SNP Molecular Markers Related to Immune Traits of Yaks and Their Applications

Abstract

The present invention relates to the field of molecular biology detection technologies, and particularly to SNP molecular markers related to the immune traits of yaks and their applications. The present invention screens out SNP molecular markers related to the immune traits of yaks, which are located at position 55577127 on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is G or A. The present invention can obtain the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M of yak individuals by using this SNP molecular marker, providing a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and providing a basis for breeding yaks with high immunity.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and particularly relates to SNP molecular markers related to yak immune traits and their applications. Background Art

[0002] In yak breeding, diseases pose a serious threat to their health and cause economic losses. Although certain diseases can be prevented through improved feeding management and the use of drugs and vaccines, these measures have not effectively controlled the spread of infectious diseases. At the same time, the widespread use of drugs may lead to the development of drug resistance, which in turn affects the safety of livestock products.

[0003] In the long run, based on the research of the genetic basis of disease resistance, screening for disease-resistant genes and conducting disease-resistant breeding at the molecular level to enhance the resistance and immunity of yaks to pathogens is an important path to fundamentally solve this problem. The potential economic benefits of disease-resistant breeding and its prospects in the research of animal models for human diseases are driving the development of this field. With the progress of molecular biology, molecular genetics, and genetic engineering technologies, disease-resistant breeding has played an increasingly important role in yak breeding.

[0004] Yaks live in high-altitude areas and face harsh environmental conditions, which require them to have stronger disease resistance to adapt to environmental pressures such as high altitude, low air pressure, strong ultraviolet rays, hypoxia, and nutritional deficiencies. Therefore, improving the disease resistance of yaks is crucial for enhancing their adaptability.

[0005] Immune indicators are important bases for reflecting the disease resistance of animals and mainly depend on the health status and function of the immune system. The immune system is responsible for recognizing and eliminating pathogens that invade the body, such as bacteria and viruses. When pathogens invade, the immune system will quickly respond and initiate a series of immune responses to resist and eliminate the pathogens. Immune indicators usually include various parameters such as antibody levels, immune cell numbers, inflammatory indicators, and cytokines. Antibodies are produced by B cells and are specific, capable of effectively binding and neutralizing pathogens, thereby enhancing the efficiency of the overall immune response. In addition, the number and function of immune cells are important indicators for evaluating the health status of the immune system. When encountering pathogen invasion, immune cells will be quickly activated and start to proliferate to enhance the ability to respond to infections. At the same time, the levels of inflammatory indicators and cytokines also reflect the response state of the immune system, helping to monitor and regulate the intensity and duration of the immune response to ensure that the immune system can effectively respond to challenges and maintain overall health.

[0006] Therefore, immune indicators can be used as important references for evaluating the disease resistance and health status of animals. By monitoring changes in immune indicators, immune problems in animals can be identified in a timely manner, and corresponding measures can be taken to improve their disease resistance and prevent and treat diseases.

[0007] Searching for variation sites related to disease resistance at the gene level, conducting association analysis using genetics and genetic engineering techniques to discover the relationship between genes and traits, and performing early selection will greatly improve the efficiency and accuracy of seed selection and have broad application prospects. Summary of the Invention

[0008] The object of the present invention is to provide SNP molecular markers related to yak immune traits and their applications.

[0009] To achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0010] The present invention provides an SNP molecular marker related to yak immune traits, and the SNP molecular marker is located at the 55,577,127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutated base is G or A.

[0011] Preferably, the yak genotype with the mutated base G is GG or GA; the yak genotype with the mutated base A is AA; the content of immunoglobulin A in yak individuals with genotypes AA and GA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin G in yak individuals with genotype AA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin M in yak individuals with genotype AA is significantly higher than that in yak individuals with genotypes GA and GG; the content of immunoglobulin M in yak individuals with genotype GA is significantly higher than that in yak individuals with genotype GG.

[0012] The present invention provides the application of the above-mentioned SNP molecular marker in the preparation of products for detecting yak immunity or products for yak assisted breeding.

[0013] The present invention provides a primer pair for amplifying the SNP molecular marker described in the claims, and the sequences of the primer pair are shown as SEQ ID NO: 1-2.

[0014] The present invention provides the application of the above-mentioned primer pair in the preparation of products for detecting yak immunity or products for yak assisted breeding.

[0015] The present invention provides a kit for detecting yak immunity, including reagents for detecting the above-mentioned SNP molecular marker or the above-mentioned primer pair.

[0016] The present invention provides a kit for yak assisted breeding, including reagents for detecting the above-mentioned SNP molecular marker or the above-mentioned primer pair.

[0017] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0018] (1) Extract yak genomic DNA;

[0019] (2) Using the yak genomic DNA obtained in step (1) as a template, amplify using the primer pair to obtain an amplification product;

[0020] (3) Perform genotype analysis on the amplification product to obtain yaks with different genotypes; associate the genotype of the yak with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M.

[0021] Preferably, the amplification system in step (2) is a total of 25 μL, including 12.5 μL of 2×L-Exp Taq MasterMix (dye plus), 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0022] Preferably, the amplification program in step (2) is: 94 °C for 1 min, 98 °C for 10 s, 58 °C for 30 s, 72 °C for 1 min, for a total of 35 cycles; extension at 72 °C for 2 min.

[0023] By adopting the above technical solution, the present invention has the following beneficial effects:

[0024] The present invention provides SNP molecular markers related to yak immune traits and their roles in breeding. Through research, the present invention finds that the SNP locus related to yak immunity is located at the 55,577,127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, the variation type is G / A, and there are 3 genotypes. When the 55,577,127th base on chromosome 22 is G, the genotype is GG or GA; when the 55,577,127th base on chromosome 22 is A, the genotype is AA.

[0025] Through the correlation analysis of different genotypes with the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it was found that the content of immunoglobulin A in yak individuals with genotypes AA and GA was significantly higher than that in yak individuals with genotype GG (p<0.05); the content of immunoglobulin G in yak individuals with genotype AA was significantly higher than that in yak individuals with genotype GG (p<0.05); the content of immunoglobulin M in yak individuals with genotype AA was significantly higher than that in yak individuals with genotypes GA and GG (p<0.05); the content of immunoglobulin M in yak individuals with genotype GA was significantly higher than that in yak individuals with genotype GG (p<0.05).

[0026] By detecting the bases at the 55,577,127th nucleotide site on chromosome 22 of the yak, the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M in yak individuals can be obtained. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, providing a basis for breeding yaks with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0028] Figure 1 Is the PCR amplification product: where M represents Marker; 1, 2, and 3 represent 3 groups of replicates;

[0029] Figure 2 Is the peak map and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] The present invention provides an SNP molecular marker related to yak immune traits. The SNP molecular marker is located at the 55,577,127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A.

[0031] In the present invention, the yak genotype with a mutant base of G is GG or GA; the yak genotype with a mutant base of A is AA; the content of immunoglobulin A in yak individuals with genotypes AA and GA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin G in yak individuals with genotype AA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin M in yak individuals with genotype AA is significantly higher than that in yak individuals with genotypes GA and GG; the content of immunoglobulin M in yak individuals with genotype GA is significantly higher than that in yak individuals with genotype GG.

[0032] The present invention also provides the application of the SNP molecular marker as described above in the preparation of products for detecting yak immunity or products for yak assisted breeding.

[0033] The present invention also provides a primer pair for amplifying the SNP molecular marker as claimed, and the sequences of the primer pair are shown as SEQ ID NO:1 to 2.

[0034] In the present invention, the sequence SEQ ID NO:1 in the primer pair is the upstream primer, and the specific sequence is 5'-CCTCCCCATAAACAGAACCTGG-3'; the sequence SEQ ID NO:2 in the primer pair is the downstream primer, and the specific sequence is 5'-ACAAGTAAGGAAATAGTCCCCAAAT-3'.

[0035] The present invention provides the application of the primer pair as described above in the preparation of products for detecting yak immunity or products for yak assisted breeding.

[0036] The present invention provides a kit for detecting yak immunity, which includes reagents for detecting the SNP molecular marker as described above or the primer pair.

[0037] The present invention provides a kit for yak assisted breeding, which includes reagents for detecting the SNP molecular marker as described above or the primer pair.

[0038] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, including the following steps:

[0039] (1) Extract yak genomic DNA;

[0040] (2) Using the yak genomic DNA obtained in step (1) as a template, amplify with the primer pair to obtain an amplification product;

[0041] (3) Genotype analysis is performed on the amplified product to obtain yaks of different genotypes; the genotype of the yak is associated with the immune index; the immune index is one or more of immunoglobulin A, immunoglobulin G, and immunoglobulin M.

[0042] In the present invention, the amplification system described in step (2) is a total of 25 μL, including 12.5 μL of 2×L-Exp Taq MasterMix (dye plus), 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0043] In the present invention, the amplification program described in step (2) is as follows: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0044] The technical solutions provided by the present invention are described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0045] Example 1

[0046] 1 Sample collection

[0047] The present invention uses the Nyainrong yak breed as the detection object. 5 mL of fasting yak blood samples were collected from a pasture in Jiali County, Nagqu City, Tibet Autonomous Region, and placed in a clean coagulant vacuum blood collection tube. After standing for 30 min, they were centrifuged at 3500 r / min for 10 min, and the supernatant was aspirated into a PE tube, sealed, and stored in a -20°C low-temperature refrigerator; another 5 mL of blood sample was added to a blood collection tube containing EDTA-K2 anticoagulant. After the blood sample collection was completed, it was quickly mixed evenly, placed in a sampling box with ice packs for temporary storage, and frozen in a -20°C refrigerator after being transported back to the laboratory for DNA extraction.

[0048] 2 Main reagents and instruments

[0049] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Nano Drop 2000 spectrophotometers were from Thermo Fisher Scientific Company, USA; DL2000 Marker, agarose, and nucleic acid dyes were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikery Bioengineering Co., Ltd.; electrophoresis apparatuses were purchased from Beijing Liuyi Instrument Factory; PCR apparatuses were purchased from BioRad Company. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme-linked Biotechnology Co., Ltd.

[0050] 3 Methods

[0051] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0052] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0053] 3.2 Extraction of genomic DNA from blood

[0054] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0055] 3.3 Primer design

[0056] With reference to the gene sequence of chromosome 22 of the yak genome LU_Bosgru_v3.0 version (Ensemble accession number: ENSBGRG00000014471), the Pick Primers online tool provided by the NCBI website was used to design specific primers, including the g55577127G>A SNP site.

[0057] Primer sequences

[0058] F: 5’-CCTCCCCATAAACAGAACCTGG-3’ (SEQ ID NO:1);

[0059] R: 5’-ACAAGTAAGGAAATAGTCCCCAAAT-3’ (SEQ ID NO:2).

[0060] The amplified fragment length is 485 bp, and the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0061] 3.4 PCR Amplification and Sequencing

[0062] The PCR amplification system was 25 μL: 12.5 μL of 2×L-Exp Taq MasterMix (dye plus), 8.5 μL of RNase free water, 1 μL of forward primer, 1 μL of reverse primer, and 2 μL of template.

[0063] The PCR amplification program was: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; 72°C for extension for 2 min.

[0064] The PCR products were detected by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, direct sequencing was used for sequencing, which was completed by Beijing Tsingke Biotechnology Co., Ltd. The results of the agarose gel electrophoresis are shown as Figure 1 shown. Figure 1 The results showed that the length of the sequence obtained by PCR amplification was 485 bp. Through sequencing, a G / A mutation occurred at the 144th nucleotide sequence of the amplified product (at the 55,577,127th base on chromosome 22 of the genome LU_Bosgru_v3.0 version). The amplified product band was clear without miscellaneous bands, and the specificity was good.

[0065] This site was preliminarily identified as a SNP marker site of yaks, named g55577127G>A SNP. The sequence obtained by PCR amplification was as shown in SEQ ID NO:3, and the 144th position of this sequence was a G mutation. The fragment size of the PCR amplification product was consistent with the expected size, and the next experiment could be carried out.

[0066] SEQ ID NO:3

[0067] CCTCCCCATAAACAGAACCTGGCTGTGCTTGGGGTGGCCATGTGCCCAGCACAGAAAACTCATCTCCCAGCCACCCCTGTGACTGGGGTGGCCACGTGACATGGTTCTGGTTAACAAGATGTACAAGGAAAATGCTGAATGGAG CTTCAGAAGAGCACTTTAAAAGGCGGTCAGGACTGTTATCTTTCTTCTTCTTACTGCCTGGTATGCAGCTACAGTGTTGCAAGTGGAAACCAAGAAGCAATGTGTATGAAGCAGTGTTGAGTAGAAAGACAGAAGGAACTGGGTTTCTGGGCACTGTGTAGTTAACTTAGCTGTTCTGGAATGTCCACT TCAAGATTTGTTATTAGAAAAGAAAACTCAAAGCCTCGTTAGGATCAGCTACTAAAAGCTGCCCTTTGTGTTACATGCAGCCAAACACATTCCTAATTGGTTTTTAAAAAATTTCTTCCACCAATTTATTTGGGGACTATTTCCTTACTTGT

[0068] The sequencing results of the PCR products were aligned using the bioinformatics software MEGA 11.0, the sequencing peak maps were analyzed, and genotyping was completed.

[0069] 4 Statistical analysis

[0070] According to the gene typing results, the number of individuals with different genotypes at each locus was counted. The Popgen32 software was used to calculate the gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test of the g55577127G>A gene. The polymorphic information content was calculated using the PIC (polymorphism information content) calculation software. The general linear model in the IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM. The results were expressed as "mean ± standard error".

[0071] 5 Results

[0072] 5.1 PCR amplification and sequencing results

[0073] The amplification products of the g55577127G>A SNP locus on chromosome 22 of yaks were detected using 1% agarose gel (see Figure 1 ). The bands were clear without background bands, and the specificity was good. The size of the PCR product fragment was 485 bp, which was consistent with the expected size, and the next experiment could be carried out.

[0074] The peak maps and sequences obtained after purification and sequencing of the PCR products are shown in Figure 2 . From Figure 2It can be seen that a G-A mutation occurred at the g55577127G>A SNP locus, and there are three genotypes: GG, GA, and AA.

[0075] 5.2 Statistical analysis results

[0076] From the perspective of population genetics, the genotypes and allele frequencies of the g55577127G>A SNP locus on chromosome 22 of yaks were analyzed. As shown in Table 1, at the g55577127G>A SNP locus, the GG genotype frequency was the highest, being the dominant genotype, and the G allele frequency was 73.4%, showing a dominant allele. By χ 2 The fitness test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.390, and the PIC was 0.314. Since 0.25<PIC<0.50, it belongs to moderate polymorphism.

[0077] Table 1 Polymorphism of the g55577127G>A SNP locus on chromosome 22 of yaks

[0078]

[0079]

[0080] 5.3 Association analysis of different genotypes with immunoglobulins IgA, IgG, and IgM

[0081] The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the IgA content of yak individuals with AA and GA genotypes was significantly higher than that of GG genotype individuals (p<0.05), the IgG content of yak individuals with AA genotype was significantly higher than that of GG genotype individuals (p<0.05), there was no significant difference in the IgA and IgG contents between AA and GA genotype individuals (p>0.05), and there was also no significant difference between GA and AA genotype yak individuals (p>0.05). The IgM content of yak individuals with AA genotype was significantly higher than that of GA and GG genotype individuals (p<0.05), and the IgM content of yak individuals with GA genotype was significantly higher than that of GG genotype individuals (p<0.05). This indicates that the bases at the g55577127G>A SNP locus on chromosome 22 of yaks are significantly correlated with yak IgA, IgG, and IgM, and are SNP markers related to yak IgA, IgG, and IgM. The results are shown in Table 2.

[0082] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, IgM

[0083]

[0084] Note: Different lowercase letters marked between data in the same row indicate significant differences (P<0.05).

[0085] The SNP molecular marker described in the present invention is located at the 55,577,127th base on chromosome 22 of the yak genome LU_Bosgru_v3.0 version; the mutation type is G / A, named g55577127G>A, and there are three genotypes. When the 55,577,127th base on chromosome 22 is G, the genotype is GG or GA; when the 55,577,127th base on chromosome 22 is A, the genotype is AA. Through the correlation analysis between different genotypes and the contents of immunoglobulins IgA, IgG, IgM, it is found that the immunoglobulins IgA of yak individuals with AA and GA genotypes are significantly higher than those of GG genotype individuals (p<0.05), the immunoglobulins IgG of yak individuals with AA genotype are significantly higher than those of GG genotype individuals (p<0.05), there is no significant difference in immunoglobulins IgA and IgG between AA and GA genotype individuals (p>0.05), and there is also no significant difference between GA and AA genotype yak individuals (p>0.05). The immunoglobulins IgM of yak individuals with AA genotype are significantly higher than those of GA and GG genotype individuals (p<0.05), and the immunoglobulins IgM of yak individuals with GA genotype are significantly higher than those of GG genotype individuals (p<0.05). By detecting the base at the 55,577,127th nucleotide site on chromosome 22 of the yak, the contents of immunoglobulins IgA, IgG, IgM of yak individuals can be judged. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0086] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in the preparation of a product for detecting yak immunity traits or a product for assisting yak immunity breeding, characterized in that: The SNP molecular marker is located at the 55577127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A; The genotype of the yak with the mutant base G is GG or GA; the genotype of the yak with the mutant base A is AA; the content of immunoglobulin A in the yak individuals with the genotype AA and GA is significantly higher than that in the yak individuals with the genotype GG; the content of immunoglobulin G in the yak individuals with the genotype AA is significantly higher than that in the yak individuals with the genotype GG; the content of immunoglobulin M in the yak individuals with the genotype AA is significantly higher than that in the yak individuals with the genotype GA and GG; the content of immunoglobulin M in the yak individuals with the genotype GA is significantly higher than that in the yak individuals with the genotype GG; The yak is Niangya yak.

2. A method for marker-assisted selection of yak immune traits for non-diagnostic purposes, characterized in that: The steps include: (1) Extracting yak genomic DNA; (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair shown in SEQ ID NO: 1-2 to obtain an amplified product; (3) performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators being one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M; The SNP molecular marker is located at the 55577127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A; The genotype of the yak with the mutant base G is GG or GA; the genotype of the yak with the mutant base A is AA; the content of immunoglobulin A in the yak individuals with the genotype AA and GA is significantly higher than that in the yak individuals with the genotype GG; the content of immunoglobulin G in the yak individuals with the genotype AA is significantly higher than that in the yak individuals with the genotype GG; the content of immunoglobulin M in the yak individuals with the genotype AA is significantly higher than that in the yak individuals with the genotype GA and GG; the content of immunoglobulin M in the yak individuals with the genotype GA is significantly higher than that in the yak individuals with the genotype GG; The yak described is Niangya yak.

3. The method according to claim 2, characterized in that The amplification system of step (2) is 25 μL in total, including 12.5 μL of 2×L-Exp TaqMasterMix, 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

4. The method according to claim 2, characterized in that: The amplification program of step (2) was: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

Images