Application of cotton GhGG3 gene in regulating compact plant type of cotton

Abstract

The application relates to application of a cotton GhGG3 gene in regulation of a compact cotton plant type, and for the first time, a heterotrimeric G protein gamma subunit GhGG3 is identified in cotton to participate in regulation of cotton plant type, fruit branch length, boll spacing and the like excellent traits, and the gene has important value for analyzing a molecular mechanism of shortening of the cotton fruit branch length and the boll spacing and the like theoretical research. The application can change the cotton plant type, so as to create a compact cotton breeding material, and has important practical application value for cotton plant type improvement.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of the cotton GhGG3 gene in regulating the compact plant type of cotton. Background Technology

[0002] Cotton is an important fiber and oilseed crop worldwide, and one of my country's key economic crops. It is not only a vital source of natural fiber for the textile industry, but also has significant applications in edible oil, national defense, medicine, and the automotive industry, playing a crucial role in national economic development and serving as a vital strategic resource related to the national economy and people's livelihood. Plant type is a crucial agronomic trait of cotton, determining its adaptability to cultivation, harvest index, and potential yield. It directly affects the light energy utilization efficiency and final yield of cotton plants, and also significantly impacts planting costs and mechanized harvesting.

[0003] To achieve high-yield and efficient cultivation and management models, cultivating high-yield populations with high planting density, uniform distribution, and consistent growth patterns, and making full use of sunlight during the early and middle stages of cotton growth, is one of the important ways to promote early maturity and high yield in cotton. On the other hand, mechanized harvesting of cotton has become an inevitable path for the sustainable development of the cotton industry. The breeding of new cotton varieties suitable for mechanized harvesting needs to focus on plant type breeding while taking into account yield, quality, early maturity, and resistance. This shows the importance of plant type selection.

[0004] The plant type of cotton is determined by traits such as fruiting branch type, internode length, and fruiting branch angle, among which fruiting branch type has the greatest impact. The plant type can be evaluated using seven indicators: plant height, number of fruiting branches, height of the first node of the fruiting branch, length of the fruiting branch, number of nodes on the fruiting branch, fruiting branch angle, and boll opening rate. The most important method for increasing cotton planting density is to improve the plant type. However, improving cotton plant type using traditional breeding methods is very difficult. Nevertheless, with the rapid development of biotechnology, shortening the breeding cycle and targeted genetic improvement have become possible. Discovering genes related to plant type regulation and creating cotton materials with moderate height and compact plant type through genetic engineering technology is a rapid and effective strategy to accelerate cotton plant type breeding improvement. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the cotton gene GhGG3 in regulating cotton plant architecture, which solves the problems encountered in the existing technology of breeding cotton varieties with compact plant architecture and suitable mechanical harvesting characteristics.

[0006] This invention created a loss-of-function GhGG3 mutant of upland cotton through CIRSPR-Cas9-mediated gene editing. Phenotypic studies of different edited lines of the mutant revealed that, compared with the wild type, the mutant exhibited superior traits such as compact plant growth, shortened internode length on the main stem, shortened fruiting branch length in different locations, and shortened spacing between bolls, without affecting yield traits and major fiber quality traits. This indicates that this gene or its encoded protein plays an important role in controlling cotton plant architecture.

[0007] This invention provides a GhGG3 gene that regulates compact cotton plant architecture. Its genomic nucleotide sequence is shown in SEQ ID NO:1, its CDS sequence is shown in SEQ ID NO:2, and its encoded amino acid sequence is shown in SEQ ID NO:3. It should be understood that, considering the gene expression regulatory region and codon degeneracy, modifications to the GhGG3 gene sequence without altering the amino acid sequence are also within the scope of this invention.

[0008] This invention provides the GhGG3 gene, and the application of its expression cassette, expression vector, or recombinant microorganism in any of the following A1)-A6):

[0009] A1) Regulating cotton plant architecture;

[0010] A2) Preparation of products that regulate cotton plant type;

[0011] A3) Regulate cotton fruiting branch length, fruiting node spacing, plant width, fruiting branch angle, main stem spacing, and average fiber length in the upper half;

[0012] A4) Prepare products that regulate cotton fruit branch length, fruit node spacing, plant width, fruit branch angle, main stem spacing, and average fiber length in the upper half.

[0013] A5) Develop cotton varieties with compact plant types;

[0014] A6) Cotton breeding;

[0015] The amino acid sequence encoded by the gene is shown in SEQ ID NO:3.

[0016] Furthermore, the nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO:1, and its coding region sequence is shown in SEQ ID NO:2.

[0017] Furthermore, knocking out the GhGG3 gene in cotton resulted in cotton exhibiting a compact plant type phenotype.

[0018] Furthermore, using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector for the GhGG3 gene was constructed and transformed into cotton plants, thereby obtaining cotton plants with a stable genetic deletion of the GhGG3 gene.

[0019] Furthermore, the sgRNA sequence in the CRISPR / Cas9 gene editing vector is shown in SEQ ID NO:4 and / or SEQ ID NO:5.

[0020] Furthermore, the cotton exhibits a phenotype characterized by shortened fruiting branch length, shortened fruiting node spacing, reduced plant width, smaller fruiting branch angle, shortened main stem spacing, and increased average fiber length in the upper half.

[0021] The present invention also provides a method for cultivating a compact cotton variety by knocking out the GhGG3 gene in cotton, thereby causing the cotton to exhibit a compact plant phenotype. The amino acid sequence encoded by the GhGG3 gene is shown in SEQ ID NO:3.

[0022] Furthermore, the nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO.1, and its coding region sequence is shown in SEQ ID NO:2.

[0023] Furthermore, using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector for the GhGG3 gene was constructed and transformed into cotton plants, thereby obtaining cotton plants with a stable genetic deletion of the GhGG3 gene.

[0024] Furthermore, the target sequence of the CRISPR / Cas9 gene editing vector is shown in SEQ ID NO:4 and / or SEQ ID NO:5.

[0025] The beneficial effects of this invention are as follows: This invention is the first to identify the heterotrimeric G protein γ subunit GhGG3 in cotton, which participates in the regulation of desirable traits such as cotton plant architecture, fruiting branch length, and boll spacing. This gene is of significant value for theoretical research on elucidating the molecular mechanisms underlying the shortening of cotton fruiting branch length and boll spacing. This invention can alter cotton plant architecture to create compact cotton breeding materials, and has important practical application value for cotton plant architecture improvement. Attached Figure Description

[0026] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 A schematic diagram of the GhGG3 gene structure and the two gene editing sites, sgRNA1 and sgRNA2;

[0028] Figure 2 Effects of GhGG3 gene knockout on cotton plant architecture traits. A: Compact plant architecture phenotype of GhGG3 gene knockout lines; B: Sequencing results of the GhGG3 gene knockout target site; C: Fruiting branch length data of GhGG3 gene knockout lines; D: Fruiting node length data of GhGG3 gene knockout lines, showing that the length of fruiting branches and fruiting nodes in gene-edited plants are significantly shorter.

[0029] Figure 3 The effect of GhGG3 gene knockout on boll spacing in cotton; A: Phenotypic diagram of boll spacing in GhGG3 gene knockout lines and WT; B: Results of the investigation on boll spacing in GhGG3 gene knockout lines, showing that compared with WT, the boll spacing in GhGG3 knockout lines is significantly reduced.

[0030] Figure 4 Plant architecture phenotype of GhGG3 gene overexpression. A: The plant architecture of GhGG3 gene overexpression lines showed no significant change compared to WT; B: Examination of fruit branch length, plant width, fruit branch angle, main stem spacing, and boll spacing of GhGG3 gene overexpression lines revealed no significant changes compared to WT. Detailed Implementation

[0031] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0032] Example 1: Cloning of the cotton GhGG3 gene

[0033] Based on the published GhGG3 gene sequence in the tetraploid upland cotton genome, primers were designed to isolate the gDNA sequence of this gene from leaves of the recipient variety, upland cotton Jin668. After amplification, sequencing, and sequence alignment, the obtained sequence was 100% homologous to sequences in the genome database. Cotton is an allotetraploid, and the GhGG3 gene is located on chromosome A13 of upland cotton, containing 5 exons and 6 introns. Figure 1The genomic nucleotide sequence is shown in SEQ ID NO:1, with a full length of 2829 bp; the nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO:2, and the amino acid sequence it encodes is shown in SEQ ID NO:3. The full length of the cDNA is 1185 bp, encoding 394 amino acids.

[0034] Example 2: Two sgRNAs were designed in the exon region of the GhGG3 gene to construct a gene editing vector.

[0035] (1) Vector construction: Gene editing sites were designed based on the genome sequence (SEQ ID NO:1) and CDS sequence (SEQ ID NO:2) of GhGG3; CRISPR / Cas9 sgRNA1 was designed at its first exon, with the sequence: 5'TGATTTGTATGGGAAACGAA 3' (SEQ ID NO.4); CRISPR / Cas9 sgRNA2 was designed at its second exon (at the junction of intron and exon), with the sequence: 5'CGAGCAGGAAGAGTTAAAAT 3' (SEQ ID NO:5). Primers were designed based on the target sequence to construct the CRISPR vector for the GhGG3 gene. The specific primer sequences are as follows: cGG3-1as: 5'TTCGTTTCCCATACAAATCAtgcaccagccgggaat 3' (SEQ ID NO:6); cGG3-1s: 5'TGATTTGTATGGGAAACGAAgttttagagctagaaata 3' (SEQ ID NO:7); cGG3-2as: 5'ATTTTAACTCTTCCTGCTCGtgcaccagccgggaat 3' (SEQ ID NO:8); inf cGG3-2as: 5'ttctagctctaaaacATTTTAACTCTTCCTGCTCG 3' (SEQ ID NO:9).

[0036] First, the GhGG3-gRNA sequence driven by the GhU6.7 promoter was obtained using overlapping PCR (where lowercase parts are vector sequences; underlined parts are tRNA; italicized parts are gRNA; and bolded parts are sgRNA):

[0037]

[0038] The vector was ligated into the pRGEB32-GhU6.7 vector using T4 DNA ligase, and the vector plasmid was then transferred into Agrobacterium strain GV3101 by electroporation to obtain the GhGG3 gene knockout vector.

[0039] (2) Agrobacterium-mediated genetic transformation of cotton:

[0040] A. Aseptic seedling culture: Select plump and normally developed seeds (Jin668 variety), peel off the cottonseed seed coat, soak in 2% sodium hypochlorite solution for 10 minutes, rinse with sterile water more than 3 times, inoculate on aseptic seedling culture medium, and after the seeds show white sprouts, insert the roots into the culture medium to support the seedlings, seal the opening and place in a 28℃ dark constant temperature incubator for 5-6 days.

[0041] B. Remove the hypocotyl and cut it into small segments (0.5-0.7cm). Infect the segments with activated Agrobacterium containing the GhGG3 knockout vector for 3-5 minutes. Discard the bacterial solution and place the segments in a sterile dish with filter paper to air dry. Spread the hypocotyls flat on a co-culture medium (MS medium + 2,4-D 0.1mg / L + KT 0.1mg / L + 30g / L glucose + 2.6g / L Phytagel, pH: 5.85-5.95) with filter paper and incubate in the dark at 20℃ for 36-48 hours.

[0042] C. Obtaining regenerated material: Infected hypocotyls were inoculated into DK callus induction medium (MS medium + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 30 g / L glucose + 2.6 g / L Phytagel + kanamycin 50 mg / L + cephalosporin 400 mg / L, pH: 5.85–5.95). The culture was carried out at 28°C in a light-controlled culture chamber (16 h light + 8 h dark), and subcultured every 20–30 days using fresh callus induction medium.

[0043] D. When the callus tissue grows into rice-grain-sized granules, it is transferred to differentiation medium (MS medium + IBA 0.5 mg / L + KT 0.1 mg / L + glutamine 1.0 g / L + asparagine 0.5 g / L + 30 g / L glucose + 2.6 g / L Phytagel, pH: 6.1~6.2) to further differentiate into embryoids.

[0044] E. The differentiated seedlings are subcultured on rooting medium (1 / 2 MS medium + 15 g / L glucose + 2.6 g / L Phytagel, pH: 6.1-6.2) until they grow into well-rooted seedlings.

[0045] (3) Identification and phenotype of GhGG3 knockout progeny:

[0046] For the 12 independently transformed transgenic positive cotton lines, DNA was extracted from the leaves of T0 and T1 generation transgenic positive plants using the CTAB method. Primers (SEQ ID NO.11: 5'-ggagtgagtacggtgtgcTTCGTCGGTCCCGACTCT-3'; SEQ ID NO.12: R: 5'-gagttggatgctggatggAGGAAACTAATTTCTCTTTCAAGCA-3') were designed to amplify the GhGG3 gene sequence by PCR. Hi-TOM sequencing was used to screen for homozygous mutants of the GhGG3 gene knockout, GhGG3_KO-1 to KO-6, for field phenotypic identification. After cotton harvest, the fruiting branch length, internode spacing, and boll spacing of the above GhGG3 gene knockout lines GhGG3_KO-1 to KO-6, wild-type Jin668, and negative control plants were measured and statistically analyzed. The results are shown in [Figure 1]. Figure 2 and Figure 3 .Depend on Figure 2 It can be seen that the fruit branch length and fruit node spacing of the GhGG3 gene knockout line were significantly lower than those of the wild type and negative control plants; Figure 3 To obtain magnified images of boll spacing and phenotypic data for cotton lines with the GhGG3 gene knocked out, by Figure 3 It was found that knocking out the GhGG3 gene significantly reduced boll spacing compared to WT. Further field investigations of the main agronomic traits of the three high-generation knockout lines yielded the results shown in Table 1. The investigated yield traits (single boll weight, lint percentage) and five fiber quality traits (i.e., average upper half fiber length, fiber uniformity, micronaire value, breaking strength, and elongation) showed no significant differences compared to the transgenic recipient, except for a decrease in fruiting branch length and an increase in average upper half fiber length. This indicates that knocking out the GhGG3 gene can directionally shorten cotton fruiting branch length without affecting cotton yield and fiber quality traits.

[0047] Table 1. Phenotypic characteristics of major agronomic traits in GhGG3 gene knockout plants

[0048]

[0049] Example 3: Overexpression of the GhGG3 gene in cotton

[0050] (1) Construction of overexpression vector

[0051] A pair of primers was designed based on the coding sequence of the GhGG3 gene (SEQ ID NO.13: GG3-BP-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGCTGCCAGGTCCG G-3'; SEQ ID NO.14: GG3-BP-R: 5'-GGGGACCACTTTGTACAAGAAAGCT GGGTGTTAGAAAAATAGGCAGCAAGGATTA-3'). The GhGG3 sequence in Jin668 was amplified using these primers. The product was detected by agarose gel electrophoresis. The recovered target product was ligated into the overexpression vector pK2GWT7. The recombinant plasmid with correct sequencing was named pK2GWT7-GG3. The recombinant plasmid was transformed into GV3101 Agrobacterium competent cells for transformation of the cotton transgenic recipient Jin668.

[0052] (2) Genetic transformation

[0053] The genetic transformation method is the same as in Example 2.

[0054] (3) Identification and phenotype of GhGG3 overexpression progeny

[0055] For the 10 independently transformed transgenic positive cotton lines, DNA was extracted from the leaves of T0 and T1 generation transgenic positive plants using the CTAB method. The 35S promoter and GhGG3 gene sequence were amplified by PCR using primers (SEQ ID NO.13, SEQ ID NO.14). Sanger sequencing was then used to screen for homozygous mutants GhGG3_OE-1 to OE-5 containing the GhGG3 overexpression element for field phenotypic identification. After cotton harvest, the fruiting branch length, boll spacing, and other traits of GhGG3_OE-1 to OE-5 and wild-type Jin668 plants were measured and statistically analyzed. The results are shown in […]. Figure 4 .Depend on Figure 4 It can be seen that the fruit branch length, boll spacing and other traits of the strains overexpressing the GhGG3 gene did not change significantly compared with the wild-type control plants.

[0056] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. Application of GhGG3 gene knockout in any of the following: A1) Negatively regulates cotton fruiting branch length, fruiting node spacing, and boll spacing, and positively regulates the average fiber length trait in the upper half; A2) Prepare products that negatively regulate cotton fruit branch length, fruit node spacing, and boll spacing, and positively regulate the average fiber length trait in the upper half; A3) Develop cotton varieties with compact plant types; The amino acid sequence encoded by the GhGG3 gene is shown in SEQ ID NO:

3.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO:1, and its coding region sequence is shown in SEQ ID NO:

2.

3. The application according to claim 1, characterized in that, Using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector for the GhGG3 gene was constructed and transformed into cotton plants to obtain cotton plants with a stable genetic deletion of the GhGG3 gene.

4. The application according to claim 3, characterized in that, The sgRNA sequence in the CRISPR / Cas9 gene editing vector is shown in SEQ ID NO:4 and / or SEQ ID NO:

5.

5. The application according to claim 3, characterized in that, The cotton exhibits a phenotype characterized by shortened fruiting branch length, shortened internode spacing, reduced boll spacing, and increased average fiber length in the upper half.

6. A method for cultivating a compact cotton variety, characterized in that, Knocking out the GhGG3 gene in cotton causes the cotton to exhibit a compact plant phenotype. The amino acid sequence encoded by the GhGG3 gene is shown in SEQ ID NO:

3. The compact plant phenotype is characterized by shortened fruiting branch length, shortened fruiting node spacing, and reduced boll spacing.

7. The method according to claim 6, characterized in that, The nucleotide sequence of the GhGG3 gene is shown in SEQ ID NO.1, and its coding region sequence is shown in SEQ ID NO:

2.

8. The method according to claim 6, characterized in that, Using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector for the GhGG3 gene was constructed and transformed into cotton plants to obtain cotton plants with a stable genetic deletion of the GhGG3 gene.

9. The method according to claim 8, characterized in that, The target sequences of the CRISPR / Cas9 gene editing vector are shown in SEQ ID NO:4 and / or SEQ ID NO:5.

Images