, faster mycelial growth, better yield, better biological conversion rate, more spore production, and higher content of active ingredients Ganoderma lucidum polysaccharide and Ganoderma lucidum sterol. It is a good resource for Ganoderma lucidum breeding and has important application value.
[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A sessile Ganoderma lucidum strain ( Ganodermasessile GT1, characterized in that, It is deposited at the China Center for Type Culture Collection, with accession number CCTCC NO: M 2026405.
2. A sessile Ganoderma lucidum mycelium, characterized in that, The mycelium obtained by culturing the sessile Ganoderma lucidum strain GT1 as described in claim 1.
3. A sessile Ganoderma lucidum strain fruiting body, characterized in that, The fruiting body obtained by cultivating the sessile Ganoderma lucidum strain GT1 as described in claim 1.
4. A method for preparing the mother culture of the sessile Ganoderma lucidum strain GT1 according to claim 1, characterized in that, Includes the following steps: Prepare PDA slant culture medium at pH 5.
6. Sterilize the culture medium at 121℃ for 20 min. After cooling, inoculate with the sessile Ganoderma lucidum strain GT1 and incubate in a constant temperature incubator at 28℃ for 7 days. After the mycelium has fully grown on the plate, the sessile Ganoderma lucidum strain GT1 mother culture is obtained.
5. The method according to claim 4, characterized in that, The composition of the PDA test tube slant culture medium is as follows: 20 g / L glucose, 200 g peeled potato juice (boiled and filtered), 15 g / L agar powder, and distilled water to a final volume of 1000 mL.
6. A method for preparing the original strain of the sessile Ganoderma lucidum strain GT1 according to claim 1, characterized in that, Includes the following steps: Original culture medium formula: 98% wheat grains, 2% gypsum, moisture content 60%~65%, mix well, bottle, autoclave, cool to room temperature, inoculate test tubes with sessile Ganoderma lucidum strain GT1 mother culture, culture mycelium in a 22~26℃ culture room to obtain sessile Ganoderma lucidum strain GT1 original culture, which is used for the preparation of cultivation spawn. The specific bottling operation is as follows: All components of the culture medium are thoroughly mixed, and the medium is manually filled to 2 / 3 full. It is then compacted, leveled, and inverted in a basin of water to clean the bottle opening. A pre-made cotton plug is then inserted and tightened. After all the medium has been filled, two layers of newspaper are used to cover the cotton plug to prevent water vapor from entering the culture medium under high pressure. The specific parameters for the high-pressure sterilization are: GL85SR high-pressure sterilizer, 121℃, 180 min.
7. A method for preparing a cultivar of the sessile Ganoderma lucidum strain GT1 according to claim 1, characterized in that, Includes the following steps: According to the mass percentage, mix 39% of Ganoderma lucidum, 39% of Oasis No. 1, 20% of wheat bran and 2% of gypsum to prepare the cultivation medium. Stir evenly, control the moisture content to 60-65%, then pack into bags, sterilize, cool to room temperature, punch holes, inoculate with the prepared original seed, and after mycelial culture management, Ganoderma lucidum growth management and harvesting, sessile Ganoderma lucidum GT1 is obtained.
8. A method for cultivating the sessile Ganoderma lucidum strain GT1 as described in claim 1, characterized in that, Includes the following steps: The sessile Ganoderma GT1 described in claim 7 is inoculated into a culture medium for mycelial culture. The indoor humidity is 55-65%. The mycelium fills the bag in 30-40 days. The mycelium is then managed for fruiting. The fruiting bodies are harvested before the spores are fired.
9. The method according to claim 8, characterized in that, The culture medium is 39% giant reed grass + 39% Oasis No. 1 + 20% wheat bran + 2% gypsum or 39% five-jointed miscanthus + 39% Oasis No. 1 + 20% wheat bran + 2% gypsum or 78% five-jointed miscanthus + 20% wheat bran + 2% gypsum; The dry material / water ratio in the culture medium is 1:1.
2.
10. The application of the sessile Ganoderma GT1 as described in claim 1 in the cultivation and production of sessile Ganoderma.