Application of a SNP molecular marker combination in comb length assisted breeding

Five SNP molecular markers related to cockscomb length were screened through GWAS, and genotype determination and breeding were performed, which solved the problem of slow progress in cockscomb length breeding, and achieved the effect of significantly improving cockscomb length breeding and accelerating breeding progress.

CN119265315BActive Publication Date: 2025-06-06JIANGSU INST OF POULTRY SCI +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411627301.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-14
Publication Date
2025-06-06
Estimated Expiration
2044-11-14

AI Technical Summary

Technical Problem

The progress of cockscomb length breeding is slow and the lack of significantly related molecular markers leads to slow breeding progress.

Method used

Five SNP molecular markers significantly related to the length of the cockscomb were screened through Genome-wide association studies (GWAS). These markers were combined for genotype determination and breeding, and individuals with disadvantaged genotypes were eliminated and individuals with dominant genotypes were retained.

Benefits of technology

By selecting and retaining individuals with dominant genotypes, the breeding effect of cockscomb length is significantly improved, and the progress of generational breeding of cockscomb length is accelerated. The average progress of cockscomb length in each generation is increased by 1.7mm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119265315B_ABST
    Figure CN119265315B_ABST
Patent Text Reader

Abstract

The present invention discloses an application of a SNP molecular marker combination in assisted breeding of comb length. The SNP molecular marker combination comprises five SNP sites, namely SNP1 to SNP5, in total. In the molecular marker-assisted breeding of comb length, the method of selecting TT dominant genotype individuals at the SNP1 site, AA dominant genotype individuals at the SNP2 site, AA dominant genotype individuals at the SNP3 site, CC and CA dominant genotype individuals at the SNP4 site, and GG dominant genotype individuals at the SNP5 site, and eliminating individuals with other inferior genotypes can be used to assist in improving the breeding of comb length and accelerate the progress of intergenerational breeding of comb length.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to molecular marker-assisted breeding, and in particular to an application of a SNP molecular marker combination in comb length-assisted breeding. Background Art

[0002] The comb is the most obvious and important feature of the chicken's secondary sexual characteristics, and can be used as an indicator to measure the degree of sexual maturity. The development of the comb is a phenotypic characteristic of sexual development. When live chickens or chilled chickens are put on the market, the combs need to reach a certain degree of development. Generally, the combs are required to be upright, large and red, and not inverted. The length of the comb is an important factor affecting the size of the comb. The longer the comb, the larger the comb area is, and the stronger the heat dissipation capacity is. The combs of healthy chickens are generally upright, large and red, while unhealthy chickens usually have smaller combs, inverted combs, white combs, etc. The comb is an important indicator of the health, disease resistance and nutritional status of chickens. The large arteries and some vertically arranged nerves distributed in the epidermis of the comb can sense external stimuli. The development of the comb is a quantitative trait controlled by multiple genes.

[0003] The comb length trait is a complex quantitative trait controlled by multiple genes. So far, no molecular markers significantly associated with comb length have been found. Currently, comb length is usually directly measured or observed with the naked eye during comb length breeding, and the generational inheritance progress is slow. Therefore, finding molecular markers significantly associated with comb length is of great significance for improving the generational selection progress of comb length. Summary of the invention

[0004] In response to the problem of slow progress in the selection and breeding of comb length mentioned above, the present invention provides an application of a SNP molecular marker combination in assisted breeding of comb length, which assists in improving the selection and breeding of comb length by using 5 SNP molecular markers that are significantly correlated with comb length, thereby accelerating the progress of generational selection and breeding of comb length.

[0005] In order to achieve the above object, the present invention provides an application of a SNP molecular marker combination in assisted breeding of comb length, wherein the SNP molecular marker corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, and the relevant information of the SNP molecular marker significantly correlated with comb length is as follows:

[0006] SNP loci Chromosome location SNP ID Candidate genes Reference genome Mutation site SNP1 5:57812208 rs313797960 FRMD6 C T SNP2 20:11637476 rs312371971 C20orf85 G A SNP3 20:11687004 rs313637016 C20orf85 G A SNP4 24:1881749 rs738049404 NTM C A SNP5 34:1672633 rs3388194039 LRP1 G A

[0007] FERM domain-containing protein 6 (FRMD6), also known as Willin, is involved in physiological functions such as neuronal differentiation, myelination, nerve damage repair and vesicle secretion. Chromosome 20 Open Reading Frame 85 (C20orf85) is involved in body immunity and chicken facial pigmentation. Neurotrimin (NTM) genes promote the response of resident sensory nerves to estrogen and are significantly associated with traits such as chicken oviduct development and differentiation, and age of onset of laying. Low-density lipoprotein receptor-related protein 1 (LRP1) is an important signaling protein that is widely involved in physiological processes such as lipid metabolism, cell movement and disease processes. It is a key mediator of cell signaling and plays a significant role in maintaining the mature phenotype of chondrocytes.

[0008] At present, there are no research reports on the role of FRMD6, C20orf85, NTM, and LRP1 in the development of comb length. The inventors screened out SNP sites of these candidate genes through GWAS (Genome-wide association studies) analysis and found that they were significantly correlated with comb length.

[0009] The screening method of SNP molecular markers is as follows:

[0010] Using the chicken genome bGalGal.mat.broiler.GRCg7b (GCF_016699485.2) as a reference, GWAS sequencing technology and whole genome association analysis were used to obtain 5 regions significantly associated with comb length, including 4 genes. The univariate analysis of variance in the general linear model of SPSS16.0 software was used to perform association analysis and verification of the genotype of the polymorphic site and comb length, and the dominant genotypes of the 5 SNP sites were screened.

[0011] GWAS is a powerful tool for analyzing the genetic structure of quantitative traits in livestock and poultry. The GWAS method is used to study the association between SNP sites and phenotypic values, which can identify molecular markers that affect economic traits and is particularly suitable for complex quantitative traits. Based on this, the present invention screened the molecular markers of comb length through GWAS and obtained 5 SNP molecular markers that were significantly correlated with comb length. Compared with candidate gene and QTL linkage analysis, GWAS has a high marker density, can analyze rare and low-frequency variations, can analyze the genetic structure of complex traits, and can also identify new variations, and the results are more reliable.

[0012] The nucleotide sequences of the primers for the above SNP molecular markers are as follows:

[0013]

[0014] Specifically, the breeding method for increasing the comb length includes the following steps:

[0015] (1) determining the genotype of the chicken to be bred, wherein the genotype is the genotype of the above-mentioned SNP molecular marker combination;

[0016] (2) The chickens to be bred that have the dominant genotype of TT at SNP1, the dominant genotype of AA at SNP2, the dominant genotype of AA at SNP3, the dominant genotypes of CA and CC at SNP4, and the dominant genotype of GG at SNP5 are individuals with relatively high comb length.

[0017] Specifically, in step (1), the method for determining the genotype of the chicken to be bred is:

[0018] (1.1) Extracting the total genomic DNA of the chicken to be tested;

[0019] (1.2) According to the SNP molecular marker combination, the target sequence is amplified by PCR method using the corresponding primer pair, and the sequence of the primer pair is:

[0020] SNP1F: 5'GGTGACAGTCCTGTCCCTGT3'

[0021] SNP1R: 5'GGCTCTAAATGCCCTCAGTG3'

[0022] SNP2F: 5'GCAATCTGCTAGGGCATGTT3'

[0023] SNP2R: 5'CCAGTGCAAAAACCCAAACT3'

[0024] SNP3F: 5'TGGGAAGAGCCTCTGTTTTG3'

[0025] SNP3R: 5'GCGATGCTGAACATTCTCAA3'

[0026] SNP4F: 5'CGTCCATCTCCTCTCCTGTCC3'

[0027] SNP4R: 5'CCCTGCATTTCAGATTTGT3'

[0028] SNP5F: 5'TTGTTCTCGGTCTGTTGCAG3'

[0029] SNP5R: 5'GACCAAGTCCAGCACTGAGC3';

[0030] (1.3) After sequencing the PCR amplification product, determine the genotype.

[0031] The PCR product was sent to a biological company for sequencing, and the resulting sequence was compared with the reference genome of chicken to find the polymorphic site. The nucleotide sequence of the PCR product of the SNP site is as follows:

[0032] SNP1—76bp has a C / T mutation, and the PCR product is 223bp in length.

[0033] GGTGACAGTCCTGTCCCTGTGTGCACCCCGGGGCCGTGTGTGTG CCTCAGGACAAGGCTTATAAAAGTAAATAK(C / T)GCACCCGAGGGGT TTGGAAGCCCCTGTGTGGCTGCGTTTCTTCATCGTTTGTGAAAACGAGTGGCACAAATGGAAGAGCTCATGGCCAGCTCATGGCAGGGCTCAGGGAGCAAACCTCCTGGGGCCACACTGAGGGCATTTAGAGCC

[0034] SNP2-83bp has a G / A mutation, and the PCR product length is 225bp.

[0035] GCAATCTGCTAGGGCATGTTTTGAAACAATTGTTTTTTGAACCTC CACTGTTTGTATTGCACAGGAGGTTTGGAAGTATCAGK(G / A)AATGTGA TGCAGTGCAAGTCTGTCAGACATGTAATGCTGTCACTTTCTTTAAAATAACTAGATCATAGTTTCAGCTGCAGACTGTAAATTGGTGTTGAATCTGTATGGTCAAATAGTTATGAAGTTTGGGTTTTTGCACTGG

[0036] SNP3—G / A mutation at 133bp, PCR product length is 250bp.

[0037] TGGGAAGGCCTCTGTTTTGACTGACAATGAAAGAGCAGTGACATTGGCCAGATTAAGGTGTCCTTCCTCTTTAGGCATTCTACAAAACATAACACCTCAACCATATTATTGTTCCACACTCTCCCTTTCCTGATATTCTCAACACTCTCCCAAGCTATGTGTTGAK(G / A)TATGTCCCTCTGCATGCTAA TTTTACGGAAGGAATAGTCAGGAGTAAAAGAGAATTCCACTTTGAGAA TGTTCAGCATCGC

[0038] SNP4—C / A mutation at 171bp, PCR product length is 250bp.

[0039] CGTCCATCTCCTCTCTGTCCCTATGGGCTATTTGCTCCTCATGTCATTTTTCTGGGATTTGTTGGATATTGGGCAGCTCTGGGCTGGGTGTGAGCTCTCCCTGCTGCACCTGAGCTCAGCCTGCTGTGCAGCAGCACGCAGACACACGCTGTTTGATCCAGTGTAAAAK(C / A)CAGCTGCTACAAAGTC AGCCTGTCAAAAAGGAGTGGGGGGGGAGAAAAGAAAAAGCTGAACA AATCTGAAATGGCAGGG

[0040] SNP5—167bp has a G / A mutation, and the PCR product length is 207bp.

[0041] TTGTTCTCGGTCTGTTGCAGTTTGTCTGCAAGAACGACAAATGCATCCCTTTCTGGTGGAAATGCGACACAGAGGACGACTGCGGGGACCGTTCCGATGAGCCCGAGGACTGCCGTGAGTGCTCCGAAAGCTCTGCTGCTCTGCCCAGGGGACAGCGCTGCTGAAGK(G / A)GGGGGGGTCACCCGTT GCAGCTCAGTGCTGGACTTGGTC

[0042] Note: The K marked in the above sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0043] The specific method for determining the dominant genotype individuals is as follows:

[0044] Firstly, the correlation between single SNP markers and comb length was analyzed. The comb lengths of the five SNPs were significantly different among different genotypes. SNP1 (rs313797960) had three genotypes: CC, CT and TT. The comb length of individuals with TT genotype was significantly longer than those with CT and CC genotypes (P < 0.05). SNP2 (rs312371971) had three genotypes: AA, GA and GG. The comb length of individuals with AA genotype was significantly longer than those with GA and GG genotypes (P < 0.05). 37016) has three genotypes: AA, GA, and GG. The comb length of individuals with AA genotype is significantly longer than that of GA and GG genotypes (P < 0.05). SNP4 (rs738049404) has three genotypes: AA, CA, and CC. The comb length of individuals with CC and CA genotypes is significantly longer than that of AA genotypes (P < 0.05). SNP5 (rs3388194039) has three genotypes: GG, GA, and AA. The comb length of individuals with GG genotype is significantly longer than that of GA and AA genotypes (P < 0.05). Haploview software was used to analyze the linkage disequilibrium (LD) of the five SNPs, and it was found that SNP2 and SNP3 were not in a strong linkage state (R 2 =69<100), and other loci were not in a strong linkage state, so the correlation between the combined genotype of the five SNP loci and comb length was no longer analyzed. The TT genotype of SNP1, the AA genotype of SNP2, the AA genotype of SNP3, the CC and CA genotypes of SNP4, and the GG genotype of SNP5 were the dominant genotypes for comb length and could be used as important molecular markers for molecular-assisted breeding of comb length.

[0045] Through the above technical solution, the present invention achieves the following beneficial effects:

[0046] In the molecular marker-assisted breeding of comb length, the method of selecting individuals with the dominant genotype TT at SNP1, individuals with the dominant genotype AA at SNP2, individuals with the dominant genotype AA at SNP3, individuals with the dominant genotype CC and CA at SNP4, and individuals with the dominant genotype GG at SNP5, and eliminating individuals with other inferior genotypes can be used to assist in improving the breeding of comb length and accelerate the progress of generational breeding of comb length. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Manhattan plots for markers of comb length-related molecules;

[0048] Figure 2 QQ plot of molecular markers related to comb length;

[0049] Figure 3 Linkage disequilibrium analysis diagram of 5 SNP molecular markers. DETAILED DESCRIPTION

[0050] The specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0051] Example 1 Screening of molecular markers significantly associated with comb length

[0052] 1. Experimental Materials

[0053] The test subjects selected were the terminal paternal line A of Lihua yellow-footed chickens. The main selected traits of this line are body weight, comb development, feed conversion rate and slaughter rate. It has undergone 6 generations of closed breeding. The experimental chickens were raised at the Jintan breeding base of Jiangsu Lihua Animal Husbandry Co., Ltd. in Changzhou City, Jiangsu Province. All experimental chickens were hatched from the same batch and raised in the same chicken house. The experimental chickens were raised in two stages. They were raised in cages from 1 to 4 weeks of age and transferred to individual cages after 5 weeks of age. The company's standard breeder feed was used for feeding, and the chickens were free to drink water and eat during the test period. Immunization followed the standard procedures established by the company.

[0054] 2. Comb length measurement

[0055] 400 Lihua yellow-footed chickens of specialized strain A were randomly selected and weighed after fasting for 12 hours. The leg numbers were recorded and the comb lengths of 60-day-old roosters were measured. The specific measurement method was as follows: a vernier caliper was used to measure the length from the front end to the rear end of the comb. All comb lengths were measured by the same person and the measured parts were basically the same.

[0056] 3. Discovery of molecular markers for comb length

[0057] At 60 days of age, 1.5 mL of blood was collected from the subwing vein of all groups whose combs were measured. EDTA was used for anticoagulation. After blood collection, the anticoagulation tube was slowly shaken up and down to allow the EDTA in the tube to fully contact and mix the blood. The anticoagulation tube was stored in an incubator containing an ice pack. After blood collection, it was quickly transported to the laboratory and stored at -20°C for standby use. DNA was extracted using the TIANGEN blood genomic DNA extraction kit (centrifugal column type) (YDP348). DNA integrity and purity were determined by gel migration (1% agarose gel electrophoresis), and the DNA concentration was determined using a Qubit 4 fluorescence quantifier (Thermo Fisher, Shanghai) to ensure that the concentration of the extracted DNA sample was greater than 15 ng / μL.

[0058] Whole genome resequencing: DNA samples that have passed quality inspection are uniformly delivered to Beijing Boya Geya Biotechnology Co., Ltd. for whole genome resequencing, including preparation of genomic libraries and sequencing on the MGISEQ-2000 platform.

[0059] Quality control: The main purpose is to filter the original genome reads of the MGISEQ-2000 platform double-end sequencing, and use the fastp (v.0.20.0) preprocessor (set to default parameters) to remove low-quality reads, adapters, and reads containing poly-N. Finally, the reads obtained after quality control were aligned to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI using BWA (v0.7.17) software; the reads with repeated alignments were removed using Picard software; and high-quality SNP sites were obtained through GATK 4.0 software analysis.

[0060] Whole genome association analysis: PLINK (v1.90p) software was used to perform principal component analysis (PCA) on the SNP sites after quality control to prevent the generation of false positive results due to population stratification. The linear mixed model (LMM) of GEMMA (v0.98.5) software was used to perform association analysis of body weight traits.

[0061] y=Wα+xβ+u+∈,u~MVNn(0,λτ -1 K),∈~MVNn(0,λτ -1 I n )

[0062] Where y is the phenotype vector; W is the fixed effect matrix (the first three principal components including PCA); α is the fixed effect vector; x is the genotype vector, β is the SNP effect vector; u is the random effect vector; ∈ represents the residual vector. MVNn is an n-dimensional multivariate normal distribution, λ is the ratio of genetic variance to residual variance (random effect vector u and residual vector ∈), τ -1 is the residual variance, K is the kinship matrix calculated based on SNP using GEMMA, and I n is the identity matrix.

[0063] The (-indep-pairwise 50 10 0.2) parameter in PLINK software was used to infer the number of effective SNPs for independent testing, and the final inference was that the number of effective independent testing SNPs was 432,529. After multiple testing, the Bonferroni correction method was used to set the significant threshold. In this study, the genome-wide significant threshold and potential significant threshold were 1.16×10-7 (0.05 / number of effective independent test SNPs) and 2.31×10 -6 (1 / number of valid independent test SNPs). The GWAS results were visualized using the Cmplot package in R. The adjacent genes within 100 Kb upstream and downstream of the significant sites were annotated using Bedtools (v2.30.0) software.

[0064] After quality inspection, genome-wide association analysis was performed on the comb length phenotype values ​​of 366 chickens. The results are as follows Figure 1 , Figure 2 As shown in the figure. From the Manhattan plot, we can see that there are potential genomic significant level markers on chromosomes 5, 20, 24 and 34 of chickens, specifically located at four candidate genes: FRMD6, C20orf85, C20orf85, NTM and LRP1. The QQ plot further verifies that the GWAS results are reliable. The molecular markers of comb length screened are summarized as shown in Table 1:

[0065] Table 1 Molecular markers significantly associated with comb length

[0066]

[0067] The physical position of the marker chromosome is referenced to the whole chicken genome (bGalGal1.mat.broiler.GRCg7b).

[0068] 4. Genetic polymorphism analysis of 5 SNPs significantly associated with comb length

[0069] The genotype frequency, gene frequency, and heterozygosity (He) of the five SNP molecular markers obtained by PopGene (version 1.31) were analyzed, and the chi-square test was used to detect whether the SNP loci were in Hardy-Weinberg (HW) equilibrium. The analysis results are shown in Table 2.

[0070] As shown in Table 2, all five SNPs have three genotypes. After HW equilibrium test, the five SNPs (SNP1-SNP4) are in HW equilibrium (P>0.05), and SNP5 is not in HW equilibrium (P<0.05). The five SNPs have medium genetic diversity (0.25 <He<0.50)。

[0071] Table 2 Genetic polymorphisms of 5 SNP loci and Hardy-Weinberg equilibrium test

[0072]

[0073]

[0074] 5. Analysis of dominant genotypes of comb length SNP molecular markers

[0075] The association analysis between polymorphic locus genotype and comb length was performed using univariate analysis of variance in the general linear model of SPSS16.0 software. Fixed factors: different genotypes of SNP markers, dependent variables: comb length, LSD method was used to compare the significance of comb length between different marker genotypes, P < 0.05 indicated significant difference.

[0076] First, the correlation between single SNP markers and comb length was analyzed, and the results are shown in Table 3. As shown in Table 3, the comb lengths of the five SNPs were significantly different among different genotypes. SNP1 (rs313797960) had three genotypes: CC, CT, and TT. The comb length of individuals with the TT genotype was significantly longer than that of individuals with the CT and CC genotypes (P < 0.05). SNP2 (rs312371971) had three genotypes: AA, GA, and GG. The comb length of individuals with the AA genotype was significantly longer than that of individuals with the GA and GG genotypes (P < 0.05). SNP3 (rs313637016) had a There are three genotypes: AA, GA, and GG. The comb length of individuals with AA genotype is significantly longer than that of GA and GG genotypes (P < 0.05). SNP4 (rs738049404) has three genotypes: AA, CA, and CC. The comb length of individuals with CC and CA genotypes is significantly longer than that of AA genotypes (P < 0.05). SNP5 (rs3388194039) has three genotypes: GG, GA, and AA. The comb length of individuals with GG genotype is significantly longer than that of GA and AA genotypes (P < 0.05). Haploview software was used to analyze the degree of linkage disequilibrium (LD) of the five SNPs. The results of linkage disequilibrium analysis are shown in Figure 3 . Figure 3 The value in the box is obtained by multiplying the D' value by 100. Figure 3 It can be seen that the five SNP loci are not in a strong linkage state (D' value <1, R 2 <100), so the correlation between the combined genotype of the five molecular markers and comb length was no longer analyzed.

[0077] In breeding, the method of selecting individuals with the dominant genotype TT at SNP1, individuals with the dominant genotype AA at SNP2, individuals with the dominant genotype AA at SNP3, individuals with the dominant genotype CC and CA at SNP4, and individuals with the dominant genotype GG at SNP5, and eliminating individuals with other inferior genotypes can assist in improving the selection and breeding of comb length and accelerate the progress of generational selection and breeding of comb length.

[0078] Table 3 Association analysis between gene loci and comb length traits (mean ± SD)

[0079]

[0080] Example 2 Molecular marker-assisted breeding of comb length

[0081] At 60 days of age, the chickens in the terminal paternal line A of Lihua Huangjiao Ma chicken were genotyped, and the dominant genotype individuals with longer comb length were retained. The specific plan is as follows:

[0082] (1) At 60 days of age, blood was collected from the wing vein of 600 A-line roosters using a disposable syringe, and DNA was extracted using the phenol-chloroform method to extract the total genomic DNA of the chickens to be tested;

[0083] PCR amplification primers: Download DNA template sequence information from the NCBI website, and use primer premier software to design primers for related gene SNP sites (rs313797960, rs312371971, rs313637016, rs738049404, rs3388194039). The relevant information of primer sequences is shown in Table 4.

[0084] Table 4 Primer sequence related information

[0085]

[0086] (2) PCR amplification, electrophoresis and sequencing genotyping: The PCR amplification products were analyzed by 1.5% agarose gel electrophoresis and sequenced for genotyping. Genotyping was performed on the A-line roosters of Lihua Mahuang chickens, and the dominant genotype individuals with longer comb length were retained.

[0087] PCR total reaction system 50 μL: DNA template 4 μL, dNTP (2 mmol / L) 2 μL, Mg 2+ (3mmol·L -1 )0.6μL, 1×PCR reaction buffer 5μL, upstream and downstream primers (10μmol·L -1 ) 1 μL each, Taq polymerase (1U·μL -1 )2.5μL, add ultrapure water to 50μL.

[0088] PCR reaction program: 95℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, 35 cycles in total; 72℃ extension for 5min. PCR amplified target fragments were detected by 1.5% agarose gel electrophoresis.

[0089] The PCR amplification products were sent to a sequencing company for sequence polymorphism detection. The nucleotide sequences of the PCR products of the five SNPs sites are as follows:

[0090] SNP1—76bp has a C / T mutation, and the PCR product is 223bp in length.

[0091] GGTGACAGTCCTGTCCCTGTGTGCACCCCGGGGCCGTGTGTGTG CCTCAGGACAAGGCTTATAAAAGTAAATAK(C / T)GCACCCGAGGGGT TTGGAAGCCCCTGTGTGGCTGCGTTTCTTCATCGTTTGTGAAAACGAGTGGCACAAATGGAAGAGCTCATGGCCAGCTCATGGCAGGGCTCAGGGAGCAAACCTCCTGGGGCCACACTGAGGGCATTTAGAGCC

[0092] SNP2-83bp has a G / A mutation, and the PCR product length is 225bp.

[0093] GCAATCTGCTAGGGCATGTTTTGAAACAATTGTTTTTTGAACCTC CACTGTTTGTATTGCACAGGAGGTTTGGAAGTATCAGK(G / A)AATGTGA TGCAGTGCAAGTCTGTCAGACATGTAATGCTGTCACTTTCTTTAAAATAACTAGATCATAGTTTCAGCTGCAGACTGTAAATTGGTGTTGAATCTGTATGGTCAAATAGTTATGAAGTTTGGGTTTTTGCACTGG

[0094] SNP3—G / A mutation at 133bp, PCR product length is 250bp.

[0095] TGGGAAGGCCTCTGTTTTGACTGACAATGAAAGAGCAGTGACATTGGCCAGATTAAGGTGTCCTTCCTCTTTAGGCATTCTACAAAACATAACACCTCAACCATATTATTGTTCCACACTCTCCCTTTCCTGATATTCTCAACACTCTCCCAAGCTATGTGTTGAK(G / A)TATGTCCCTCTGCATGCTAA TTTTACGGAAGGAATAGTCAGGAGTAAAAGAGAATTCCACTTTGAGAA TGTTCAGCATCGC

[0096] SNP4—C / A mutation at 171bp, PCR product length is 250bp.

[0097] CGTCCATCTCCTCTCTGTCCCTATGGGCTATTTGCTCCTCATGTCATTTTTCTGGGATTTGTTGGATATTGGGCAGCTCTGGGCTGGGTGTGAGCTCTCCCTGCTGCACCTGAGCTCAGCCTGCTGTGCAGCAGCACGCAGACACACGCTGTTTGATCCAGTGTAAAAK(C / A)CAGCTGCTACAAAGTC AGCCTGTCAAAAAGGAGTGGGGGGGGAGAAAAGAAAAAGCTGAACA AATCTGAAATGGCAGGG

[0098] SNP5—167bp has a G / A mutation, and the PCR product length is 207bp.

[0099] TTGTTCTCGGTCTGTTGCAGTTTGTCTGCAAGAACGACAAATGCATCCCTTTCTGGTGGAAATGCGACACAGAGGACGACTGCGGGGACCGTTCCGATGAGCCCGAGGACTGCCGTGAGTGCTCCGAAAGCTCTGCTGCTCTGCCCAGGGGACAGCGCTGCTGAAGK(G / A)GGGGGGGTCACCCGTT GCAGCTCAGTGCTGGACTTGGTC

[0100] Note: The K marked in the above sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0101] (3) Method for measuring comb length at 60 days of age: Use a vernier caliper to measure the length from the front end to the back end of the comb. All comb length measurements are performed by the same person and the measured parts are basically the same.

[0102] (4) Molecular marker-assisted selection of comb length

[0103] The TT genotype at SNP1, the AA genotype at SNP2, the AA genotype at SNP3, the CC and CA genotypes at SNP4, and the GG genotype at SNP5 were the dominant genotypes for comb length.

[0104] In the molecular marker-assisted breeding of comb length, by selecting individuals with the dominant genotype TT at SNP1, individuals with the dominant genotype AA at SNP2, individuals with the dominant genotype AA at SNP3, individuals with the dominant genotype CC and CA at SNP4, and individuals with the dominant genotype GG at SNP5, and eliminating individuals with other inferior genotypes, the method can be used to assist in improving the selection of comb length and accelerate the progress of generational selection of comb length.

[0105] Through whole genome association analysis, 5 SNP molecular markers significantly correlated with comb length were screened out. The molecular marker-assisted breeding verification experiment on the comb length of the 5th and 6th generations of Lihua Huangjiao Ma Chicken's terminal paternal line A showed that the operation is simple and can increase the comb length more quickly. As shown in Table 5, after 2 generations of breeding, the rooster comb thickness of the 5th generation increased by 1.80mm compared with the 4th generation, and the 6th generation increased by 1.59mm compared with the 5th generation, with an average increase of about 1.7mm per generation. Compared with the 2nd to 4th generations, the comb length of each generation increased by about 0.8mm, the comb length of the 5th and 6th generations increased significantly, the coefficient of variation also decreased significantly, the uniformity increased significantly, and the progress of comb length breeding was accelerated.

[0106] Table 5 Results of comb length measurement of different generations of Lihua Ephedra chicken strain A

[0107]

[0108] Measurement age: 60 days

[0109] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0110] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0111] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. Application of a SNP molecular marker combination in assisted breeding of comb length of yellow-footed chicken, characterized in that: The SNP molecular marker combination includes the following five SNP sites, SNP1 to SNP5: SNP1 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, chromosome 5, sense strand, number 57812208, which is a C or T polymorphism and is numbered rs313797960; SNP2 corresponds to position 11637476 of the positive strand of chromosome 20 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a G or A polymorphism and is numbered as rs312371971; SNP3 corresponds to position 11687004 of the positive strand of chromosome 20 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a G or A polymorphism and is numbered rs313637016; SNP4 corresponds to position 1881749 of the positive strand of chromosome 24 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a C or A polymorphism and is numbered rs738049404; SNP5 corresponds to position 1672633 of the positive strand of chromosome 34 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is a G or A polymorphism and is numbered rs3388194039; The dominant genotype of SNP1 is TT, the dominant genotype of SNP2 is AA, the dominant genotype of SNP3 is AA, the dominant genotype of SNP4 is CA and CC, and the dominant genotype of SNP5 is GG. The chickens to be bred with the dominant genotypes are individuals with relatively long comb lengths.

2. A breeding method for increasing the comb length of yellow-footed chicken, characterized in that: The steps include: (1) Determining the genotype of the chicken to be bred, wherein the genotype is the genotype of the SNP molecular marker combination according to claim 1; (2) The chickens to be bred that have the dominant genotype TT at SNP1, the dominant genotype AA at SNP2, the dominant genotype AA at SNP3, the dominant genotypes CA and CC at SNP4, and the dominant genotype GG at SNP5 are individuals with relatively long comb lengths.

3. The breeding method according to claim 2, characterized in that: In step (1), the method for determining the genotype of the chicken to be bred is: (1.1) Extracting the total genomic DNA of the chicken to be tested; (1.2) According to the SNP molecular marker combination, the target sequence is amplified by PCR method using the corresponding primer pair, and the sequence of the primer pair is: SNP1F: 5'GGTGACAGTCCTGTCCCTGT3' SNP1R: 5'GGCTCTAAATGCCCTCAGTG3' SNP2F: 5'GCAATCTGCTAGGGCATGTT3' SNP2R: 5'CCAGTGCAAAAACCCAAACT3' SNP3F: 5'TGGGAAGAGCCTCTGTTTTG3' SNP3R: 5'GCGATGCTGAACATTCTCAA3' SNP4F: 5'CGTCCATCTCCTCTCCTGTCC3' SNP4R: 5'CCCTGCATTTCAGATTTGT3' SNP5F: 5'TTGTTCTCGGTCTGTTGCAG3' SNP5R: 5'GACCAAGTCCAGCACTGAGC3'; (1.3) After sequencing the PCR amplification product, determine the genotype.

4. The breeding method according to claim 3, characterized in that: The nucleotide sequences of the PCR amplification products are shown in SEQ ID NO.1 to SEQ ID NO.5, and the lengths of the PCR products are 223 bp, 225 bp, 250 bp, 250 bp, and 207 bp.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker combination related to number of teeth of Nandan Yao cockscomb based on whole genome sequencing screening and application of SNP molecular marker combination

    CN117106923A

  • Feeding device for poultry having non-sharp-edged circumferentially closed bars or other parts delimiting feed openings between the bars

    US20110107972A1